The structure and evolution of archaebacterial ribosomal RNAs

A cladistic analysis of 553 5S rRNA sequences has revealed a Ur-5S rRNA, the ancestor of all present-day 5S rRNA molecules. Previously stated characteristic differences between the eubacterial and eukaryotic molecules, namely, the length base-pairing schemes of helices D, can be used as a marker for the various archaebacterial branches. One model comprises Thermococcus, Thermoplasma, methanobacteria, and halobacteria; a second comprises the Sulfolobales; and a third is represented only by the single organism Octopus Spring species 1. A relaxed selection pressure on helix E with subsequent deletions is observed in Methanobacteriales, Methanococcales, and eubacteria. The secondary structures are supported by enzymatic digestion and chemical modification studies of the 5S rRNAs. Reconstitution of eubacterial 50S ribosomal subunits with 5S rRNA from Halobacterium and Thermoplasma has revealed 100% incorporation, while eukaryotic 5S rRNAs yielded a 50% incorporation. Relevant positions of the small-subunit rRNA are selected to answer the question of the monophyly of archaebacteria. Eight positions account for monophyly, eight for an ancestry of eubacteria with halophile methanogens and eukaryotes with eocytes (paraphyly of archaebacteria), and two for an ancestry of eubacteria with eocytes. A refinement of the neighborliness method of S. Sattath and A. Tversky resulted in a monophyly of archaebacteria when all positions are treated equally and in a paraphyly when tranversions are weighted twice over transitions.     

The molecular weights of yeast ribosomal precursor RNAs

The molecular weights of the predominant rRNA precursors as well as those of 26-S and 17-S mature rRNA from Saccharomyces carlsbergensis were determined by polyacrylamide gel electrophoresis in the presence of formamide. Mature 26-S + 5.8-S rRNA was found to have a molecular weight of 1.24 X 10(6) while their immediate precursor, 29-S RNA, had a molecular weight of 1.52 X 10(6). Values of 0.70 X 10(6) and 0.82 X 10(6) were obtained for the molecular weights of mature 17-S rRNA and its 18-S precursor. Finally the 37-S precursor, common to both 29-S and 18-S RNA, was found to have a molecular weight of 2.80 X 10(6). Each precursor rRNA, therefore, contains extra sequences not found at the next stage of maturation.     

Isolation and characterization of cytoplasmic and chloroplastic ribosomes and their ribosomal RNAs from the diatom Cylindrotheca fusiformis

The cytoplasmic and chloroplast ribosomes from the marine diatom Cylindrotheca fusiformis were isolated and characterized. The cytoplasmic ribosomes sedimented in sucrose at 84S and dissociated into subunits of 64S and 42S in the absence of Mg²⁺. It contained ribosomal RNAs with molecular weights of 1.31×10⁶ and 0.70×10⁶. The chloroplast ribosomes sedimented at 70S only in the presence of high Mg²⁺ concentrations (25–100 mM). No stable subunits were routinely observed and at very high levels of Mg²⁺ (>100 mM) the 70S species was converted to a form sedimenting at 55S. At 4°C ribosomal RNAs with molecular weights of 1.1×10⁶ and 0.40×10⁶ were detected on polyacrylamide gel electrophoresis. When the RNAs were resolved at room temperature the large molecular weight component disappeared while RNA with molecular weights of 0.65×10⁶ and 0.53×10⁶ were observed. Apparently the large chloroplast RNAs dissociated into two pieces of unequal molecular weight. These properties of the diatom's chloroplast ribosomes are very similar to those of the counter parts in unicellular green algae, which suggests that both types of algae have a common phylogenetic ancestor.     

Hybridizable sequences between cytoplasmic ribosomal RNAs and 3 micron circular DNAs of Saccharomyces cerevisiae and Torulopsis glabrata.

We have shown that 2.8 and 3.1 micron circular DNA molecules, previously reported to be present in Saccharomyces cerevisiae and Torulopsis glabrata respectively, contain sequences hybridizing to cytoplasmic ribosomal RNAs. In S. cerevisiae the 2.8 micron circular DNA appears to be identical to the rDNA repeating unit from nuclear DNA, both in length (approximately 9000 base pairs) and in the location of the 25, 18 and 5.8S rRNA sequences on the large HindIII fragment (6500 bp) and the presence of the 5S rRNA sequence on the small HindIII fragment. The 3.1 micron molecule from T. glabrata is approximately 2000 base pairs longer than the S. cerevisiae molecule and in addition, one of the HindIII sites lies within the region hybridizing to 25, 18 and 5.8S rRNAs. In S. cerevisiae the 4-5 copies of the 2.8 micron circular DNA molecules per cell, which have an extra-nuclear location, do not appear to be essential for cell viability as in one strain they were undetectable.     

