Sequestered water and binding energy are coupled in complexes of lambda Cro repressor with non-consensus binding sequences

We use the osmotic pressure dependence of dissociation rates and relative binding constants to infer differences in sequestered water among complexes of lambda Cro repressor with varied DNA recognition sequences. For over a 1000-fold change in association constant, the number of water molecules sequestered by non-cognate complexes varies linearly with binding free energy. One extra bound water molecule is coupled with the loss of approximately 150 cal/mol complex in binding free energy. Equivalently, every tenfold decrease in binding constant at constant salt and temperature is associated with eight to nine additional water molecules sequestered in the non-cognate complex. The relative insensitivity of the difference in water molecules to the nature of the osmolyte used to probe the reaction suggests that the water is sterically sequestered. If the previously measured changes in heat capacity for lambda Cro binding to different non-cognate sequences are attributed solely to this change in water, then the heat capacity change per incorporated water is almost the same as the difference between ice and water. The associated changes in enthalpies and entropies, however, indicate that the change in complex structure involves more than a simple incorporation of fixed water molecules that act as adaptors between non-complementary surfaces.     

Physical studies of the interaction between the Escherichia coli DNA binding protein and nucleic acids.

The interaction of nucleic acid with the Escherichia coli DNA-binding protein has been studied by fluorescence emission spectroscopy and sedimentation velocity analysis. The protein binds to single-strand DNA with an apparent equilibrium dissociation constant of 2 X 10(-9). It binds to the homopolymers poly (dA) and poly (dT) slightly more tightly, but has a larger apparent equilibrium dissociation constant to poly (dC). The protein also binds tightly to ribohomopolymers and to tRNA, but not to duplex DNA. By the use of defined-length oligonucleotides, it has been shown that the protein binds to DNA in a highly cooperative manner. The extent of cooperativity is seen as the difference in binding between an isolated monomeric protein molecule bound to DNA and two or more molecules binding to contiguous sites.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Kinetics and mechanism in the reaction of gene regulatory proteins with DNA

We have measured the kinetic properties of the Escherichia coli cAMP receptor protein (CAP) and lac repressor interacting with lac promoter restriction fragments. Under our reaction conditions (10 mM-Tris X HCl (pH 8.0 at 21 degrees C), 1 mM-EDTA, 10 microM-cAMP, 50 micrograms bovine serum albumin/ml, 5% glycerol), the association of CAP is at least a two-step process, with an initial, unstable complex formed with rate constant kappa a = 5(+/- 2.5) X 10(7) M-1 s-1. Subsequent formation of a stable complex occurs with an apparent bimolecular rate constant kappa a = 6.7 X 10(6) M-1 s-1. At low total DNA concentration, the dissociation rate constant for the specific CAP-DNA complex is 1.2 X 10(-4) s-1. The ratio of formation and dissociation rate constants yields an estimate of the equilibrium constant, Keq = 5 X 10(10) M-1, in good agreement with static results. We observed that the dissociation rate constant of both CAP-DNA and repressor-DNA complexes is increased by adding non-specific "catalytic" DNA to the reaction mixture. CAP dissociation by the concentration-dependent pathway is second-order in added non-specific DNA, consistent with either the simultaneous or the sequential participation of two DNA molecules in the reaction mechanism. The results imply a role for distal DNA in assembly-disassembly of specific CAP-DNA complexes, and are consistent with a model in which the subunits in the CAP dimer separate in the assembly-disassembly process. The dissociation of lac repressor-operator complexes was found to be DNA concentration-dependent as well, although in contrast to CAP, the reaction is first-order in catalytic DNA. Added excess operator-rich DNA gave more rapid dissociation than equivalent concentrations of non-specific DNA, indicating that the sequence content of the competing DNA influences the rate of repressor dissociation. The simplest interpretation of these observations is that lac repressor can be transferred directly from one DNA molecule to another. A comparison of the translocation rates calculated for direct transfer with those predicted by the one-dimensional sliding model indicates that direct transfer may play a role in the binding site search of lac repressor.     

The binding of Ca2+ to actin monomer is monitored by the fluorescence of actin-bound auramine O.

