Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').     

Binding of Escherichia coli ribonucleic acid polymerase holoenzyme to a bacteriophage T7 promoter-containing fragment: selectivity exists over a wide range of solution conditions

The selectivity of binding of Escherichia coli RNA polymerase holoenzyme to a promoter-containing fragment of T7 DNA has been investigated over a range of solution conditions by using a double-label nitrocellulose filter binding assay. A 32P-labeled HaeIII restriction fragment of T7 D111 DNA containing the A1 and D promoters for the E. coli enzyme and a 3H-labeled nonpromoter HaeIII fragment of comparable size were incubated with sigma-saturated holoenzyme and filtered through a nitrocellulose membrane filter. We find that the extent of binding of polymerase to the promoter-containing fragment decreases dramatically with increasing salt concentrations and with increasing pH and increases moderately with increasing temperature in the range 0-37 degrees C. By contrast, the nonspecific interaction of polymerase with the nonpromoter fragment is known to be relatively insensitive to pH and temperature, though a strong function of salt concentration [deHaseth, O. L., Lohman, T. M., Burgess, R. R., & Record, M. T., Jr. (1978) Biochemistry 17, 1612-1622]. Selectivity of binding of RNA polymerase in our assay is demonstrated by a greater fractional retention of the promoter-containing fragment than of the nonpromoter fragment on the filter. We observe selective binding over the temperature range from 0 to 37 degrees C near neutral pH and over a wide range of Na+ concentrations, in the presence or absence of Mg2+. Because of the different dependences of promoter and nonpromoter binding on pH and temperature, the extent of selectivity increases with increasing temperature and decreases with increasing pH. Quantitative treatment of these binding data [Strauss, H. S., Burgess, R. R., & Record, M. t., Jr. (1980) Biochemistry (second paper of four in this issue)] confirms these conclusions and shows that selectivity is a function of ion concentration as well.     

DNA melting investigated by differential scanning calorimetry and Raman spectroscopy.

Thermal denaturation of the B form of double-stranded DNA has been probed by differential scanning calorimetry (DSC) and Raman spectroscopy of 160 base pair (bp) fragments of calf thymus DNA. The DSC results indicate a median melting temperature Tm = 75.5 degrees C with calorimetric enthalpy change delta Hcal = 6.7 kcal/mol (bp), van't Hoff enthalpy change delta HVH = 50.4 kcal/mol (cooperative unit), and calorimetric entropy change delta Scal = 19.3 cal/deg.mol (bp), at the experimental conditions of 55 mg DNA/ml in 5 mM sodium cacodylate at pH 6.4. The average cooperative melting unit (nmelt) comprises 7.5 bp. The Raman signature of 160 bp DNA is highly sensitive to temperature. Analyses of several conformation-sensitive Raman bands indicate the following ranges for thermodynamic parameters of melting: 43 < delta HVH < 61 kcal/mol (cooperative unit), 75 < Tm < 80 degrees C and 6 < (nmelt) < 9 bp, consistent with the DSC results. The changes observed in specific Raman band frequencies and intensities as a function of temperature reveal that thermal denaturation is accompanied by disruption of Watson-Crick base pairs, unstacking of the bases and disordering of the B form backbone. These three types of structural change are highly correlated throughout the investigated temperature range of 20 to 93 degrees C. Raman bands diagnostic of purine and pyrimidine unstacking, conformational rearrangements in the deoxyribose-phosphate moieties, and changes in environment of phosphate groups have been identified. Among these, bands at 834 cm-1 (due to a localized vibration of the phosphodiester group), 1240 cm-1 (thymine ring) and 1668 cm-1 (carbonyl groups of dT, dG and dC), are shown by comparison with DSC results to be the most reliable quantitative indicators of DNA melting. Conversely, the intensities of Raman marker bands at 786 cm-1 (cytosine ring), 1014 cm-1 (deoxyribose ring) and 1092 cm-1 (phosphate group) are largely invariant to melting and are proposed as appropriate standards for intensity normalizations.     

