Inhibition of Real-Time PCR in DNA Extracts from Aquifer Sediment

Variation in inhibition of real-time PCR was investigated with DNA extracts from 50 aquifer sediment core samples of 5 cm length collected through a 2.5 meter vertical profile across a landfill leachate plume. The inhibition was quantified using an internal control of the green fluorescent protein ( gfp ) gene, which was spiked into the real-time PCR reactions. The inhibition was investigated at two gfp gene concentrations: at 1.7 · 10 ⁷ gfp gene copies/g sediment (5.1 · 10 ⁴ gfp gene copies/PCR reaction) and at 1.7 · 10 ⁵ gfp gene copies/g sediment (5.1 · 10 ² gfp gene copies/PCR reaction). Despite the low TOC content of the sediment (average 0.4 mg C/g dw) the average real-time PCR response was partially inhibited, compared to a reference (pure water), at both high and low gfp concentrations. The relative amplification (reference = 1) was 0.85 ± 0.20 (high) and 0.66 ± 0.23 (low), showing significantly (P < 0.05) stronger inhibition at the lower target gene concentration. The inhibition of the real-time PCR did not show a systematic variation in the vertical profile related to plume position but variations were significant on a small scale of 5–15 cm depth intervals. One of the 50 samples failed to produce a signal with either concentration of the gfp internal control and three other samples inhibited real-time PCR at both high and low gfp concentration. These 4 samples, which were the samples with the highest inhibition, were the only DNA extracts with a visible brown colouration, indicating contents of humic-like substances. Elevated absorbance at 400 nm of these samples also indicated that humic-like substances were responsible for inhibition. However, other factors not associated with either absorbance or TOC may have contributed to the inhibition in less inhibited samples since the variation in real-time PCR response could not be sufficiently explained by absorbance or TOC. The results of this study suggest that an internal control is needed in real-time PCR reactions with DNA from environmental samples due to variation in inhibition to correctly quantify the number of target genes, especially at low target gene concentrations, when dilution of DNA extracts is not practical.     

Novel Synthesis and Biological Evaluation of the First Pyrazole Thioglycosides as Pyrazofurin Analogues

This study reports a novel and efficient method for the synthesis of the first reported novel class of pyrazole thioglycosides 6a–h. These series of compounds were designed through the reaction of sodium 2-cyano-3-oxo-3-(4-substitutedphenylamino)prop-1-ene-1,1-bis(thiolate) salts 2 with hydrazine hydrate in ethanol at room temperature to give the corresponding sodium 5-amino-4-(substitutedphenylcarbamoyl)-1H-pyrazole-3-thiolates 3a–d. The latter compounds were treated with protected α-D-gluco- and galacto-pyranosyl bromides 4a,b in DMF at ambient temperature to give in a high yields the corresponding pyrazole thioglycosides 6a–h. Treatment of pyrazole salts 3a–d with hydrochloric acid at amobient temperature afforded the corresponding 3-mercaptopyrazole derivatives 5. The latter compounds were treated with peracetylated sugars 4 in sodium hydride in ethanol at ambient temperature to tolerate the S-glycosyl 6a–h compounds. Ammonolysis of the pyrazole thioglycosides 6a–h afforded the corresponding free thioglycosides 7a–h. The toxicity and antitumor activities of the synthesized compounds were studied.     

Biotransformation of mestanolone and 17-methyl-1-testosterone by Rhizopus stolonifer

Abstract

Microbial transformation of mestanolone (1) using the plant pathogenic fungus, Rhizopus stolonifer, resulted in the production of two known metabolites, identified as 11α-hydroxymestanolone (3) and 6α-hydroxymestanolone (4). Transformation of 17-methyl-1-testosterone (2) by R. stolonifer yielded two known metabolites, methandrostenolone (5) and 11α,17β- dihydroxy-androsta-1,4-diene-3-one (6). These transformations included α-hydroxylations at C-11 and C-6, dehydrogenation at C-4, androsta and a demethylation at C-17 positions. Structures of transformed products were determined using spectroscopic techniques.     

