The role of selenium peroxidases in the protection against oxidative damage of membranes

The present review deals with the chemical properties of selenium in relation to its antioxidant properties and its reactivity in biological systems. The interaction of selenite with thiols and glutathione and the reactivity of selenocompounds with hydroperoxides are described. After a short survey on distribution, metabolism and organification of selenium, the role of this element as a component of the two seleno-dependent glutathione peroxidases is described. The main features of glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase are also reviewed. Both enzymes reduce different hydroperoxides to the corresponding alcohols and the major difference is the reduction of lipid hydroperoxides in membrane matrix catalyzed only by the phospholipid hydroperoxide glutathione peroxidase. However, in spite of the different specificity for the peroxidic substrates, the kinetic mechanism of both glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase seems identical and proceeds through a tert-uni ping pong mechanism. In the reaction cycle, indeed, as supported by the kinetic data, the oxidation of the ionized selenol by the hydroperoxide yields a selenenic acid that in turn is reduced back by two reactions with reduced glutathione. Special emphasis has been given to the role of selenium-dependent glutathione peroxidases in the prevention of membrane lipid peroxidation. While glutathione peroxidase is able to reduce hydrogen peroxide and other hydroperoxides possibly present in the soluble compartment of the cell, this enzyme fails to inhibit microsomal lipid peroxidation induced by NADPH or ascorbate and iron complexes. On the other hand, phospholipid hydroperoxide glutathione peroxidase, by reducing the phospholipid hydroperoxides in the membranes, actively prevents lipid peroxidation, provided a normal content of vitamin E is present in the membranes. In fact, by preventing the free radical generation from lipid hydroperoxides, phospholipid hydroperoxide glutathione peroxidase decreases the vitamin E requirement necessary to inhibit lipid peroxidation. Finally, the possible regulatory role of the selenoperoxidases on the arachidonic acid cascade enzymes (cyclooxygenase and lipoxygenase) is discussed.     

Lipid peroxidation and antioxidant status in blood of patients with uterine myoma, endometrial polypus, hyperplastic and malignant endometrium

Oxidative stress is considered to be involved in pathogenesis of many disorders of the female genital tract. In this study, we explored the lipid peroxidation levels and antioxidant enzyme activities in women diagnosed with different forms of uterine diseases in order to evaluate the extent of oxidative stress in blood of such patients. Blood samples of healthy subjects and gynecological patients were collected and subjected to assays for superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase and lipid hydroperoxides. The results show that alterations of measured parameters vary with the enzyme type and diagnosis. However, both reduction in antioxidants and elevation of lipid peroxidation were observed in general. Lipid hydroperoxides level was negatively correlated to superoxide dismutase and glutathione peroxidase activities, as well as positively correlated to catalase activity. In addition, the lipid hydroperoxides/ glutathione peroxidase ratio was found to be increased, according to the type of uterine disease. The obtained results show that perturbation of antioxidant status is more pronounced in blood of patients with premalignant (hyperplastic) and malignant (adenocarcinoma) lesions, compared to those with benign uterine changes such as polypus and myoma.     

A selenium-containing single-chain abzyme with potent antioxidant activity.

Reactive oxygen species (ROS) are products of normal metabolic activities and are thought to be the cause of many diseases. A selenium-containing single-chain abzyme 2F3 (Se-2F3-scFv) that imitates glutathione peroxidase has been produced which has the capacity to remove ROS. To evaluate the antioxidant ability of Se-2F3-scFv, we constructed a ferrous sulfate/ascorbate (Vc/Fe2+)-induced mitochondrial damage model system and investigated the capacity of Se-2F3-scFv to protect mitochondria from oxidative damage. Se-2F3-scFv markedly decreased mitochondrial swelling, inhibited lipid peroxidation, and maintained the activity of cytochrome c oxidase, in comparison with Ebselen, a well-studied glutathione peroxidase mimic, indicating that Se-2F3-scFv has potential for treating diseases mediated by ROS.     

