Highly repetitive tRNA(Pro)-tRNA(His) gene cluster from Photobacterium phosphoreum.

A DNA fragment comprising the four tRNA gene sequences of the Escherichia coli argT locus hybridized with two Sau3A-generated DNA fragments from the vibrio Photobacterium phosphoreum (ATCC 11040). Detailed sequence analysis of the longer fragment shows the following gene organization: 5'-promoter-tRNA(Pro)-tRNAPro-tRNA(Pro)-tRNA(His)-tRNA(Pro)-tRNA(Pro)- tRNA(His)-tRNA(Pro)-five pseudogenes derived from the upstream tRNAPro interspersed by putative Rho-independent terminators. This sequence demonstrates the presence of highly repetitive, tandem tRNA genes in a bacterial genome. Furthermore, a stretch of 304 nucleotides from this cluster was found virtually unchanged in the other (shorter) fragment which was previously sequenced. The two clusters together contain eight tRNA(Pro) pseudogenes and eight fully intact tRNA(Pro) genes, an unusually high number for a single eubacterial isoacceptor tRNA. These results show that the organization of some tRNA operons is highly variable in eubacteria.     

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.     

A cluster of nine tRNA genes between ribosomal gene operons in Bacillus subtilis.

A cluster of nine tRNA genes located in the 1-kb region between ribosomal operons rrnJ and rrnW in Bacillus subtilis has been cloned and sequenced. This cluster contains the genes for tRNA(UACVal), tRNA(UGUThr), tRNA(UUULys), tRNA(UAGLeu). tRNA(GCCGly), tRNA(UAALeu), tRNA(ACGArg), tRNA(UGGPro), and tRNA(UGCAla). The newly discovered tRNA gene cluster combines features of the 3'-end of trnI, a cluster of 6 tRNA genes between ribosomal operons rrnI and rrnH, and of the 5'-end of trnB, a cluster of 21 tRNA genes found immediately 3' to rrnB. Neither the tRNA(UAGLeu) gene nor its product has been found previously in B. subtilis. With the discovery of this new set of tRNA genes, a total of 60 such genes have now been found in B. subtilis. These known genes account for almost all of the tRNA hybridizing restriction fragments of the B. subtilis genome. The 60 known tRNA genes of B. subtilis code for only 28 different anticodons, compared with a total of 41 different anticodons for 78 tRNA genes in Escherichia coli. This may indicate that B. subtilis does not need as many anticodons because of more flexible translation rules, similar to the situation in Mycoplasma capricolum.     

Analysis of a drosophila tRNA gene cluster: two tRNALeu genes contain intervening sequences

A recombinant DNA phage containing a cluster of Drosophila melanogaster tRNA genes has been isolated and analyzed. The insert of this phage has been mapped by in situ hybridization to chromosomal region 50AB, a known tRNA site. Nucleotide sequencing of the entire Drosophila tRNA coding region reveals seven tRNA genes spanning 2.5 kb of chromosomal DNA. This cluster is separated from other tRNA regions on the chromosome by at least 2.7 kb on one side, and 9.6 kb on the other. Two tRNA genes are nearly identical and contain intervening sequences of length 38 and 45 bases, respectively, in the anticodon loop. These two genes are assigned to be tRNALeu genes because of significant sequence homology with yeast tRNA3Leu, and secondary structure homology with yeast tRNA3Leu intervening sequence. In addition, an 8 base sequence (AAAAUCUU) is conserved in the same location in the intervening sequences of Drosophila tRNALeu genes and a yeast tRNA3Leu gene. Similar sequenes occur in all other tRNAs containing intervening sequences. The remaining five genes are identical tRNAIle genes, which are also identical to a tRNAIle gene from chromosomal region 42A. The 5' flanking regions are only weakly homologous, but each set of isoacceptors contains short regions of strong homology approximately 20 nucleotides preceding the tRNA coding sequences: GCNTTTTG preceding tRNAIle genes; and GANTTTGG preceding tRNALeu genes. The genes are irregularly distributed on both DNA strands; spacing regions are divergent in sequence and length.     

Gene rearrangements in snake mitochondrial genomes: highly concerted evolution of control-region-like sequences duplicated and inserted into a tRNA gene cluster

Mitochondrial DNA (mtDNA) regions corresponding to two major tRNA gene clusters were amplified and sequenced for the Japanese pit viper, himehabu. In one of these clusters, which in most vertebrates characterized to date contains three tightly connected genes for tRNA(Ile), and tRNA(Gln), and tRNA(Met), a sequence of approximately 1.3 kb was found to be inserted between the genes for tRNA(Ile) and tRNA(Gln). The insert consists of a control-region-like sequence possessing some conserved sequence blocks, and short flanking sequences which may be folded into tRNA(Pro), tRNA(Phe), and tRNA(Leu) genes. Several other snakes belonging to different families were also found to possess a control-region-like sequence and tRNA(Leu) gene between the tRNA(Ile)and tRNA(Gln) genes. We also sequenced a region surrounded by genes for cytochrome b and 12S rRNA, where the control region and genes for tRNA(Pro) and tRNA(Phe) are normally located in the mtDNAs of most vertebrates. In this region of three examined snakes, a control-region- like sequence exists that is almost completely identical to the one found between the tRNA(Ile) and tRNA(Gln) genes. The mtDNAs of these snakes thus possess two nearly identical control-region-like sequences which are otherwise divergent to a large extent between the species. These results suggest that the duplicate state of the control-region- like sequences has long persisted in snake mtDNAs, possibly since the original insertion of the control-region-like sequence and tRNA(Leu) gene into the tRNA gene cluster, which occurred in the early stage of the divergence of snakes. It is also suggested that the duplicated control-region-like sequences at two distant locations of mtDNA have evolved concertedly by a mechanism such as frequent gene conversion. The secondary structures of the determined tRNA genes point to the operation of simplification pressure on the T psi C arm of snake mitochondrial tRNAs.