Structure and function of 5S ribosomal ribonucleic acid from Torulopsis utilis. IV. Detection of exposed guanine residues by chemical modification with kethoxal

The reaction of Torulopsis (Candida) utilis 5S ribosomal RNA with kethoxal (beta-ethoxy-alpha-ketobutyraldehyde) was studied in an attempt to identify the exposed guanine residues. At most 7-8 out of 32 guanine residues in T.utilis 5S RNA were kethoxalated after reaction at 37 degrees C for 4 h in the presence of magnesium ions. Localization of the kethoxalated guanine residues in T.utilis 5S RNA was achieved by sequence analyses of RNase T1 digests of the kethoxalated 5S RNA. These analyses showed that residues G37, G57, G91, and some of the three guanine residues G80, G82, and G85, are the most accessible sites. Residues G30, G41, and G49 also reacted with kethoxal though less strongly. These results are for the most part compatible with our secondary structure model for T.utilis 5S 5S RNA (Nishikawa and Takemura (1974) J. Biochem. 76, 935-947). However, partial formation of some hydrogen bonds within the loop region of the model seems to be necessary to explain the inaccessibility of residue G101 to kethoxal. The results are also discussed in comparison with those of similar studies on E.coli 5S RNA.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Structural analyses of E. coli 5S RNA fragments, their associates and complexes with proteins L18 and L25.

The structure of Escherichia coli 5S RNA fragments 1-41 and 42-120 has been studied by the read-off gel sequencing technique using S1 nuclease and cobra venom RNase as probes. Comparison of the digestion patterns with those of reassociated and intact 5S RNA suggests that the structure of both fragments is very similar to that of the corresponding regions in the intact molecule. Six different fragments obtained by partial digestion with T1 RNase and S1 nuclease have been used for reconstitution of 5S RNA, its certain structural regions and complexes with ribosomal proteins L18 and L25 recognizes the double-helix consisting of nucleotides 79-97 (i.e. prokaryotic stem), whereas a loop-region around position 40 (possible positions 39-47) is involved in the interaction with protein L18.     

Location of single-stranded and double-stranded regions in rat liver ribosomal 5S RNA and 5.8S RNA.

Rat liver 5S rRNA and 5.8S rRNA were end-labelled with 32P at 5'-end or 3'-end of the polynucleotide chain and partially digested with single-strand specific S1 nuclease and double-strand specific endonuclease from the cobra Naja naja oxiana venom. The parallel use of these two structure-specific enzymes in combination with rapid sequencing technique allowed the exact localization of single-stranded and double-stranded regions in 5S RNA and 5.8 S RNA. The most accessible regions to S1 nuclease in 5S RNA are regions 33-42, 74-78, 102-103 and in 5.8 S RNA 16-20, 26-29, 34-36, 74-80 and a region around 125-130. The cobra venom endonuclease cleaves the following areas in 5S RNA: 7-8, 17-20, 28-30, 49-51, 56-57, 60-64, 69-70, 81-82, 95-97, 106-112. In 5.8S RNA the venom endonuclease cleavage sites are 4-7, 10-13, 21-22, 33-35, 43-45, 51-55, 72-74, 85-87, 98-99, 105-106, 114-115, 132-135. According to these results the tRNA binding sequences proposed by Nishikawa and Takemura [(1974) FEBS Lett. 40, 106-109], in 5S RNA are located in partly single-stranded region, but in 5.8S RNA in double-stranded region.     

The conformation of 16S RNA in the 30S ribosomal subunit from Escherichia coli.

The digestion of E. coli 16S RNA with a single-strand-specific nuclease produced two fractions separable by gel filtration. One fraction was small oligonucleotides, the other, comprising 67.5% of the total RNA, was highly structured double helical fragments of mol. wt. 7,600. There are thus about 44 helical loops of average size corresponding to 12 base pairs in each 16S RNA. 10% of the RNA could be digested from native 30S subunits. Nuclease attack was primarily in the intraloop single-stranded region but two major sites of attack were located in the interloop single-stranded regions. Nuclease digestion of unfolded subunits produced three classes of fragments, two of which, comprising 80% of the total RNA, were identical to fragments from 16S RNA. The third, consisting of 20% RNA, together with an equal weight of peotein, was a resistant core (sedimentation coefficient 7S).     