In vitro evaluation of glutathione peroxidase (GPx)-like activity and antioxidant properties of some Ebselen analogues

Four analogues of Ebselen were synthesized and their glutathione peroxidase activity and antioxidant property evaluated and compared to Ebselen. Among the studied compounds, only diselenide [3] exhibited both glutathione peroxidase activity and radical-scavenging capability. Compounds [3] and [4] showed a strong inhibitory effect (53% and 43%, respectively) on the lipid peroxidation of linoleic acid compared to Ebselen and selenide derivatives ([1] and [2]) which were less active (28%, 26% and 18% inhibition, respectively). A concentration-dependent inhibitory effect was also found in the model of the formation of ABTS*+ radical cation: 65% and 89% inhibition for compound [3] at 10(-4) M and 5 x 10(-5) M, respectively, and 68% and 90% for compound [4], compared to 14% and 52% inhibition for Ebselen and the diselenides [1] and [2] (29%, 46% and 45%, 68%, respectively). By EPR spin trapping technique, the following inhibitory profile of the Ebselen analogues was observed towards the formation of thiyl radicals: Ebselen = [3]>[1]>[2]>[4]. Studies with compound [3] are in progress on oxidative stress cell models.     

The activity of pro- and antioxidant systems in the liver of freshwater fishes during different seasons

The content of lipid peroxidation products--diene conjugates, lipid hydroperoxides, thiobarbituric acid reactive substances (TBARS), vitamins A, E and carotenoids and the activity of antioxidant enzymes--superoxide dismutase, glutathione peroxidase and catalase in the liver of freshwater fishes of different species (silver carp, grass carp and common carp) in different seasons have been studied. It was established the activity of antioxidant defence system in the liver of fish depends significantly on the season and fish species. In particular, the content of lipid peroxidation products in the liver of freshwater fishes at the beginning of winter and spring was significantly higher compared to their content at the beginning of summer and autumn. The superoxide dismutase and glutathione peroxidase activities in the liver of these fish species at the beginning of winter and spring were significantly lower than at the beginning of summer and autumn while the seasonal changes of catalase activity in the liver of fish are expressed insignificantly. The content of vitamins E, A1, A2 and carotenoids in the liver of fishes of different species at the beginning of winter and spring was significantly lower than at the beginning of summer and autumn. The content of lipid peroxidation products and vitamins E, A1 and A2 in the liver of common carp is significantly lower than in the liver of silver carp and grass carp and species differences in antioxidant enzymes activity are insignificant.     

Photooxidation of cell membranes in the presence of hematoporphyrin derivative: reactivity of phospholipid and cholesterol hydroperoxides with glutathione peroxidase

The susceptibility of photodynamically-generated lipid hydroperoxides to reductive inactivation by glutathione peroxidase (GPX) has been investigated, using hematoporphyrin derivative as a photosensitizing agent and the human erythrocyte ghost as a target membrane. Photoperoxidized ghosts were reactive in a glutathione peroxidase/reductase (GPX/GRD)-coupled assay only after phospholipid hydrolysis by phospholipase A2 (PLA2). However, enzymatically determined lipid hydroperoxide values were consistently approx. 40% lower than iodometrically determined values throughout the course of photooxidation. Moreover, when irradiated ghosts were analyzed iodometrically during PLA2/GSH/GPX treatment, a residual 30-40% of non-reactive lipid hydroperoxide was observed. The possibility that cholesterol product(s) account for the non-reactive lipid hydroperoxide was examined by tracking cholesterol hydroperoxides in [14C]cholesterol-labeled ghosts. The sum of cholesterol hydroperoxides and GPX/GRD-detectable lipid hydroperoxides was found to agree closely with iodometrically determined lipid hydroperoxide throughout the course of irradiation. Thin-layer chromatography of total lipid extracts indicated that cholesterol hydroperoxide was unaffected by PLA2/GSH/GPX treatment, whereas most of the phospholipid peroxides were completely hydrolyzed and the released fatty acid peroxides were reduced to alcohols. It appears, therefore, that the GPX-resistant lipid hydroperoxides in photooxidized ghosts were derived primarily from cholesterol. Ascorbate plus Fe3+ produced a burst of free-radical lipid peroxidation in photooxidized, PLA2-treated ghosts. As expected for fatty acid hydroperoxide inactivation, the lipid peroxidation was inhibited by GSH/GPX, but only partially so, suggesting that cholesterol hydroperoxide-derived radicals play a major role in the reaction.     