Novel synthesis of new pyrazole thioglycosides as pyrazomycin analogues

This study reports a novel method for the synthesis of a new class of pyrazole thioglycosides 7a-h as pyrazomycin analogues. These series of compounds were designed through the reaction of sodium 2-cyano-3-oxo-3-(4-substitutedphenylamino)prop-1-ene-1,1-bis(thiolate) salts 2 with phenyl hydrazine in ethanol at room temperature to give the corresponding sodium 5-amino-4-(substitutedphenylcarbamoyl)-1-phenyl-1H-pyrazole-3-thiolates 3a-d. The latter compounds were treated with tetra-acetylated glycosyl bromides 4a,b in DMF at ambient temperature to give the corresponding pyrazole thioglycosides 6a-h. Treatment of pyrazole salts 3a–d with hydrochloric acid at room temperature afforded the corresponding 3-mercaptopyrazole derivatives 5. The latter compounds were treated with tetra-acetylated glycosyl bromides 4 in sodium hydride-DMF to tolerate the S-glycosyl 6a-h compounds. Ammonolysis of the latters afforded the corresponding free thioglycosides 7a-h. The structures of the reaction products were elucidated based on spectral data and elemental analysis.     

First novel synthesis of triazole thioglycosides as ribavirin analogues

This study reports a novel and efficient method for the synthesis of the first reported novel class of triazole thioglycosides. These series of compounds were designed through the reaction of potassium cyanocarbonimidodithioate 2 with hydrazine derivatives 3a-d in EtOH at room temperature to give the corresponding potassium 5-amino-1H-1,2,4-triazole-3-thiolates 4a-d. The latter compounds were treated with tetra-O-acetyl-α-D-glucopyranosyl bromide 6a and tetra-O-acetyl-α-D-galactopyranosyl bromide 6b in DMF at room temperature to give in high yields the corresponding triazole thioglycosides 7a-h. Treatment of triazole salts 4a–d with hydrochloric acid afforded the corresponding 3-mercaptotriazoles 5a-d. Compounds 5a-d were then reacted with bromoperacetylated sugars 6a,b in sodium hydride-DMF at ambient temperature to afford the thioglycosyl compounds 7a-h. Ammonolysis of the triazole thioglycosides 7a-h afforded the corresponding free thioglycosides 8a-h. The scope and limitation of the method is demonstrated. The structure of the reaction products was confirmed on the basis of their elemental analysis and spectral data (IR, ¹H NMR, MS and ¹³C NMR).     

New Steroidal Glycosides from Rhizomes of Clintonia udensis

A total of 10 steroidal glycosides, together with three new spirostanol glycosides (6–8), a new furostanol glycoside (9), and a new cholestane glycoside (10), were isolated from the rhizomes of Clintonia udensis (Liliaceae). The structures of the new compounds were determined on the basis of extensive spectroscopic analyses, including 2-D nuclear magnetic resonance (NMR) data, and of hydrolytic cleavage followed by chromatographic or spectroscopic analyses. The isolated glycosides were evaluated for their cytotoxic activity against HL-60 leukemia cells. Spirostanol glycosides 1 and 2, and furostanol glycoside 4 showed cytotoxic activity with IC₅₀ values of 3.2±0.02, 2.2±0.12, and 2.2±0.06 μg/ml, respectively. Neither the spirostanol and furostanol saponins with a hydroxy group at C-1 (6 and 9) and C-12 (7 and 8) nor cholestane glycosides (5 and 10) exhibited apparent cytotoxic activity at a sample concentration of 10 μg/ml.     

Kinetics and DFT studies on the reaction of copper(II) complexes and H2O2

Copper(II) complexes supported by bulky tridentate ligands L1^H (N,N-bis(2-quinolylmethyl)-2-phenylethylamine) and L1^Ph (N,N-bis(2-quinolylmethyl)-2,2-diphenylethylamine) have been prepared and their crystal structures as well as some physicochemical properties have been explored. Each complex exhibits a square pyramidal structure containing a coordinated solvent molecule at an equatorial position and a weakly coordinated counter anion (or water) at an axial position. The copper(II) complexes reacted readily with H₂O₂ at a low temperature to give mononuclear hydroperoxo copper(II) complexes. Kinetics and DFT studies have suggested that, in the initial stage of the reaction, deprotonated hydrogen peroxide attacks the cupric ion, presumably at the axial position, to give a hydroperoxo copper(II) complex retaining the coordinated solvent molecule (H ^R ·S). H ^R ·S then loses the solvent to give a tetragonal copper(II)-hydroperoxo complex (H ^R ), in which the –OOH group may occupy an equatorial position. The copper(II)–hydroperoxo complex H ^R exhibits a relatively high O–O bond stretching vibration at 900 cm⁻¹ compared to other previously reported examples.Electronic Supplementary Material Supplementary material is available for this article at     

