Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Influence of temperature and magnesium ions on the secondary and tertiary structures of tRNAPhe and 23 S RNA - infrared investigations.

Band splitting and/or bands shifting in opposite directions due to coupling of vibrations of neighboring groups observed in the infrared spectra of tRNAPhe and 23 S RNA give information on the secondary structure. The base pairing, dependent on temperature, is investigated, discussing coupling effects with the base residues' vibrations in the region 1700-1500 cm-1. The secondary structure of the backbone is studied, discussing coupling effects with vibrations in the region 1300-1000 cm-1. The 2'OH groups are cross-linked with the O atoms of the neighboring ribose residues via hydrogen bonds. Probably the greater than PO-2 groups are turned inward at the backbone, i.e. towards the base residues. The base pairs as well as the secondary structure of the backbone melt with increasing temperature and with dialysis against distilled water. The comparison of the Mg2+ and the K+ salts of the tRNAPhe shows that the changes of base pairing due to Mg2+ are small. At the backbone, however, Mg2+ favor somewhat more the discussed secondary structure than K+ does. All Mg2+ effects on secondary structure are, however, too small to explain the considerable increase in melting temperature due to Mg2+. Thus it is supposed that the rise in the melting temperature due to Mg2+ is not caused by a change in secondary but in the tertiary structure of tRNAPhe. Furthermore, the influence of Mg2+ on the secondary structure of 23 S RNA is studied. The following results are obtained: (1) The double helical regions become more compact and probably increase due to the influence of Mg2+. (2) At the backbone, Mg2+ induces strong hydrogen bonding between the 2'OH groups and the ether O atoms of neighboring ribose residues. Probably they turn the greater than PO-2 groups toward the base residues, i.e., inward at the backbone. Schulte, Morrison and Garrett found that a critical level of Mg2+ is required for binding certain proteins to rRNA (Biochemistry (1974) 13, 1032). Thus the observed conformation is probably necessary for binding these proteins.     

Effects of magnesium ions on two EMCV IRES key activity fragments

Using NMR magnetization transfer from water and ammonia-catalyzed exchange of the imino protons, changes have been monitored in base-pair kinetics induced by Mg^2 + in two key activity fragments r(CACCUGGCGACAGGUG) and r(GGCCAAAAGCC) of the encephalomyocarditis virus internal ribosome entry site. For r(CACCUGGCGACAGGUG), the addition of Mg^2 + reveals two types of base-pairs: r(U⁵⁴⁵·A) and r(G⁵⁴⁶·C), in the first category, have lifetimes only slightly higher in the presence of Mg^2 +, whereas their dissociation constants are substantially reduced. This behavior has been termed proximal. The base-pairs r(G⁵⁵³·C) and r(G⁵⁵⁴·C), in the second category, have lifetimes substantially higher in the presence of Mg^2 +, whereas their dissociation constants remain almost constant. This behavior has been termed distal. Mg^2 + has a specific effect on r(CACCUGGCGACAGGUG), the magnitude of which is progressively modulated from the proximal region of the 16-mer towards its distal region. For r(GGCCAAAAGCC), an intermediate behavior is found for base-pairs r(G⁵⁶⁵·C) and r(G⁵⁷²·C). Their lifetimes are slightly higher in the presence of Mg^2 + and their dissociation constants are significantly lower, a behavior resembling that of the 16-mer proximal region. These results indicate that Mg^2 + diffusively moves around r(GGCCAAAAGCC).     

Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures

Melting temperatures, T(m), were systematically studied for a set of 92 DNA duplex oligomers in a variety of sodium ion concentrations ranging from 69 mM to 1.02 M. The relationship between T(m) and ln [Na(+)] was nonlinear over this range of sodium ion concentrations, and the observed melting temperatures were poorly predicted by existing algorithms. A new empirical relationship was derived from UV melting data that employs a quadratic function, which better models the melting temperatures of DNA duplex oligomers as sodium ion concentration is varied. Statistical analysis shows that this improved salt correction is significantly more accurate than previously suggested algorithms and predicts salt-corrected melting temperatures with an average error of only 1.6 degrees C when tested against an independent validation set of T(m) measurements obtained from the literature. Differential scanning calorimetry studies demonstrate that this T(m) salt correction is insensitive to DNA concentration. The T(m) salt correction function was found to be sequence-dependent and varied with the fraction of G.C base pairs, in agreement with previous studies of genomic and polymeric DNAs. The salt correction function is independent of oligomer length, suggesting that end-fraying and other end effects have little influence on the amount of sodium counterions released during duplex melting. The results are discussed in the context of counterion condensation theory.     