Interactions of ribosomal protein L1 with ribosomal and messenger RNAs

Crystal structures of unbound protein L1 and of its complexes with ribosomal an messenger RNAs are analyzed. It is shown that the values of the apparent association rate constant for L1-RNA depend on conformation of unbound protein L1. It is suggested that L1 binds to rRNA with higher affinity than to mRNA because of additional interactions between domain II of L1 and the loop rRNA region, which is absent in mRNA.     

Interactions of ribosomal protein L1 with ribosomal and messenger RNAs

The crystal structures of unbound protein L1 and its complexes with ribosomal and messenger RNAs were analyzed. The apparent association rate constants for L1-RNA complexes proved to depend on the conformation of unbound L1. It was suggested that L1 binds to rRNA with a higher affinity than to mRNA, owing to additional interactions between domain II of L1 and the loop rRNA region, which is absent in mRNA. Published in Russian in Molekulyarnaya Biologiya, 2006, Vol. 40, No. 4, pp. 650–657. The article was translated by the authors.     

Lead-catalysed specific cleavage of ribosomal RNAs.

Ribosomes have long been known to require divalent metal ions for their functional integrity. Pb2+-induced cleavage of the sugar-phosphate backbone has now been used to probe for metal binding sites in rRNA. Only three prominent Pb2+cleavages have been detected, with cleavage sites 5' of G240 in 16S rRNA and two sites 5' of A505 and C2347 in 23S rRNA. All cleavages occur in non-paired regions of the secondary structure models of the rRNAs and can be competed for by high concentrations of Mg2+, Mn2+, Ca2+ and Zn2+ ions, suggesting that lead is bound to general metal binding sites. Although Pb2+ cleavage is very efficient, ribosomes with fragmented RNAs are still functional in binding tRNA and in peptidyl transferase activity, indicating that the scissions do not significantly alter ribosomal structure. One of the lead cleavage sites (C2347 in 23S RNA) occurs in the vicinity of a region which is implicated in tRNA binding and peptidyl transferase activity. These results are discussed in the light of a recent model which proposes that peptide bond formation might be a metal-catalysed process.     

Do ribosomal RNAs act merely as scaffold for ribosomal proteins?

Investigations that are being carried out in various laboratories including ours clearly provide the answer which is in the negative. Only the direct evidences obtained in this laboratory will be presented and discussed. It has been unequivocally shown that the interaction between 16S and 23S RNAs plays the primary role in the association of ribosomal subunits. Further, 23S RNA is responsible for the Binding of 5S RNA to 16S.23S RNA complex with the help of three ribosomal proteins, L5, L18, L15/L25. The 16S.23S RNA complex is also capable of carrying out the following ribosomal functions, although to small but significant extents, with the help of a very limited number of ribosomal proteins and the factors involved in protein synthesis: (a) poly U-Binding, (B) poly U-dependent Binding of phenylalanyl tRNA, (c) EF-G-dependent GTPase activity, (d) initiation complex formation, (e) peptidyl transferase activity (puromycin reaction) and (f) polyphenylalanine synthesis. These results clearly indicate the direct involvement of rRNAs in the various steps of protein synthesis. Very recently it has Been demonstrated that the conformational change of 23S RNA is responsible for the translocation of peptidyl tRNA from the aminoacyl (A) site to the peptidyl (P) site. A model has Been proposed for translocation on the Basis of direct experimental evidences. The new concept that ribosomal RNAs are the functional components in ribosomes and proteins act as control switches may eventually turn out to Be noncontroversial.     

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described.     

The nucleotide sequences of 5S ribosomal RNAs from four Bryophyta-species

The nucleotide sequences of cytoplasmic 5S rRNA from four bryophytes, Marchantia polymorpha, Lophocolea heterophylla, Plagiomnium trichomanes and Anthoceros punctatus have been determined. These RNAs are 119 nucleotides long except for the Anthoceros RNA that has 118 nucleotides. Their sequences are highly similar to each other (91-99% identity) and are more related to those from seed plants (78-83% identity) than to those from green algae (61-73% identity).     

Two thraustochytrid 5S ribosomal RNAs.

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.