Synthesis of N-Aryl Uracils and Hypoxanthines and Their Biological Properties

Abstract

1-Benzyluracils 2a,b were treated with iodobenzene in the presence of cuprous oxide in 2,4,6-trimethylpyridine at 180°C to give the N ¹-phenyl derivatives 3a and 3b in 47% and 55%, respectively. Similar reaction of 2a with 2-bromopyridine at 120°C gave the 3-(2-pyridinyl)uracil 4a in 42% yield. However, unusual product 5 as well as 3-(2-pyridinyl) derivative 4b were obtained in the case of 2b. The structure of 5 was identified as 1-(2,6-difluorobenzyl)-3-[(2,4-dimethyl-2-pyridinyl)methyl]uracil from spectroscopic data. Reaction of the hypoxanthines 7a,b with 2-bromopyridine gave the 1-(2-pyridinyl)hypoxanthines 8a,b in low yields. But N-phenylation of 7a,b were unsuccessful.     

The Origin and Age of Biogeochemical Trends in Deep Fracture Water of the Witwatersrand Basin,South Africa

Water residing within crustal fractures encountered during mining at depths greater than 500 meters in the Witwatersrand basin of South Africa represents a mixture of paleo-meteoric water and 2.0–2.3 Ga hydrothermal fluid. The hydrothermal fluid is highly saline, contains abiogenic CH ₄ and hydrocarbon, occasionally N ₂ , originally formed at ～ 250–300°C and during cooling isotopically exchanged O and H with minerals and accrued H ₂ , ⁴ He and other radiogenic gases. The paleo-meteoric water ranges in age from ～ 10 Ka to > 1.5 Ma, is of low salinity, falls along the global meteoric water line (GMWL) and is CO ₂ and atmospheric noble gas-rich. The hydrothermal fluid, which should be completely sterile, has probably been mixing with paleo-meteoric water for at least the past ～100 Myr, a process which inoculates previously sterile environments at depths > 2.0 to 2.5 km. Free energy flux calculations suggest that sulfate reduction is the dominant electron acceptor microbial process for the high salinity fracture water and that it is 10 ⁷ times that normally required for cell maintenance in lab cultures. Flux calculations also indicate that the potential bioavailable chemical energy increases with salinity, but because the fluence of bioavailable C, N and P also increase with salinity, the environment remains energy-limited. The ⁴ He concentrations and theoretical calculations indicate that the H ₂ that is sustaining the subsurface microbial communities (e.g. H ₂ -utilizing SRB and methanogens) is produced by water radiolysis at a rate of ～1 nM yr ^?1 . Microbial CH ₄ mixes with abiogenic CH ₄ to produce the observed isotopic signatures and indicates that the rate of methanogenesis diminishes with depth from ～ 100 at < 1 kmbls, to < 0.01 nM yr ^?1 at > 3 kmbls. Microbial Fe(III) reduction is limited due to the elevated pH. The δ¹³C of dissolved inorganic carbon is consistent with heterotrophy rather than autotrophy dominating the deeper, more saline environments. One potential source of the organic carbon may be microfilms present on the mineral surfaces.     

Microbial hydroxylation of epiandrosterone by Aspergillus candidus

In this work, Aspergillus candidus MRC 22634 converted epiandosterone 1 into 10 hydroxylated metabolites. A. candidus has been shown to hydroxylate 1 predominantly at C-11α, C-1α, and C-15β with minor hydroxylations occurring at C-14α and C-7α. Oxidation at C-3, reduction at C-17, and C-3 epimerization of some of the remaining substrate have also been shown. 15β-Hydroxylation and C-3 epimerization of 1 by a fungus were reported for the first time. Two of the metabolites, 1α,3α-dihydroxy-5α-androstan-17-one 4 and 15β,17β-dihydroxy-5α-androstan-3-one 7, were identified as new compounds.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

The reaction force and the transition region of a reaction

The reaction force F(R) and the position-dependent reaction force constant κF(R) are defined by F(R)=-∂V(R)/∂R and κ(R)=∂²V(R)/∂R², where V(R) is the potential energy of a reacting system along a coordinate R. The minima and maxima of F(R) provide a natural division of the process into several regions. Those in which F(R) is increasing are where the most dramatic changes in electronic properties take place, and where the system goes from activated reactants (at the force minimum) to activated products (at the force maximum). κ(R) is negative throughout such a region. We summarize evidence supporting the idea that a reaction should be viewed as going through a transition region rather than through a single point transition state. A similar conclusion has come out of transition state spectroscopy. We describe this region as a chemically-active, or electronically-intensive, stage of the reaction, while the ones that precede and follow it are structurally-intensive. Finally, we briefly address the time dependence of the reaction force and the reaction force constant.     