Effects of manganese ions and magnesium ions on the activity of soya-bean ribulose bisphosphate carboxylase/oxygenase.

The Michaelis constants of soya-bean ribulose bisphosphate carboxylase for CO2 in the carboxylation reaction and for O2 in the oxygenation reaction depend on the nature of the bivalent cation present. In the presence of Mg2+ the Km for bicarbonate is 2.48 mM, and the Km for O2 is 37% (gas-phase concentration). With Mn2+ the values decrease to 0.85 mM and 1.7% respectively. For the carboxylation reaction Vmax. was 1.7 mumol/min per mg of protein with Mg2+ but only 0.29 mumol/min per mg of protein with Mn2+. For the oxygenation reaction, Vmax. values were 0.61 and 0.29 mumol/min per mg of protein respectively with Mg2+ and Mn2+.     

Effects of secondary structures in RNA on interlocking probabilities

In 1967 Wang and Schwartz reported on the formation of interlocked rings between linear or circular DNA molecules by the enzyme topoisomerase. We propose viewing the secondary structured loop in RNA (or single stranded DNA) as analogous to a circular DNA molecule. Formation of a catenane between such an RNA loop with a DNA molecule may constitute a probe of the secondary and general three dimensioanl structure of the RNA molecule. The experimental results may be compared with the theoretical calculation. We suggest here a method for estimating linkage probabilities and calculate them for several cases for which secondary structures of the RNA have been proposed.     

Effects of calcium and magnesium ions and host viability on growth of bdellovibrios

Bdellovibrio spp. strains 6-5-S, 100, 109 (Davis), and A3.12 multiply in the presence of viable but non-proliferating or heat-killed (70 or 100 C, 10 min; 121 C, 5 min) cells ofSpirillum serpens strain VHL suspended in buffers supplemented with Ca⁺⁺ and/or Mg⁺⁺. Ca⁺⁺ (optimal, 2 × 10⁻³ m) and Mg⁺⁺ (optimal, 2 × 10⁻⁵ m) independently stimulate the groth of bdellovibrios: additive effects are noted. Multiplication ofBdellovibrio in the presence of Ca⁺⁺ and Mg⁺⁺ is associated with the release into the culture supernatant solution of UV-absorbing materials and of amino sugars (presumably by activating or stabilizing lytic enzymes). The growth rate ofBdellovibrio strain 6-5-S in suspensions of heat-killed host cells is lower than in living but non-proliferating host cells. Bdellovibrio spp. strains 100, 109 (Davis), 109 (Jerusalem), A3.12, and 6-5-S all require added Ca⁺⁺ for growth in cell suspensions of homologous or heterologous host bacteria which have been grown in minimal medium.Bdellovibrio sp. strain 109 (Jerusalem) is capable of growing in the presence of the low level of Ca⁺⁺ boundin situ to the cells of its host,E. coli B, when the host cells had been cultivated in a complex medium but not when the host cells had been grown in a Ca⁺⁺-depleted minimal medium (except when Ca⁺⁺ is added). Addition of ethylenediaminetetraacetic acid (0.01m) preventsBdellovibrio growth, which is restored by addition of Ca⁺⁺ and Mg⁺⁺. The nonparasitic growth ofBdellovibrio spp. strains 100, 109, A3.12, and 6-5-S in heat-killed cell suspensions only in the presence of added cations indicates that, in this system, the cations are essential for activity of bacteriolytic and other enzymes and that they might also directly affectBdellovibrio growth rather than — as may be the case in other systems of live host cells plusBdellovibrio — only indirectly by affecting attachment to the host cell, maintaining integrity of the host spheroplasts, and increasing the burst size.     