The role of selenium in the regulation of lipid peroxidation in biological membranes and glutathione peroxidase activity

The antioxidative effect of selenium cannot be exclusively due to the functioning of the selenium-dependent glutathione peroxidase mechanism of utilization of various hydroperoxides. This hypothesis is based on the following experimental evidence. Selenium ions are readily incorporated into animal organs and tissues immediately after injection (2 hours) as well as into cell organelles and cytosol where they inhibit lipid peroxidation. The activity of glutathione peroxidase (EC 1.1.1.19) in rat liver and guinea pig cytosol is thereby unchanged but increases drastically after 12 hours reaching a maximum an the 3rd-4th day. The effectiveness of lipid peroxidation inhibition does not increase under these conditions. Although the glutathione peroxidase activity is absent in the nuclei and microsomes, exogenous selenium inhibits lipid peroxidation in these organelles. The activity of the rat liver cytosolic enzyme markedly exceeds that of its guinea pig counterpart. However, lipid peroxidation in guinea pig liver occurs less intensively than that in rat liver cytosol.     

Phospholipid hydroperoxide glutathione peroxidase protects against singlet oxygen-induced cell damage of photodynamic therapy

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) is an important enzyme in the removal of lipid hydroperoxides (LOOHs) from cell membranes. Cancer treatments such as photodynamic therapy (PDT) induce lipid peroxidation in cells as a detrimental action. The photosensitizers used produce reactive oxygen species such as singlet oxygen ((1)O(2)). Because singlet oxygen introduces lipid hydroperoxides into cell membranes, we hypothesized that PhGPx would provide protection against the oxidative stress of singlet oxygen and therefore could interfere with cancer treatment. To test this hypothesis, human breast cancer cells (MCF-7) were stably transfected with PhGPx cDNA. Four clones with varying levels of PhGPx activity were isolated. The activities of other cellular antioxidant enzymes were not influenced by the overexpression of PhGPx. Cellular PhGPx activity had a remarkable inverse linear correlation to the removal of lipid hydroperoxides in living cells (r = -0.85), and correlated positively with cell survival after singlet oxygen exposure (r = 0.94). These data demonstrate that PhGPx provides significant protection against singlet oxygen-generated lipid peroxidation via removal of LOOH and suggest that LOOHs are major mediators in this cell injury process. Thus, PhGPx activity could contribute to the resistance of tumor cells to PDT.     

Cholesterol-rich diets have different effects on lipid peroxidation, cholesterol oxides, and antioxidant enzymes in rats and rabbits

The objective of this study was to compare the effect of cholesterol feeding of rats and rabbits. The levels of lipid peroxidation products and oxysterols in the plasma of the two species plus the antioxidant enzyme activities in the liver and erythrocytes were measured to explain their different susceptibilities to atherosclerosis. Our study showed that rats are less susceptible than are rabbits to the atherogenic effect of a cholesterol-rich diet because of differences in lipid peroxidation products as well as antioxidant enzymes activities in their livers. In rabbits, cholesterol feeding produced severe hypercholesterolemia (43-fold increase) and increased plasma and liver lipid peroxidation. Total as well as the individual oxysterol contents of 7alpha-, 7beta-hydroxycholesterol, alpha-epoxy, beta-epoxycholesterol, cholestanetriol, 7-keto, and 27-hydroxycholesterol significantly increased in the plasma of hypercholesterolemic (HC) rabbits. Erythrocyte glutathione peroxidase (GSH-Px) activity significantly decreased whereas catalase activity significantly increased in HC rabbits. In rats cholesterol feeding increased the plasma cholesterol only twofold and had no effect on plasma or liver lipid peroxidation. Only 7alpha- and 7beta-hydroxycholesterol increased and no change was observed in any of the antioxidant enzymes activity in the erythrocytes. Although cholesterol feeding caused a 10-fold increase of liver cholesterol as ester in both rats and rabbits, the antioxidant enzyme GSH-Px and catalase activities in the liver significantly increased in rats but significantly decreased in rabbits. The increase of GSH-Px and catalase activities in the liver of cholesterol fed rats could have a protective role against oxidation, thus preventing the formation of lipid peroxidation and oxysterols.     