Mutagenesis of bacteriophage T7 and T7 DNA by alkylation damage.

We have developed a new assay for in vitro mutagenesis of bacteriophage T7 DNA that measures the generation of mutations in the specific T7 gene that codes for the phage ligase. This assay was used to examine mutagenesis caused by in vitro DNA synthesis in the presence of O6-methylguanosine triphosphate. Reversion of one of the newly generated ligase mutants by ethyl methanesulfonate was also tested.     

Hyperfine structure in melting profile of bacteriophage lambda DNA.

A high-resolution plotter of differential melting profiles of DNA, RNA, or related biopolymers with an on-line mini-computer is described. With this device, more than 15 transition steps were identified in the thermal melting profile of DNA from bacteriophage lambda. These fine structures were found to be reproducible, and some of them disappear in the deletion mutant. To Examine the melting profile, computer simulations for several hypothetical polynucleotide sequences were performed, and compared with experimental data. The sharp peaks that appeared in the differential melting profile of λ DNA may come from some homogeneous sequences of 500 bases or longer.     

Large-scale preparation of a DNA fragment containing the strong promoter A1 of the phage T7

A procedure has been developed to isolate DNA fragments on a large scale. A DNA fragment of 130 base-pairs containing the strong promoter A1 of the phage T7 was purified to homogeneity in amounts of 10 mg. The procedure includes the rapid purification of gram amounts of plasmid DNA, a new, simple method to separate small DNA fragments from the vector by a phenol/water partitioning system, and a liquid-liquid PEG-dextran partition chromatography for the final purification of the fragment. The fragment was cloned in two vector systems: The vector pDS1, to1+ (1), containing an efficient terminator downstream from the promoter integration site, gives high yields, 3-4 mg plasmid DNA per liter medium. In the plasmid pWH802 (2), which is not specially designed for the amplification of a strong promoter, the integration of the promoter was possible but the yield decreased by a factor of about 50. The stability of the inserts was tested in both systems. Monomeric inserts were stable in both plasmids, multimeric inserts up to a tetramer were only stable in pWH802. Only one orientation of the fragment was found.     

Determination of melting temperature and temperature melting range for DNA with multi-peak differential melting curves

Many factors that change the temperature position and interval of the DNA helix–coil transition often also alter the shape of multi-peak differential melting curves (DMCs). For DNAs with a multi-peak DMC, there is no agreement on the most useful definition for the melting temperature, T_m, and temperature melting width, ΔT, of the entire DNA transition. Changes in T_m and ΔT can reflect unstable variation of the shape of the DMC as well as alterations in DNA thermal stability and heterogeneity. Here, experiments and computer modeling for DNA multi-peak DMCs varying under different factors allowed testing of several methods of defining T_m and ΔT. Indeed, some of the methods give unreasonable “jagged” T_m and ΔT dependences on varying relative concentration of DNA chemical modifications (r_b), [Na⁺], and GC content. At the same time, T_m determined as the helix–coil transition average temperature, and ΔT, which is proportional to the average absolute temperature deviation from this temperature, are suitable to characterize multi-peak DMCs. They give smoothly varying theoretical and experimental dependences of T_m and ΔT on r_b, [Na⁺], and GC content. For multi-peak DMCs, T_m value determined in this way is the closest to the thermodynamic melting temperature (the helix–coil transition enthalpy/entropy ratio).     

The Physical Measurement of Radiation Damage to Coliphage T7 DNA

Coliphage T7 was exposed to ⁶⁰Co gamma radiation while suspended in phosphate buffer or in phosphate buffer plus 0.001 M l-histidine. DNA was isolated from the phage by incubation with pronase, followed by extraction with cold phenol. The intrinsic viscosity of the DNA was measured as a function of radiation dose. The fraction of DNA molecules surviving radiation treatment with no double-strand breaks was measured from the radiation-induced heterogeneity of the DNA sedimentation boundary. From comparison of these measurements it is concluded that radiation introduces lesions other than double-strand breaks which affect the hydrodynamic properties of the DNA. In both buffer and buffer plus histidine the surviving fraction of intact virus genomes far exceeds the surviving fraction of plaque-forming units at any given dose. It was found that the decrease in intrinsic viscosity with dose is independent of the presence of histidine in the radiation medium. From this it is concluded that DNA damage is primarily due to a direct effect of radiation on the phage particle. The procedure necessary to isolate DNA from irradiated virus suggests that radiation produces covalent bonding of protein to the DNA.     