The fluorescence of the cation auramine O was substantially enhanced by the presence of actin monomer. Titrations of this fluorescence enhancement indicated that actin monomer had two auramine O binding sites, each with a dissociation constant of approx. 20 microM. Calcium ions had no effect on the number of actin monomer-bound auramine O molecules or on the dissociation constant for that interaction. However, calcium ions increased the maximum change of fluorescence that occurs when actin monomer was fully saturated with auramine O. This effect of calcium was saturable and yielded a Ca2+ dissociation constant of 1.6 mM. It was concluded that auramine O bound to sites on actin monomer and independently monitored the binding of Ca2+ ion(s) to other site(s) on actin monomer. Further, the magnitude of the Ca2+ dissociation constant suggested that this Ca2+-binding site may be representative of the multiple bivalent cation-binding sites on actin monomer which are thought to be directly involved in actin polymerization. However, the exact relationship between these sites remains unclear.     

Radiation-induced DNA damage as a function of hydration. I. Release of unaltered bases.

The release of unaltered bases from irradiated DNA, hydrated between 2.5 and 32.7 mol of water per mole of nucleotide (gamma), was investigated using HPLC. The objective of this study was to elucidate the yield of the four DNA bases as a function of dose, extent of hydration, and the presence or absence of oxygen. The increase in the yield of radiation-induced free bases was linear with dose up to 90 kGy, except for the DNA with gamma = 2.5, for which the increase was linear only to 10 kGy. The yield of free bases as a function of gamma was not constant in either the absence or the presence of oxygen over the range of hydration examined. For DNA with gamma between 2.5 and 15, the yield of free bases was nearly constant under nitrogen, but decreased under oxygen. However, for DNA with gamma greater than 15, the yield increased rapidly under both nitrogen and oxygen. The yield of free bases was described by a model that depended on two factors: 1) a change in the DNA conformation from a mixture of the A and C conformers in vacuum-dried DNA to predominantly the B conformer in the fully hydrated DNA, and 2) the proximity of the water molecules to the DNA. Irradiation of the inner water molecules (gamma less than 15) was less efficient than irradiation of the outer water molecules (gamma greater than 15), by a factor of approximately 3.3, in forming DNA lesions that resulted in the release of an unaltered base. This factor is similar to the previously published relative efficiency of 2.8 with which hydroxyl radicals and base cations induce DNA strand breaks. Our irradiation results are consistent with the hypothesis that the G value for the first 12-15 water molecules of the DNA hydration layer is the same as the G value for the form of DNA to which it is bound (i.e., the pseudo-C or the B form). Thus we suggest that the release of bases originating from irradiation of the hydration water is obtained predominantly: (1) by charge transfer from the direct ionization of the first 12-15 water molecules of the primary hydration layer and (2) by the attack of hydroxyl radicals generated in the outer, more loosely bound water molecules.     

Dissociation of the lactose repressor-operator DNA complex: effects of size and sequence context of operator-containing DNA

The dissociation kinetics for repressor-32P-labeled operator DNA have been examined by adding unlabeled operator DNA to trap released repressor or by adding a small volume of concentrated salt solution to shift the Kd of repressor-operator interaction. The dissociation rate constant for pLA 322-8, an operator-containing derivative of pBR 322, was 2.4 X 10(-3) s-1 in 0.15 M KCl. The dissociation rate constant at 0.15 M KCl for both lambda plac and pIQ, each of which contain two pseudooperator sequences, was approximately 6 X 10(-4) s-1. Elimination of flanking nonspecific DNA sequences by use of a 40 base pair operator-containing DNA fragment yielded a dissociation rate constant of 9.3 X 10(-3) s-1. The size and salt dependences of the rate constants suggest that dissociation occurs as a multistep process. The data for all the DNAs examined are consistent with a sliding mechanism of facilitated diffusion to/from the operator site. The ability to form a ternary complex of two operators per repressor, determined by stoichiometry measurements, and the diminished dissociation rates in the presence of intramolecular nonspecific and pseudooperator DNA sites suggest the formation of an intramolecular ternary complex. The salt dependence of the dissociation rate constant for pLA 322-8 at high salt concentrations converges with that for a 40 base pair operator. The similarity in dissociation rate constants for pLA 322-8 and a 40 base pair operator fragment under these conditions indicates a common dissociation mechanism from a primary operator site on the repressor.     