Synthesis and in vitro evaluation of antiviral and cytostatic properties of novel 8-triazolyl acyclovir derivatives

Abstract

As a part of the research aimed on identification of new nucleobase derivatives with improved biological properties, a series of novel 8-substituted acyclovir derivatives were synthesized. The 8-azidoguanosine 4 and novel 8-azidoacyclovir 9 were synthesized from commercially available guanosine 1 and acyclovir 6 which were transformed into 8-bromopurine derivatives 2 and 7 and hydrazine derivatives 3 and 8, respectively. 8-Triazolylguanosine 5 and 8-triazolylacyclovir analogs 10–12 were successfully synthesized via the Cu(I) catalyzed 1,3-dipolar cycloaddition reaction of azides 4 and 9 with propargyl alcohol, 4-pentyn-1-ol and 5-hexyn-1-ol. The novel 1,4-disubstituted 1,2,3-triazolyl compounds 5, 10–12 were evaluated for antiviral activity against selected DNA and RNA viruses and cytostatic activity against normal Madine Darby canine kidney (MDCK I) cells, and seven tumor cell lines (HeLa, CaCo-2, NCI-H358, Jurkat, K562, Raji and HuT78). While tested compounds exerted no antiviral activity at nontoxic concentrations, the 8-triazolyl acyclovir derivative 10, with the shortest alkyl substituent at the C-4 of triazole ring, was found to be the most active against the CaCo-2 cell line.     

Tryptophol Metabolism by a Species of Arthrobacter

The stereochemistry of some dihydrofurano-isoflavones previously isolated from white lupin roots, or obtained following fungal metabolism of prenylated isoflavones, was investigated using CD spectroscopy. The osmate ester/pyridine complex of dextrorotatory lupinisoflavone A (1) exhibited a positive CD Cotton effect at 480 nm, indicating a side-structure configuration (S at C- 2″), opposite to that of natural rotenone (9), which afforded a negative Cotton effect at 474 nm (R- configuration at C-2′ on the side structure [ring E]). The stereochemistry of the laevorotatory luteone metabolite BC-1 (2) and lupinisoflavone D (4) (both ^-configuration at C-2″) was similarly determined after converting to the corresponding dehydrate (10) or trimethyl-dehydrate (1b, 10a).     

Behavioural responses of non-breeding waterbirds to drone approach are associated with flock size and habitat

ABSTRACT

Capsule: Non-breeding waterbirds are more likely to respond to drone approach when in larger flocks, and responses are more likely in arable and coastal habitats than at inland lochs.

Aims: To investigate the extent to which drones are a potential source of disturbance to non-breeding waterbirds.

Methods: Using a commercially available quadcopter drone, we approached waterbird flocks of varying sizes in coastal, freshwater, and arable habitats following a standardized protocol.

Results: Waterbirds at coastal sites and in arable fields were more likely to respond to drone approach than those at inland freshwater bodies. Larger flocks were more likely to respond to drone approach and responded at a greater distance than smaller flocks.

Conclusion: Repeated drone use at coastal and arable sites with large aggregations of feeding or roosting waterbirds could cause energetically costly flight responses, increased stress, and effective loss of available habitat. At such sites, it may be beneficial to regulate recreational and commercial drone use to minimize potential disturbance effects.     

Indole-based hydrazide-hydrazones and 4-thiazolidinones: synthesis and evaluation as antitubercular and anticancer agents

A new series of indolylhydrazones (6) and indole-based 4-thiazolidinones (7, 8) have been designed, synthesized and screened for in vitro antitubercular activity against Mycobacterium tuberculosis H37Rv. 4-Thiazolidinone derivatives 7g–7j, 8g, 8h and 8j displayed notable antituberculosis (anti-TB) activity showing 99% inhibition at MIC values ranging from 6.25 to 25.0?µg/ml. Compounds 7g, 7h, 7i, 8h and 8j demonstrated anti-TB activity at concentrations 10-fold lower than those cytotoxic for the mammalian cell lines. The indolylhydrazone derivative 6b has also been evaluated for antiproliferative activity against human cancer cell lines at the National Cancer Institute (USA). Compound 6b showed an interesting anticancer profile against different human tumor-derived cell lines at sub-micromolar concentrations with obvious selectivity toward colon cancer cell line COLO 205.     