Electron microscope maps of SA7 DNA melting

Electron microscopic denaturation maps corresponding to the first peaks of the differential melting curve of SA7 DNA were constructed by fixation of partly denatured molecules with glyoxal at temperatures within the melting range. These maps were oriented with respect to the functional map of the virus genome. The localization and the size of the most AT-rich SA7 DNA regions were determined.     

Stimulation of T7 DNA polymerase by a new phage-coded protein

Summary A bacteriophage-induced DNA-binding protein was purified from T7 infected E. coli. The protein has a molecular weight of about 25000, as judged by SDS-polyacrylamide gel electrophoresis. The purified protein binds to single-stranded but not to native T7 DNA. Like the T4 gene-32 protein and the 22000-dalton unwinding protein of E. coli, the T7 25000 protein lowers the melting temperature of poly d(A-T). Using partially single-stranded T7 DNA as template-primer, the protein stimulates in vitro DNA synthesis by T7 DNA polymerase about five-fold. It was also found that the DNA-unwinding protein of E. coli stimulates T7 DNA polymerase to approximately the same extent. However, neither of the unwinding proteins stimulate DNA polymerase I of E. coli.     

Activation of a cryptic gene by excision of a DNA fragment.

The cryptic bgl operon in Escherichia coli K-12 strain 1011A contains a 1.4-kilobase-pair fragment of foreign DNA within the bglF structural gene. The active allele found in its descendant strain, MK1, required the precise excision of that insertion for its activation. Molecular and genetic approaches have shown that strain 1011A possessed an active (bglR+) rather than a silent wild-type (bglR0) allele of the regulatory region and that this change was caused by a point mutation. Our model for the retention of cryptic genes (B. G. Hall, S. Yokoyama, and D. H. Calhoun, Mol. Biol. Evol. 1:109-124, 1983) suggested that the insertion might have been selected to silence a disadvantageous bglR+ allele. We examined the genealogy of strain MK1 and found that the insertion of foreign DNA was not selected for that reason, since it preceded the change to bglR+. This means that the change to bglR+ was also not selected, since the presence of the insertion would not allow expression of the operon. We have calculated the probability of isolating a bglR+ mutation by chance alone as less than 10(-8). We suggest that mutation rates estimated under the usual conditions of exponential growth may be irrelevant to the frequencies of these events under natural conditions.     

Estimation of the diversity between DNA calorimetric profiles,differential melting curves and corresponding melting temperatures

The Poland–Fixman–Freire formalism was adapted for modeling of calorimetric DNA melting profiles, and applied to plasmid pBR 322 and long random sequences. We studied the influence of the difference (H_GC?H_AT) between the helix‐coil transition enthalpies of AT and GC base pairs on the calorimetric melting profile and on normalized calorimetric melting profile. A strong alteration of DNA calorimetrical profile with H_GC?H_AT was demonstrated. In contrast, there is a relatively slight change in the normalized profiles and in corresponding ordinary (optical) normalized differential melting curves (DMCs). For fixed H_GC?H_AT, the average relative deviation (S) between DMC and normalized calorimetric profile, and the difference between their melting temperatures (T_cal?T_m) are weakly dependent on peculiarities of the multipeak fine structure of DMCs. At the same time, both the deviation S and difference (T_cal?T_m) enlarge with the temperature melting range of the helix‐coil transition. It is shown that the local deviation between DMC and normalized calorimetric profile increases in regions of narrow peaks distant from the melting temperature.