Role of a partially purified glutathione S-transferase from rat liver nuclei in the inhibition of nuclear lipid peroxidation

Glutathione protects isolated rat liver nuclei against lipid peroxidation by inducing a lag period prior to the onset of peroxidation. This GSH-dependent protection was abolished by exposing isolated nuclei to the glutathione S-transferase inhibitor S-octylglutathione. In incubations containing 0.2 mM S-octylglutathione, the GSH-induced lag period was reduced from 30 to 5 min. S-Octylglutathione (0.2 mM) also completely inhibited nuclear glutathione S-transferase activity and reduced glutathione peroxidase activity by 85%. About 70% of the glutathione S-transferase activity associated with isolated nuclei was solubilized with 0.3% Triton X-100. This solubilized glutathione S-transferase activity was partially purified by utilizing a S-hexylglutathione affinity column. The partially purified nuclear glutathione S-transferase exhibited glutathione peroxidase activity towards lipid hydroperoxides in solution. The data from the present study indicate that a glutathione S-transferase associated with the nucleus may contribute to glutathione-dependent protection of isolated nuclei against lipid peroxidation. Evidence was obtained which indicates that this enzyme is distinct from the microsomal glutathione S-transferase.     

Prevention of lipid peroxidation by NAD(P)H in rat liver submitochondrial particles

In rat liver submitochondrial particles both NADH and NADPH inhibit lipid peroxidation induced by cumene hydroperoxide. Concomitantly with the inhibition of lipid peroxidation, NADH and NADPH strongly stimulate the peroxidase activity of rat liver submitochondrial particles. Rotenone slightly prevents both the protective effect on malondialdehyde formation and peroxidase activity. The peroxidase activity of rat liver submitochondrial particles was attributed to the NAD(P)H-mediated reduction of mitochondrial cytochrome P-450 which can act upon hydroperoxides, by decomposing them to alcohols.     

Lipid peroxidation in the myocardium in experimental infarct

Changes in the content of lipid peroxidation (LP) products and activities of antioxidant enzymes--superoxide dismutase, glutathione peroxidase and catalase in myocardium of rats after experimental infarction as well as after pretreatment with antioxidant ionol, beta-adrenoblocker inderal and verapamil, an inhibitor of slow Ca2+-channels have been studied. In the left ventricles of the control animals decreased levels of LP-products (Schiff bases and lipid hydroperoxides) have been registered as compared with right ventricles, accompanied by increased activity of antioxidant enzymes in the left ventricles. In experimental infarction the level of LP products increases and activity of antioxidant enzymes decreases both in ischemic and nonischemic regions of the heart. In nonischemic zone these changes can be prevented by pretreatment with inderal and ionol but not with verapamil.     