Analysis of the interaction between the Saccharomyces cerevisiae MSH2-MSH6 and MLH1-PMS1 complexes with DNA using a reversible DNA end-blocking system

The Lac repressor-operator interaction was used as a reversible DNA end-blocking system in conjunction with an IAsys biosensor instrument (Thermo Affinity Sensors), which detects total internal reflectance and allows monitoring of binding and dissociation in real time, in order to develop a system for studying the ability of mismatch repair proteins to move along the DNA. The MSH2-MSH6 complex bound to a mispaired base was found to be converted by ATP binding to a form that showed rapid sliding along the DNA and dissociation via the DNA ends and also showed slow, direct dissociation from the DNA. In contrast, the MSH2-MSH6 complex bound to a base pair containing DNA only showed direct dissociation from the DNA. The MLH1-PMS1 complex formed both mispair-dependent and mispair-independent ternary complexes with the MSH2-MSH6 complex on DNA. The mispair-independent ternary complexes were formed most efficiently on DNA molecules with free ends under conditions where ATP hydrolysis did not occur, and only exhibited direct dissociation from the DNA. The mispair-dependent ternary complexes were formed in the highest yield on DNA molecules with blocked ends, required ATP and magnesium for formation, and showed both dissociation via the DNA ends and direct dissociation from the DNA.     

Theory of acoustic mode vibrations of DNA fibers

A previous model for acoustic mode vibrations of a DNA molecule in water is extended to the case of an array of many DNA molecules, as occurs in the fibers studied in most experimental work on DNA. The acoustic modes of this system are found to consist of coupled modes of water sound vibrations and DNA acoustic modes. This model is used to study the electrostatic coupling of acoustic vibrations to the relaxational modes of the orientational degrees of freedom of the water molecules. It is found that the long-range or macroscopic electric field generated by the acoustic mode vibrations of the water-DNA system gives too small a damping and frequency shift of the acoustic modes to account for the observations on DNA fibers. Therefore, the observed damping and frequency shifts are most likely due to either friction between the surrounding water and the vibrating DNA, or coupling to the water orientation degrees of freedom resulting from the short range (i.e., screened) Coulomb interaction. The latter explanation (which is most likely the correct one) implies that the relaxation time of the hydration shell water is longer than the observed relaxation time by a factor of the static dielectric constant of the hydration water.     

Osmotic pressure effects on EcoRV cleavage and binding

Investigations of DNA binding proteins frequently measure pH and salt dependence, but relatively few studies measure protein binding in high concentrations of small molecules often found in vivo. We have measured kinetics of the restriction enzyme EcoRV in concentrated solutions of three small cosolvents that produce osmotic pressures from 0.25 to 2.5 mol/kg (6 to 62 atm or water activity of 0.995 to 0.956). We have correlated DNA cleavage and binding parameters with four solution parameters (dielectric constant, viscosity, water concentration, and water activity). We found that the responses of maximum velocity (Vmax) and the dissociation constant for nonspecific binding (Kd,ns) best correlate with water activity. The Michaelis constant (Km) correlates with both water activity and solution viscosity, the latter due to the highly dilute reactant concentrations, which make enzyme-substrate combination diffusion limited. Dielectric constant does not influence any of the kinetic parameters, which is consistent with a view that protein and DNA are preferentially hydrated, and excluded solutes cannot affect the local dielectric constant.     

Study of a noncovalent trp repressor: DNA operator complex by electrospray ionization time-of-flight mass spectrometry.

Electrospray ionization time-of-flight mass spectrometry (ESI-TOF MS) has been used to study noncovalent interactions between the trp apo-repressor (TrpR), its co-repressor tryptophan and its specific operator DNA. In 5 mM ammonium acetate, TrpR was detected as a partially unfolded monomer. In the presence of a 21-base-pair DNA possessing the two symmetrically arranged CTAG consensus sequences required for specific TrpR binding, a homodimer-dsDNA complex with a 1:1 stoichiometry was observed. Co-repressor was not needed for the complex to form under our experimental conditions. Collision induced dissociation (CID-MS) revealed that this complex was very stable in the gas phase since dissociation was achieved only at energies that also broke covalent bonds. We saw no evidence for the presence of the six water molecules that mediate the interaction between the protein and the DNA in the crystal structure. To check the binding specificity of the TrpR for its target DNA, a competitive experiment was undertaken: the protein was mixed with an equimolar amount of three different DNAs in which the two CTAG sequences were separated by 2, 4, and 6 bp, respectively. Only the DNA with the correct consensus spacing of 4 bp was able to form stable interactions with TrpR. This experiment demonstrates the potential of ESI-MS to test the sequence-specificity of protein-DNA complexes. The interactions between the TrpR-DNA complex and 5-methyl-, L- and D-tryptophan were also investigated. Two molecules of 5-methyl- or L-tryptophan were bound with high affinity to the TrpR-DNA complex. On the other hand, D-tryptophan appeared to bind to the complex with poor specificity and poor affinity.     