Identification and assignment of base pairs in three helical stems of Torulopsis utilis ribosomal 5S RNA and its RNase T1 and RNase T2 cleaved fragments via 500-MHz proton homonuclear overhauser enhancements

Imino proton resonances in the downfield region (10-14 ppm) of the 500-MHz 1H NMR spectrum of Torulopsis utilis 5S RNA are identified (A X U, G X C, or G X U) and assigned to base pairs in helices I, IV, and V via analysis of homonuclear Overhauser enhancements (NOE) from intact T. utilis 5S RNA, its RNase T1 and RNase T2 digested fragments, and a second yeast (Saccharomyces cerevisiae) 5S RNA whose nucleotide sequence differs at only six residues from that of T. utilis 5S RNA. The near-identical chemical shifts and NOE behavior of most of the common peaks from these four RNAs strongly suggest that helices I, IV, and V retain the same conformation after RNase digestion and that both T. utilis and S. cerevisiae 5S RNAs share a common secondary and tertiary structure. Of the four G X U base pairs identified in the intact 5S RNA, two are assigned to the terminal stem (helix I) and the other two to helices IV and V. Seven of the nine base pairs of the terminal stem have been assigned. Our experimental demonstration of a G X U base pair in helix V supports the 5S RNA secondary structural model of Luehrsen and Fox [Luehrsen, K. R., & Fox, G.E. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 2150-2154]. Finally, the base-pair proton peak assigned to the terminal G X U in helix V of the RNase T2 cleaved fragment is shifted downfield from that in the intact 5S RNA, suggesting that helices I and V may be coaxial in intact T. utilis 5S RNA.     

5S RNA structure and interaction with transcription factor A. 1. Ribonuclease probe of the structure of 5S RNA from Xenopus laevis oocytes

The structure of Xenopus laevis oocyte (Xlo) 5S ribosomal RNA has been probed with single-strand-specific ribonucleases T1, T2, and A with double-strand-specific ribonuclease V1 from cobra venom. The digestion of 5'- or 3'-labeled renatured 5S RNA samples followed by gel purification of the digested samples allowed the determination of primary cleavage sites. Results of these ribonuclease digestions provide support for the generalized 5S RNA secondary structural model derived from comparative sequence analysis. However, three putative single-stranded regions of the molecule exhibited unexpected V1 cuts, found at C36, U73, U76, and U102. These V1 cuts reflect additional secondary structural features of the RNA including A.G base pairs and support the extended base pairing in the stem containing helices IV and V which was proposed by Stahl et al. [Stahl, D. A., Luehrsen, K. R., Woese, C. R., & Pace, N. R. (1981) Nucleic Acids Res. 9, 6129-6137]. A conserved structure for helix V having a common unpaired uracil residue at Xlo position 84 is proposed for all eukaryotic 5S RNAs. Our results are compared with nuclease probes of other 5S RNAs.     

Binding oligonucleotides to Escherichia coli and Bacillus stearothermophilus 5 S RNA.

Binding complementary tri- and tetranucleotides to Escherichia coli A19 and Bacillus stearothermophilus 799 5 S RNAs permitted identification of single-stranded regions in these RNAs. Sequences around positions 10, 30, 60, 70, 85 and 95 are in a single-stranded conformation in both 5 S RNAs. It is concluded that the overall structure of bacterial 5 S RNA has been conserved during evolution. Two types of structural conservation have been observed at specific sites of the 5 S RNA: firstly, nucleotide sequence and single strandedness and secondly, single strandedness only. The oligonucleotide binding data for E. coli 5 S RNA are in general agreement with a previous study (Lewis and Doty, 1970) and do not support fully any proposed structural model.     

Partial enzyme digestion studies onescherichia coli,pseudomonas, chlorella,drosophila, HeLa and yeast 5S RNAs support a general class of 5S RNA models

Summary Fox and Woese (1975a) have shown that a model of 5S RNA secondary structure similar to the one originally derived forChlorella 5S RNA can be generalized with relatively minor variations to all sequenced 5S RNA molecules, i.e. that corresponding base paired regions can be formed at approximately the same positions. We present experimental data in favour of this hypothesis and show that the points at which ribonucleases T1, T2 and pancreatic ribonuclease cleave six different 5S RNA molecules under mild conditions (high ionic strength, low temperature, low RNAase concentration) nearly always fall in the proposed single-stranded regions. We conclude that this model is a good approximation to the conformation of 5S RNA in solution.     

Specific cleavage of tRNA by nuclease S1.

Nuclease S1 specifically hydrolizes tRNAs in their anticodon loops, forming new 5' phosphate and 3' OH ends. Some single-stranded regions are not cut by nuclease S1. The strong preference of nuclease S1 for the anticodon region can be used for rapid identification of an anticodon-containing oligonucleotide and subsequent identification of the probable amino acid specificity of tRNA.     