Inhibitory Effects of Ebselen on Lipid Peroxidation in Rat Liver Microsomes

The effects of ebselen(2-pheny1-1,2-benzoisoselenazol-3(2H)-one), a synthetic seleno-organic compound with glutathione peroxidase-like activity were investigated on lipid peroxidation in rat liver microsomes. Ebselen inhibited malondialdehyde production coupled to the lipid peroxidation stimulated by either ADP-iron-ascorbate or CC1₄. The inhibitory activity of ebselen on each system was strongly increased by a 5-min preincubation with liver microsomes; the IC₅₀ values against ADP-Fe-ascorbate-stimulated and CC1₄-stimulated lipid peroxidation were 1.6/jM and 70 μM respectively. Ebselen also inhibited the endogenous lipid peroxidation with a NADPH-generating system, but it slightly stimulated the endogenous activity of ADP-Fe-ascorbate-stimulated lipid peroxidation (without a NADPH-generating system). Furthermore, ebselen inhibited oxygen uptake coupled to the lipid peroxidation by ADP-Fe-ascorbate and NADPH-ADP-iron; the IC₅₀ values were 2.5μM AND 20.3 μM respectively. Ebselen also prolonged the lag-time of onset of ADP-Fe-ascorbate-stimulated lipid peroxidation significantly, but not that observed with NADPH-ADP-Fe-stimulated lipid peroxidation.     

Horseradish peroxidase inhibition and antioxidant activity of ebselen and related organoselenium compounds

Horseradish peroxidase (HRP) inhibition and glutathione peroxidase (GPx) activities of ebselen and some related derivatives are described. These studies show that ebselen and ebselen ditelluride (EbTe(2)) with significant antioxidant activity, inhibit the HRP-catalyzed oxidation reactions. In addition, inhibition of lipid peroxidation and singlet oxygen quenching studies were carried out. Although the inhibition of HRP by ebselen is comparable with that of EbTe(2), the inhibitory effect on gamma-radiation induced lipid peroxidation and the GPx activity of ebselen is found to be much higher than that of EbTe(2).     

Cooperation of antioxidants in protection against photosensitized oxidation

The aim of this study was to determine whether alpha-tocopherol and zeaxanthin offer synergistic protection against photosensitized lipid peroxidation mediated by singlet oxygen and free radicals. The antioxidant action of zeaxanthin and alpha-tocopherol was studied in liposomes made of phosphatidylcholine and cholesterol. Progress of lipid peroxidation, induced by aerobic photoexcitation of rose bengal, was monitored by the detection of lipid hydroperoxides and by electron spin resonance oximetry. In addition, cholesterol was employed as a mechanistic reporter molecule, which forms characteristic products of the interaction with singlet oxygen or free radicals. Cholesterol hydroperoxides were quantitatively determined by HPLC/electrochemical detection. HPLC/ultraviolet-visible (UV-VIS) absorption detection was used to measure concentrations of zeaxanthin and alpha-tocopherol. Zeaxanthin, even at concentrations of 2.5 microM, effectively protected against singlet oxygen-mediated lipid peroxidation but was rapidly consumed due to interaction with free radicals. alpha-Tocopherol alone was not effective in protecting against lipid peroxidation, even at concentration of 0.1 mM. Combinations of zeaxanthin and alpha-tocopherol exerted a synergistic protection against lipid peroxidation. The synergistic effect may be explained in terms of prevention of carotenoid consumption by effective scavenging of free radicals by alpha-tocopherol therefore allowing zeaxanthing to quench the primary oxidant-singlet oxygen effectively.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.     

Isoprenoid pathway and free radical generation and damage in neuropsychiatric disorders

