Characterization of the genome of Arabidopsis thaliana

The small crucifer Arabidopsis thaliana has many useful features as an experimental organism for the study of plant molecular biology. It has a four-week life-cycle, only five chromosomes and a genome size less than half that of Drosophila. To characterize the DNA sequence organization of this plant, we have randomly selected 50 recombinant lambda clones containing inserts with an average length of 12,800 base-pairs and analyzed their content of repetitive and unique DNA by various genome blot, restriction digestion and RNA blot procedures. The following conclusions can be drawn. The DNA represented in this random sample is composed predominantly of single-copy sequences. This presumably reflects the organization of the Arabidopsis genome as a whole and supports prior conclusions reached on the basis of kinetics of DNA reassociation. The DNA that encodes the ribosomal RNAs constitutes the only major class of cloned nuclear repetitive DNA. It consists of approximately 570 tandem copies of a heterogeneous 9900-base-pair repeat unit. There is an average of approximately 660 copies of the chloroplast genome per cell. Therefore, the chloroplast genome constitutes the major component of the repetitive sequences found in A. thaliana DNA made from whole plants. The inner cytosine residue in the sequence C-C-G-G is methylated more often than the outer in the tandem ribosomal DNA units, whereas very few differences in the methylation state of these two cytosine residues are detected in unique sequences.     

The shrunken genome of Arabidopsis thaliana

This paper examines macro and micro-level patterns of genome size evolution in the Brassicaceae. A phylogeny of 25 relatives of Arabidopsis thaliana was reconstructed using four molecular markers under both parsimony and Bayesian methods. Reconstruction of genome size (C value) evolution as a discrete character and as a continuous character was also performed. In addition, size dynamics in small chromosomal regions were assessed by comparing genomic clones generated for Arabidopsis lyrata and for Boechera stricta to the fully sequenced genome of A. thaliana. The results reveal a sevenfold variation in genome size among the taxa investigated and that the small genome size of A. thaliana is derived. Our results also indicate that the genome is free to increase or decrease in size across these evolutionary lineages without a directional bias. These changes are accomplished by insertions and deletions at both large and small-scales occurring mostly in intergenic regions, with repetitive sequences and transposable elements implicated in genome size increases. The focus upon taxa relatively closely related to the model organism A. thaliana, and the combination of complementary approaches, allows for unique insights into the processes driving genome size changes.     

The size and sequence organization of the centromeric region of Arabidopsis thaliana chromosome 4.

We have determined the genome structure of the centromeric region of Arabidopsis thaliana chromosome 4 by sequence analysis of BAC clones obtained by genome walking, followed by construction of a physical map using DNA of a hypomethylated strain. The total size of the centromeric region, corresponding to the recombinant inbred (RI) markers between mi87 and mi167, was approximately 5.3 megabases (Mb). This value is over 3 Mb longer than that previously estimated by the Arabidopsis Genome Initiative (Nature, 408, 796-815, 2000). Although we could not cover the entire centromeric region by BAC clones because of the presence of highly repetitive sequences in the middle (2.7 Mb), the cloned regions spanning approximately 1 Mb at both sides of the gap were newly sequenced. These results together with the reported sequences in the adjacent regions suggest that the centromeric region is principally composed of a central domain of 2.7 Mb, consisting of mainly 180-bp repeats and Athila elements, and upper and lower flanking regions of 1.55 Mb and 1 Mb, respectively. The flanking regions were predominantly composed of various types of transposable elements, except for the upper end moiety in which a large 5S rDNA array (0.65 Mb) and central domain-like sequence are present. Such an organization is essentially identical to the centromeric region of chromosome 5 reported previously.     

Interstitial telomere-like repeats in the Arabidopsis thaliana genome

Eukaryotic chromosomal ends are protected by telomeres, which are thought to play an important role in ensuring the complete replication of chromosomes. On the other hand, non-functional telomere-like repeats in the interchromosomal regions (interstitial telomeric repeats; ITRs) have been reported in several eukaryotes. In this study, we identified eight ITRs in the Arabidopsis thaliana genome, each consisting of complete and degenerate 300- to 1200-bp sequences. The ITRs were grouped into three classes (class IA-B, class II, and class IIIA-E) based on the degeneracy of the telomeric repeats in ITRs. The telomeric repeats of the two ITRs in class I were conserved for the most part, whereas the single ITR in class II, and the five ITRs in class III were relatively degenerated. In addition, degenerate ITRs were surrounded by common sequences that shared 70-100% homology to each other; these are named ITR-adjacent sequences (IAS). Although the genomic regions around ITRs in class I lacked IAS, those around ITRs in class II contained IAS (IASa), and those around five ITRs in class III had nine types of IAS (IASb, c, d, e, f, g, h, i, and j). Ten IAS types in classes II and III showed no significant homology to each other. The chromosomal locations of ITRs and IAS were not category-related, but most of them were adjacent to, or part of, a centromere. These results show that the A. thaliana genome has undergone chromosomal rearrangements, such as end-fusions and segmental duplications.     

Whole genome transcriptome polymorphisms in Arabidopsis thaliana

ArrayPlex is a software package that centrally provides a large number of flexible toolsets useful for functional genomics, including microarray data storage, quality assessments, data visualization, gene annotation retrieval, statistical tests, genomic sequence retrieval and motif analysis. It uses a client-server architecture based on open source components, provides graphical, command-line, and programmatic access to all needed resources, and is extensible by virtue of a documented application programming interface. ArrayPlex is available at http://sourceforge.net/projects/arrayplex/.     