Subunits of oncornavirus high-molecular-weight RNA. II. Detection of double-stranded-regions in 60S AMV (avian myeloblastosis virus) RNA

Nuclease S₁, specifically splitting only single-stranded polynucleotides has been used to detect the double-stranded regions of high-molecular-weight AMV-RNA. Nuclease S₁-resistant material comprising approx. 8% of 60S AMV-RNA molecule was isolated, purified and found to be completely nuclease S₁-resistant when native and completely nuclease S₁-sensitive upon heat denaturation. The symmetric nucleotide composition with equal G-C and equal A-U contents is also consistent with double-stranded nature of this material. Poly A does not participate significantly, if at all, in nuclease S₁-resistant structures. It is suggested that those base paired regions might participate in linking the RNA subunits together to form an aggregate 60S RNA molecule of oncornaviruses.     

Chemical modification of guanine residues of mouse 5 S ribosomal RNA with kethoxal. (Nucleosides and nucleotides 46)

Chemical modification of mouse 5 S rRNA with kethoxal was carried out to examine the secondary structure. The guanine residues located at positions 37, 41, 56, 66, 75 and 89 were modified. The relative rates of reaction are in the order G37, G56, G89, G66, G41, G75 at 28 degrees C and G37, G41, G56, G89, G75, G66 at 35 degrees C. These results support a secondary structure model containing 5 helices and 5 loops and indicate that the region around position 37 is the most exposed in higher-order structure.     

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

Ribosome-bound eukaryotic elongation factor 2 protects 5 S rRNA from modification.

The interaction between eukaryotic elongation factor eEF-2 and reconstituted 80 S ribosomes was investigated by analyzing the accessibility of 5 S ribosomal RNA for chemical and enzymatic modification. Ribosomes reconstituted from derived subunits were modified, and the positions of the modified sites were identified by primer extension using a 5 S rRNA-specific probe. All reactive sites were located between nucleotides 38 and 99, and most of them were found in putative single-stranded regions of the 5 S rRNA. Conversion of the ribosomes to the post-translocation type of particles by treatment with the translational inhibitor ricin resulted in the exposure of 3 additional bases for chemical modification, suggesting that the 5 S rRNA was more exposed in this type of ribosome. After binding of eEF-2 in complex with the non-hydrolyzable GTP analogue guanosine 5'-(beta, gamma-methylene)-triphosphate, most of the exposed bases in the 5 S rRNA were protected against both chemical and enzymatic modification.     

Nucleotide sequences of the 5S ribosomal RNA genes and their adjacent regions in Schizosaccharomyces pombe.

The organization of 5S ribosomal RNA (rRNA) genes in the genome of Schizosaccharomyces pombe has been investigated by restriction and hybridization analyses. The 5S rRNA genes were not linked to the other three species of rRNA genes which formed a repeating unit of 6.9 megadaltons, but located in other regions surrounded by heterogeneous sequences. The 5S rRNA gene organization in S. pombe is therefore different from those in other yeasts; Saccharomyces cerevisiae and Torulopsis utilis. Four restriction segments of different sizes each containing a single 5S rRNA gene were cloned on a bacterial plasmid, and the sequences in and around the RNA coding regions were determined. In the RNA coding regions, the sequences in four clones were identical with an exception that one residue has been substituted in one clone. In the flanking regions, the sequences were extremely rich in the AT-content and highly heterogeneous. The sequences were also markedly different from those in the corresponding regions of the other two yeasts. THe presence of T-clusters in the regions immediately after the RNA coding sequences was only notable homology among the four clones and the other two yeasts.     

Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

Secondary structure of a 345-base RNA fragment covering the S8/S15 protein binding domain of Escherichia coli 16S ribosomal RNA

A technique for isolating defined fragments of a large RNA has been developed and applied to a ribosomal RNA. A section of the Escherichia coli rrnB cistron corresponding to the S8/S15 protein binding domain of 16S ribosomal RNA was cloned into a single-stranded DNA phage; after hybridization of the phage DNA with 16S RNA and digestion with T1 ribonuclease, the protected RNA was separated from the DNA under denaturing conditions to yield a 345-base RNA fragment with unique ends (bases 525-869 in the 16S sequence). The secondary structure of this fragment was determined by mapping the cleavage sites of enzymes specific for single-stranded or double-helical RNA. The fragment structure is almost identical with that proposed for the corresponding region of intact 16S RNA on the basis of phylogenetic comparisons [Woese, C. R., Gutell, R., Gupta, R., & Noller, H. (1983) Microbiol. Rev. 47, 621-669]. We conclude that this section of RNA constitutes an independently folding domain that may be studied in isolation from the rest of the 16S RNA. The structure mapping experiments have indicated several interesting features in the RNA structure. (i) The largest bulge loop in the molecule (20 bases) contains specific tertiary structure. (ii) A region of long-range secondary structure, pairing bases about 200 residues apart in the sequence, can hydrogen bond in two different mutually exclusive schemes. Both appear to exist simultaneously in the RNA fragment under our conditions. (iii) The long-range secondary structure and one adjacent helix melt between 37 and 60 degrees C in the absence of Mg2+, while the rest of the structure is quite stable.