Effects of spermine and magnesium ions on the aminoacylation of yeast tRNA(Tyr)

Stimulatory effects of Mg2+ and spermine on the kinetics of the aminoacylation of tRNA(Tyr) were examined using purified yeast tRNA(Tyr) and tyrosyl-tRNA synthetase. The apparent Km for tRNA(Tyr) was the lowest at Mg2+ concentrations between 2 and 5 mM and was not influenced by spermine. In the absence of spermine, the apparent Vmax was the highest at Mg2+ concentrations of 5 mM or higher, whereas the presence of spermine strongly stimulated the reaction at lower Mg2+ concentrations. Spermine alone could not substitute for Mg2+, nor was it able, at any Mg2+ concentration, to increase the reaction rate above the level reached at high concentrations of Mg2+ alone. Calculations of the concentration of Mg3.tRNA(Tyr) complex as a function of initial Mg2+ concentration, using the binding constants derived from physical measurements, allow the conclusion that spermine exerts its stimulatory activity by creating strong binding sites for Mg2+; this would enable the tRNA to assume the conformation required for optimal aminoacylation. The conformational requirement for the first tRNA: synthetase encounter is obviously less stringent, since the apparent Km for tRNA(Tyr) is not influenced by spermine.     

Effects of magnesium and sodium ions on the outer membrane permeability of cephalosporins in Escherichia coli

Both Mg2+ and Na+ stimulated the outer membrane permeation of negatively charged cephalosporins in Escherichia coli without any significant alteration of the permeation of a zwitterionic cephalosporin. Such stimulation was not observed in an E. coli mutant lacking porins. The stimulation was caused by the direct interaction between the cations and the porin pores, which resulted in a decrease in cation selectivity of both the Omp F and Omp C porin pores.     

Effects of strontium on the absorption of calcium, magnesium and phosphate ions from the ovine reticulo-rumen

The net absorption rates of strontium ions from the ovine reticulo-rumen, isolated in situ in trained conscious animals, were measured under controlled conditions. A linear positive response was obtained from the addition of Sr²⁺ ions to the artificial rumen fluid. This increase in the absorption of Sr was reflected in an increase in the plasma Sr concentration. In contrast to the discrimination observed elsewhere in favour of the absorption of Ca relative to Sr, the absorption rate of Sr from the reticulo-rumen was significantly greater than that of Ca, from solutions containing the same molar concentration. A graded increase in the Sr concentration in the ruminal fluid from 1 mmol/l to 4 mmol/l led to a corresponding reduction in the absorption rate of Ca but an increase in that of phosphate. The latter result is similar to that observed when the intra-ruminal concentration of Ca²⁺ ions is increased. It is suggested that Ca and Sr share a common pathway for absorption from the reticulo-rumen and that this may involve coupling with the absorption of phosphate ions. Accepted: 18 January 2000     

Effects of osmomolarity,calcium and magnesium ions on the structuredness of cytoplasmic matrix (SCM)

Summary The involvement of intracellular water content, calcium and magnesium ions in changes of the structuredness of cytoplasmic matrix (SCM) in human lymphocytes was investigated with the technique of fluorescence polarization.     

Binding of magnesium ions and ethidium bromide: comparison of ribosomes and free ribosomal RNA.

Comparative studies of free ribosomal RNA and ribosomes were made with two probes, Mg++ ions and ethidium bromide, which interact with RNA in different ways. Mg++. E. coli 16 S rRNA and 30 S ribosomes were equilibrated with four different buffers. Equilibration required several days at 4 degrees and several hours at 37 degrees. In all buffers ribosomes bound more Mg than free rRNA, the difference sometimes reaching 20--30%. Ribosomes were more resistant than free rRNA to heat denaturation and their denaturation was more highly cooperative. Ribosomes that bound more Mg++ had higher denaturation temperatures. Ethidium bromide. Fluorescence enhancement studies of ethidium intercalation showed the free 16 S rRNA to have 50--80 binding sites per molecule. A large fraction of these sites were present and accessible in the ribosome, but their ethidium-binding constants were reduced by an order of magnitude. In addition, free rRNA contained a small number of very strong binding sites that were virtually absent in the ribosomes.     

Effects of cardiac glycosides on RNA content in cardio-regulating structures of the hindbrain]

In the experiments on 112 white mongrel male rats using cytophotometric investigation the authors showed that digoxin in doses 0.89 and 8.9 micrograms/g in single and repeated subcutaneous administration influences differently the level of RNA in cardio-regulating structures of the hindbrain.