Quantitative analyses of bifunctional molecules

Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.     

Interaction of proteins located at a distance along DNA: mechanism of target immunity in the Mu DNA strand-transfer reaction

DNA molecules carrying a Mu end(s) are inefficient targets in the Mu DNA strand-transfer reaction. This target immunity is due to preferential dissociation of Mu B protein from DNA molecules that have Mu A protein bound to the Mu end; free DNA is a much poorer target than DNA with Mu B protein bound. We show that Mu B protein, which binds nonspecifically to DNA, is immobile once bound. An encounter between Mu A and Mu B proteins, bound some distance apart along DNA, is necessary to facilitate the Mu B dissociation. Experiments which show that DNA without a Mu end can acquire immunity, by catenation to DNA with a Mu end(s), are consistent with a model of Mu A-Mu B interaction by DNA looping, but not by linear movement of protein(s) along DNA.     

Alcoholysis catalyzed by Candida antarctica lipase B in a gas/solid system: effects of water on kinetic parameters

The influence of water on the kinetics of alcoholysis of methyl propionate and n-propanol catalyzed by immobilized lipase B from Candida antarctica was studied in a continuous solid/gas reactor. In this reactor, the solid phase is composed of a packed enzymatic sample which is percolated by gaseous nitrogen, simultaneously carrying gaseous substrates to the enzyme while removing reaction products. In this system, interactions between the enzyme and nonreacting molecules are avoided, since no solvent is present, and it is thus more easy to assess the role of water. To this end, alcohol inhibition constant, substrates dissociation constants as well as acylation rate constant and ratio of acylation to deacylation rate constants have been determined as a function of water activity (a(w)). Data obtained highlight that n-propanol inhibition constant and dissociation constant of methyl propionate are a lot affected by a(w) variations whereas water has no significant effect on the catalytic acylation step nor on the ratio of acylation to deacylation rate constants. These results suggest the water-independent character of the transition step.     

Dissociation mechanism of gas hydrates (I,II, H) of alkane molecules: a comparative molecular dynamics simulation

Employing NPT molecular dynamics method with consistent valence force field, the dissociation processes of sI, sII and sH gas hydrates are simulated at different temperatures and at a constant pressure of 100 MPa. The dissociation mechanisms of gas hydrates are revealed by analysing the structural snapshots, radial distribution functions and diffusion coefficients at different temperatures. As temperature increases, the diffusion rates of water molecules and guest molecules increase; thus the clathrate skeleton formed by water molecules with hydrogen bonds distorts and breaks down; meanwhile the guest molecules encapsulated in the water cavities are released. The size of guest molecules affects the dissociation behaviour of gas hydrate. In addition, the dissociation behaviour also relies on the structural phase of gas hydrates.     

Use of electrospray ionization mass spectrometry to study binding interactions between a replication terminator protein and DNA

Tus protein binds tightly to specific DNA sequences (Ter) on the Escherichia coli chromosome halting replication. We report here conditions for detecting the 1 : 1 Tus-Ter complex by electrospray ionization mass spectrometry (ESI-MS). ESI mass spectra of a mixture of Tus and nonspecific DNA showed ions predominantly from uncomplexed Tus protein, indicating that the Tus-Ter complex observed in the gas phase was the result of a specific interaction rather than nonspecific associations in the ionization source. The Tus-Ter complex was very stable using a spray solvent of 10 mM ammonium acetate at pH 8.0, and initial attempts to distinguish binding affinities of Tus and mutant Tus proteins for Ter DNA were unsuccessful. Increasing the ammonium acetate concentration in the electrospray solvent (800 mM at pH 8.0) increased the dissociation constants sufficiently such that relative orders of binding affinity for Tus and various mutant Tus proteins for various DNA sequences could be determined. These were in agreement with the dissociation constants determined in solution studies. A dissociation constant of 700 x 10(-9) M for the binding of the mutant Tus protein A173T (where residue 173 is changed from alanine to threonine) to Ter DNA was estimated, compared with a value of 相似文献   

Slow interaction of 5'-adenylyl-beta,gamma-imidodiphosphate with Escherichia coli DNA gyrase. Evidence for cooperativity in nucleotide binding.