Two substances which are products of the isoprenoid pathway, can participate in lipid peroxidation. One is digoxin, which by inhibiting membrane Na(+)-K+ ATPase, causes increase in intracellular Ca2+ and depletion of intracellular Mg2+, both effects contributing to increase in lipid peroxidation. Ubiquinone, another products of the pathway is a powerful membrane antioxidant and its deficiency can also result in defective electron transport and generation of reactive oxygen species. In view of this and also in the light of some preliminary reports on alteration in lipid peroxidation in neuropsychiatric disorders, a study was undertaken on the following aspects in some of these disorders (primary generalised epilepsy, schizophrenia, multiple sclerosis, Parkinson's disease and CNS glioma)--1) concentration of digoxin, ubiquinone, activity of HMG CoA reductase and RBC membrane Na(+)-K+ ATPase 2) activity of enzymes involved in free radical scavenging 3) parameters of lipid peroxidation and 4) antioxidant status. The result obtained indicates an increase in the concentration of digoxin and activity of HMG CoA reductase, decrease in ubiquinone levels and in the activity of membrane Na(+)-K+ ATPase. There is increased lipid peroxidation as evidenced from the increase in the concentration of MDA, conjugated dienes, hydroperoxides and NO with decreased antioxidant protection as indicated by decrease in ubiquinone, vit E and reduced glutathione in schizophrenia, Parkinson's disease and CNS glioma. The activity of enzymes involved in free radical scavenging like SOD, catalase, glutathione peroxidase and glutathione reductase is decreased in the above diseases. However, there is no evidence of any increase in lipid peroxidation in epilepsy or MS. The role of increased operation of the isoprenoid pathway as evidenced by alteration in the concentration of digoxin and ubiquinone in the generation of free radicals and protection against them in these disorders is discussed.     

Antioxidative enzyme activity and metabolism of peroxide compounds in the crystalline lens during cataractogenesis

Lens antioxidative enzyme activity (catalase, superoxide dismutase, glutathione peroxidase) in cataract as well as the possibility of cataract induction by the lipid peroxidation products and their influence on the content of reduced thiols (oxy-red balance) were studied. It was shown that the rate of the H2O2 decomposition by the human cataract lenses is lowered in comparison with the normal lenses. This is not due to the lowered catalase or glutathione-peroxidase 1 activity, but depends on the deficiency of reduced glutathione in the lens. Activity of superoxide dismutase and glutathione peroxidase metabolizing organic hydroperoxides is significantly lowered in the cataract lenses. Lipid peroxidation products injected into the rabbit vitreous induce posterior subcapsular cataract, which is accompanied by depletion of reduced glutathione level in the lens. The conclusion is made that two interrelated processes: accumulation of H2O2 and of lipid peroxides induce aggregation of the soluble proteins and the fragmentation of the membrane structures in cataract lenses.     

GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis

Oxygen is necessary for aerobic metabolism but can cause the harmful oxidation of lipids and other macromolecules. Oxidation of cholesterol and phospholipids containing polyunsaturated fatty acyl chains can lead to lipid peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key intermediates in the process of lipid peroxidation. The lipid hydroperoxidase glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid alcohols, and this process prevents the iron (Fe²⁺)‐dependent formation of toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to lipid peroxidation and can result in the induction of ferroptosis, an iron‐dependent, non‐apoptotic form of cell death. This review describes the formation of reactive lipid species, the function of GPX4 in preventing oxidative lipid damage, and the link between GPX4 dysfunction, lipid oxidation, and the induction of ferroptosis.     

Protective effect of green tea against lipid peroxidation in the rat liver, blood serum and the brain

This paper reports data on the effect of green tea on the lipid peroxidation products formation and parameters of antioxidative system of the liver, blood serum and central nervous tissue of healthy young rats drinking green tea for five weeks. The rats were permitted free access to solubilized extract of green tea. Bioactive ingredients of green tea extract caused in the liver an increase in the activity of glutathione peroxidase and glutathione reductase and in the content of reduced glutathione as well as marked decrease in lipid hydroperoxides (LOOH), 4-hydroksynonenal (4-HNE) and malondialdehyde (MDA). The concentration of vitamin A increased by about 40%. Minor changes in the measured parameters were observed in the blood serum. GSH content increased slightly, whereas the index of the total antioxidant status increased significantly. In contrast, the lipid peroxidation products, particularly MDA was significantly diminished. In the central nervous tissue the activity of superoxide dismutase and glutathione peroxidase decreased while the activity od glutathione reductase and catalase increased after drinking green tea. Moreover the level of LOOH, 4-HNE and MDA significantly decreased. The use of green tea extract appeared to be beneficial to rats in reducing lipid peroxidation products. These results support and substantiate traditional consumption of green tea as protection against lipid peroxidation in the liver, blood serum, and central nervous tissue.