Potential Inhibitors of Angiogenesis. Part II: 3-(Azolylmethylene)-2,3-dihydrobenzo[b]furan-2-ones

The synthesis and pharmacological evaluation of new 3-(imidazol-4(5)-ylmethylene)-2,3-dihydrobenzo[b]furan-2-ones 8-10 and 3-(3,5-dimethylpyrrol-2-ylmethylene)-2,3-dihydrobenzo[b]furan-2-one 11, analogues of SU-5416, as potential inhibitors of angiogenesis, are reported. Compounds 8 and 11 were prepared by a Knoevenagel reaction starting from 2-hydroxyphenylacetic acid 2 and 4-formylimidazole 5 or 2-formyl-3,5-dimethylpyrrole 7, followed by acid-catalysed cyclodehydration. For compounds 9 and 10, an alternative method was used; it consisted in carrying out the Knoevenagel reaction with the 2,3-dihydrobenzo[b]furan-2-ones 3 and 4. The antiangiogenic activity of these compounds was evaluated in the three-dimensional in vitro rat aortic rings test at 1 μM. At this concentration, compound 11 induced a decrease of angiogenesis comparable to that observed with SU-5416; the vascular density index at 1 μM of 11 and SU-5416 were 30±10 and 22±4% of control, respectively.     

Twenty-Four-Hour Variations in the Sensitivity of Rat Aorta to Vasoactive Agents

The presence of time-dependent variations in the in vitro sensitivity of aorta preparations to either vasoconstricting or relaxing agents was investigated in rats maintained in light from 08: 00 to 20: 00 and in darkness from 20: 00 to 08: 00. Rat thoracic aorta rings were obtained from animals sacrificed at four different times of the day. The rat aorta was found to be more sensitive to the constricting effect of phenylephrine at 15: 00, and of 5-hydroxytryptamine at 21: 00. On the other hand, both endothelium-dependent and -independent relaxations were more remarkable at 03: 00 than at other times of the day. These variations represented significant circadian rhythms when analyzed by analysis of variance. Different in vitro responsiveness to these agents might reflect changes in the sensitivity and/or number of related receptors in vascular preparations. In conclusion, the circadian time of animal sacrifice to obtain vascular preparations constitutes an important aspect of the research method and a key determinant of findings. (Chronobiology International, 13(6), 465–475, 1996)     

Synthesis and anticonvulsant activity of some 2-(2-{1-[substituted phenyl]ethylidene}hydrazinyl)-4-(4-methoxy-phenyl)-6-oxo-1,6-dihydro-pyrimidine-5-carbonitrile

A series of dihydro-pyrimidine-5-carbonitrile derivatives (3–16) were synthesized and evaluated for their anticonvulsant activity against MES and scPTZ models. Motor impairment screening was carried out by rotarod test method and CNS depressant effect was determined by Porsolt’s force swim pool method. Compounds 4 and 9 having p-substituted bromo and m-substituted nitro groups, respectively, were found to be most active showing activity both in MES and scPTZ screen at lower doses of 30 mgkg^?1 at 0.5?h and 100 mgkg^?1 at 4?h. In the rotarod motor impairment screen, compound 4 did not show any motor impairment even at the maximum dose of 300 mgkg^?1; however, compound 9 showed motor impairment at 300 mgkg^?1 dose after 4.0?h. The compounds were also tested for their CNS depression effect. The compounds 4 and 9 showed 41.38 and 43.44% increase in immobility time with respect to control. The pharmacophore hypothesis also fits best for compounds 4 and 9.     

Synthesis of N-substituted indole-2-carboxamides and investigation of their biochemical responses against free radicals

The antioxidant role of novel N-substituted indole-2-carboxamides (I2CDs) was investigated for their inhibitory effects on superoxide anion (O₂^? ) and lipid peroxidation (LP). Among the synthesized I2CDs, 3, 4, 6, 8 and 9 significantly inhibited O₂^{· ?} with an inhibition range at 70–98%. Examination of substituent effects on activity showed that both the ortho- and para-positions of the benzamide residue needs to be dichlorinated in order to get a maximum inhibitory effect on superoxide anion. In general, halogenated derivatives were found more active then the non-halogenated ones. However, none of the I2CDs had a significant inhibitory effects on the level of lipid peroxidation; only compounds 7 and 10 moderately decreased LP levels by over 50% at 10^{? 3} M concentrations.