We have examined the kinetics of interaction between Escherichia coli DNA gyrase and the nonhydrolyzable ATP analog 5'-adenylyl-beta,gamma-imidodiphosphate (ADPNP) in the presence and absence of ATP. In the absence of ATP, [alpha-32P]ADPNP binds extremely slowly to gyrase, with an apparent second-order rate constant (k1) of 120 M-1 min-1. Similarly, the limited negative supercoiling of closed-circular DNA caused by ADPNP binding is slow, requiring at least 2 h to reach completion in the presence of 100 microM ADPNP. A very slow but detectable rate of dissociation of ADPNP from gyrase was measured, with a rate constant of 3.5 x 10(-4) min-1. The calculated dissociation constant for ADPNP is thus 2.9 microM. ADPNP is a potent competitive inhibitor of ATP-dependent DNA supercoiling. Inhibition is established much more rapidly than can be accounted for by the slow rate of ADPNP binding in the absence of ATP. We have found that ATP can accelerate the rate of [32P]ADPNP binding by more than 15-fold (k1 = 1,850 M-1 min-1). The ATP-promoted rate enhancement requires the presence of DNA; in the absence of DNA, ATP has no effect on the rate of binding. Relaxed closed-circular, nicked-circular, and linear pBR322 DNA are all equally effective cofactors for ATP-stimulated binding of ADPNP. After a short lag, the presence of ATP also greatly speeds up ADPNP dissociation from gyrase bound initially to closed-circular DNA, with the restoration of DNA supercoiling activity. This effect is not observed in the presence of nicked-circular or linear DNA, suggesting that ADPNP dissociates more rapidly from gyrase bound to supercoiled DNA. The results of ADPNP binding provide evidence for cooperative interactions between the nucleotide binding sites. To account for these data, a model is proposed for the interaction of nucleotides at the two ATP binding sites on DNA gyrase.     

Lac repressor-operator interaction: DNA length dependence

The interaction of the E. coli lac operon repressor with its operator DNA has been directly examined as a function of the length of operator-containing DNA. The apparent bimolecular association rate constants were calculated as ka = (kd/KD), where the dissociation equilibrium constant, KD and the dissociation rate constant, kd, were measured by nitrocellulose filter adsorption assays. The values obtained for the overall association rate constants are compared with theoretical association rate curves for specific mechanisms. Association of the repressor with short operator containing DNA fragments (less than 70 base pairs) occurs at rates expected of three-dimensional diffusion. Our data also imply that at longer DNA lengths a combination of three-dimensional diffusion with one-dimensional sliding along with hopping and/or intersegment transfer must be involved to facilitate the repressor operator association.     

Active site mechanics of liver microsomal cytochrome P-450

For a set of 10 para-substituted toluene derivatives, three enzymatic constants were determined describing their interaction with purified rabbit liver microsomal P-450LM2. The three constants were the catalytic rate constant (Kcat) for hydroxylation, the apparent dissociation constant (Kd) for the enzyme-substrate complex, and the interaction energy (delta Gint) between the substrate-binding and spin-state equilibria. The para-substituents of the toluene substrates were: hydrogen, fluoro, bromo, chloro, iodo, nitro, methyl, cyano, isopropyl, and t-butyl. Linear free energy correlations were sought between the enzymatic constants and several physical constants of the individual substrate molecules. These correlations would be useful both for empirical prediction purposes and for insight into active site chemistry and mechanics. Catalytic rates were correlated by a linear combination of the Hansch pi hydrophobic constant and the Hammett sigma value. A deuterium isotope effect (DV) of 2.6 for d8-toluene compared to d0-toluene confirmed that hydrogen abstraction was partially rate-limiting with this series of substrates. Apparent dissociation constants were predicted by a linear combination of the molar volume and pi, while the spin-state interaction energies were best predicted by a linear combination of the Hansch pi hydrophobic constant and the reciprocal of the dielectric constant.     

Thermodynamic and spectroscopic features of the behavior of amphotericin B in aqueous medium

The interaction between amphotericin B molecules in aqueous medium solution was studied using absorption and circular dichroism approaches. The results showed that at concentrations below 1 microM of amphotericin B, an equilibrium between the monomer and aggregate occurred with a constant of approximately 0.6x10(6) M(-1). The aggregate formation constant was dependent on the experimental conditions of the medium: its value increased at acidic pH values, while alkaline medium induced the equilibrium displacement to the monomer formation. Either neutral salts or chaotropic agents such as urea prevented the formation of the aggregate. The presence of net electrical charge on the amine and carboxyl groups plays a role in the thermodynamic stability of the aggregate. A hydrophobic effect was also found between the monomer form and the water molecules of neighbours. In the aggregate formation water molecules were released contributing to an increase in the entropic change.