The age of the Arabidopsis thaliana genome duplication

We estimate the timing of the Arabidopsis thaliana whole-genome duplication by means of phylogenetic and statistical analysis, and propose two possible scenarios for the duplication. The first one, based on the assumption that the duplicated segments diverged from an autotetraploid form, places the duplication at about 38 million years ago, after the Arabidopsislineage diverged from that of soybean (Glycine max) and before it diverged from its sister genus, Brassica. The second scenario assumes that the ancestor was allotetraploid, and suggests that the duplication is younger than 38 million years and may have contributed to the Arabidopsis-Brassica divergence. In each case, our estimate places the age of the genome duplication as significantly younger than previously reported.     

Gene targeting in Arabidopsis thaliana.

Summary Gene targeting of a chromosomally integrated transgene in Arabidopsis thaliana is reported. A chimeric gene consisting of the promoter of the 35S RNA of CaMV, the polyadenylation signal of the octopine synthase gene and the coding region of the bacterial hygromycin phosphotransferase gene (hpt), which was rendered non-functional by deletion of 19 bp, was introduced into the genome of A. thaliana using Agrobacterium-mediated gene transfer. A total of 3.46 x 10⁸ protoplasts isolated from 17 independent transgenic Arabidopsis lines harbouring the defective chimeric hpt gene were transformed via direct gene transfer using various DNA forms containing only the intact coding region of the hpt gene. Out of 150 hygromycin-resistant colonies appearing in the course of these experiments, four were the result of targeted recombination of the incoming DNA with the defective chromosomal locus as revealed by PCR and Southern blot analysis. Comparison with the number of transformants obtained when an hpt gene controlled by a promoter and terminator from the nopaline synthase gene was employed results in a maximal ratio of homologous to non-homologous transformation in A. thaliana of 1 x 10^–4.     

Gardening the genome: DNA methylation in Arabidopsis thaliana

DNA methylation has two essential roles in plants and animals - defending the genome against transposons and regulating gene expression. Recent experiments in Arabidopsis thaliana have begun to address crucial questions about how DNA methylation is established and maintained. One cardinal insight has been the discovery that DNA methylation can be guided by small RNAs produced through RNA-interference pathways. Plants and mammals use a similar suite of DNA methyltransferases to propagate DNA methylation, but plants have also developed a glycosylase-based mechanism for removing DNA methylation, and there are hints that similar processes function in other organisms.     

Gene prediction and gene classes in Arabidopsis thaliana

Gene prediction methods for eukaryotic genomes still are not fully satisfying. One way to improve gene prediction accuracy, proven to be relevant for prokaryotes, is to consider more than one model of genes. Thus, we used our classification of Arabidopsis thaliana genes in two classes (CU(1) and CU(2)), previously delineated according to statistical features, in the GeneMark gene identification program. For each gene class, as well as for the two classes combined, a Markov model was developed (respectively, GM-CU(1), GM-CU(2) and GM-all) and then used on a test set of 168 genes to compare their respective efficiency. We concluded from this analysis that GM-CU(1) is more sensitive than GM-CU(2) which seems to be more specific to a gene type. Besides, GM-all does not give better results than GM-CU(1) and combining results from GM-CU(1) and GM-CU(2) greatly improve prediction efficiency in comparison with predictions made with GM-all only. Thus, this work confirms the necessity to consider more than one gene model for gene prediction in eukaryotic genomes, and to look for gene classes in order to build these models.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Herbicide Safener-Inducible Gene Expression in Arabidopsis thaliana

The potential use of a new chemical-inducibie gene expressionsystem in Arabidopsis thaliana has been examined. The systemis based on the maize In2-2 promoter which is activated by benzenesulfonamideherbicide safe-ners. Plants transformed with the ß-glucuronidase(gus) reporter gene under the control of the In2-2 promoterwere grown in the presence of different safeners and the inducedGUS activity pattern was studied histochemically. In the absenceof safeners, the In2-2 promoter was not active. Applicationof different safeners induced distinct gus expression patterns,including expression in the root, hy-dathodes, and the shootapical meristem. Plants maintained continuously on inducingconcentrations of the safeners were retarded in growth. Thegrowth inhibition effects of the Sa5 safener could be overcomein a sul-fonylurea-resistant background. In2-2 promoter activitycould also be induced by the sulfonylurea herbicide chlor-sulfuron.In the sulfonylurea-resistant background, which derives fromherbicide-resistant acetolactate synthase activity, inductionof the In2-2 promoter by chlorsulfuron was lower. Furthermore,branched-chain amino acids, known to inhibit acetolactate synthaseactivity, also induced In2-2 promoter activity. Our data suggesta strong correlation between In2-2 expression and inhibitionof the acetolactate synthase activity. (Received November 12, 1996; Accepted February 21, 1997)     

Structural Analysis of a recA-like Gene in the Genome of Arabidopsis thaliana

A recA-like gene was identified in the genome of Arabidopsisthaliana by means of PCR using primers designed on the basisof previously reported amino acid sequences of eukaryotic RecA-likeproteins. The structure of the gene, termed ArLIM15, was investigatedby comparing the primary structure of the genomic DNA with thatof the corresponding cDNA. The open reading frame, which wassplit into 15 exons, was established to have the capacity forencoding a 37.3-kDa polypeptide. The amino acid sequence ofthe putative product of ArLIM15 showed a high degree of similaritytothat of LIM15 in the monocotyledonous plant Lilium, includinga 93% identity, and to those of other recA-like genes in yeastsand vertebrates with identities of 69–71%. Phylogeneticanalysis indicated ArLIM15 to be much closer to meiosis-specificLIM15 and DMC1 in Saccharomyces cerevisiae than to RAD51 inS. cerevisiae and its homologues on an evolutionary scale.