RNA-aptamers that modulate the RhoGEF activity of Tiam1

Rho GTPases regulate the actin cytoskeleton and thereby control cell migration, cell morphology, cell motility, and other cellular functions. The gene product of the oncogene Tiam1 acts as a guanine nucleotide exchange factor (GEF) for the Rho GTPase Rac. Like other RhoGEFs, Tiam1 is involved in cancer progression, but it also counteracts invasion in different cancer cell types. Hence, further investigations are required to unravel the functions of Tiam1 in the context of cancer initiation and progression, which appear to be cell specific. Although RhoGEFs in general seem to be attractive therapeutic targets, not many inhibitors have been described, yet. Here we report the identification and characterization of inhibitory RNA aptamers that specifically target Tiam1. After 16 selection rounds three aptamers sharing a 15 nucleotides consensus motif were identified. The clones K91 and K11 inhibited the Tiam1-mediated activation of the GTPase Rac2 in vitro. The tightest binder K91 neither bound the Rho GEF Vav1 nor the Arf GEF Cytohesin-2. In the presence of Rac1, the binding of K91 to Tiam1 was impaired indicating that the binding motif on Tiam1 overlaps with the GTPase binding site. K91 and K11 are the first reported inhibitory molecules targeting the GEF function of Tiam1. Due to their specificity over related GEF proteins they may represent promising tools for further elucidation of the biological functions of Tiam1. We anticipated that these aptamers will prove useful in validating the ambiguous roles of Tiam1 in cancer biology.     

An RNA molecule that specifically inhibits G-protein-coupled receptor kinase 2 in vitro

G-protein-coupled receptors are desensitized by a two-step process. In a first step, G-protein-coupled receptor kinases (GRKs) phosphorylate agonist-activated receptors that subsequently bind to a second class of proteins, the arrestins. GRKs can be classified into three subfamilies, which have been implicated in various diseases. The physiological role(s) of GRKs have been difficult to study as selective inhibitors are not available. We have used SELEX (systematic evolution of ligands by exponential enrichment) to develop RNA aptamers that potently and selectively inhibit GRK2. This process has yielded an aptamer, C13, which bound to GRK2 with a high affinity and inhibited GRK2-catalyzed rhodopsin phosphorylation with an IC50 of 4.1 nM. Phosphorylation of rhodopsin catalyzed by GRK5 was also inhibited, albeit with 20-fold lower potency (IC50 of 79 nM). Furthermore, C13 reveals significant specificity, since almost no inhibitory activity was detectable testing it against a panel of 14 other kinases. The aptamer is two orders of magnitude more potent than the best GRK2 inhibitors described previously and shows high selectivity for the GRK family of protein kinases.     

A DNA aptamer with high affinity and specificity for therapeutic anthracyclines

We describe the characterization of a DNA aptamer that displays high affinity and specificity for the anthracyclines daunomycin and doxorubicin, both of which are frequently used in chemotherapy. Aptamers were isolated from a pool of random sequences using a semiautomated procedure for magnetic beads. All selected aptamers displayed high affinity for the target molecule daunomycin. One aptamer was further characterized and exhibited a dissociation constant (KD) of 20 nM. To examine the aptamer's binding properties and clarify its applicability for diagnostic assays, its performance under various buffer conditions was evaluated. The aptamer proved to be very robust and not dependent on the presence of specific ions. It also tolerated a wide pH range and immobilization via 5'-biotinylation. Furthermore, a competition assay for sensitive daunomycin detection was established. This not only allows the determination of the aptamer's specificity but also allows the quantification of as little as 8.4 microg/L daunomycin and doxorubicin.     

In vitro selection of RNA aptamers that selectively bind danofloxacin

Danofloxacin is a synthetic fluoroquinolone with broad spectrum antibacterial activity that is used for the treatment of respiratory diseases in animal husbandry. However, danofloxacin has many adverse reactions and is toxic to humans. Especially, it detrimentally affects muscle, central nerve system, peripheral nerve system, liver, and skin in those who ingest foods in which danofloxacin has accumulated. Prescreening and determination of the level of danofloxacin in foods or food products is necessary for human health. Aptamers are composing of oligonucleotides that specifically interact with target molecules. They are emerging as detection/diagnostic ligands. Here, we used the SELEX in vitro selection technology to identify specific and high-affinity RNA aptamers with 2′-fluoro-2′-deoxyribonucleotide modified pyrimidine nucleotides against danofloxacin. Selected RNA aptamers bound specifically to danofloxacin, but not to tetracycline. Truncation of RNA aptamer up to 36 mer did not comprise specificity and affinity. The truncated RNA aptamer specifically bound to target chemical, allowing the discrimination of danofloxacin from other fluoroquinolones. The isolated specific aptamer could be a potential agent used for the rapid and cost-effective detection and sensing of danofloxacin, replacing instrumental methods including the more expensive and time-consuming methods of high performance liquid chromatography and liquid chromatography/mass spectrometry.     

Application of Microchip Electrophoresis in the Analysis of RNA Aptamer-Protein Interactions

DNA and RNA can be separated by microchip electrophoresis (ME) and detected using an intercalating fluorescent dye. The advantages of this method are short sensing times (< 3 min), avoidance of a radioisotope labeling detection system, relatively low costs, and reduced labor intensity. In the present study, RNA aptamer-protein or -peptide interactions were analyzed using ME and the regression of free aptamers corresponding to unbound RNA was detected as the target protein or peptide increased in a dose-dependent manner. Our results demonstrate the applicability of this method to simple, rapid ligand screening in the interactions between oligonucleotides and their targets.     

Assignment methodology for larger RNA oligonucleotides: Application to an ATP-binding RNA aptamer

The use of uniform 13C,15N labeling in the NMR spectroscopic study of RNA structures hasgreatly facilitated the assignment process in small RNA oligonucleotides. For ribose spinsystem assignments, exploitation of these labels has followed previously developed methodsfor the study of proteins. However, for sequential assignment of the exchangeable andnonexchangeable protons of the nucleotides, it has been necessary to develop a variety of newNMR experiments. Even these are of limited utility in the unambiguous assignment of largerRNAs due to the short carbon relaxation times and extensive spectral overlap for all nuclei.These problems can largely be overcome by the additional use of base-type selectively13C,15N-labeled RNA in combination with a judicious use of related RNAs with basesubstitutions. We report the application of this approach to a 36-nucleotide ATP-binding RNAaptamer in complex with AMP. Complete sequential 1H assignments, as well as the majorityof 13C and 15N assignments, were obtained.     

A binary Cy3 aptamer probe composed of folded modules

Aptamers are short single-stranded DNA or RNA sequences that are selected in vitro based on their high affinity to a target molecule. Dye-binding aptamers are promising tools for real-time detection of not only DNA or RNA sequences but also proteins of interest both in vitro and in vivo. In this study, we aimed to isolate an RNA aptamer to Cy3, a widely used, membrane-permeant, and nontoxic fluorescent cyanine dye. Extensive selection of affinity RNA molecules to Cy3 yielded a unique sequence aptamer named Cy3_apt. The selected Cy3_apt was 83 nucleotides long and successfully shortened to 49 nucleotides long with increased affinity to Cy3 by multiple base changes. The shortest Cy3_apt is composed of two separate hairpin modules that are required for the affinity to Cy3 as monitored by the surface plasmon resonance (SPR) assay. Also, the fluorescence of Cy3 increased on binding to Cy3_apt. The two modules of Cy3_apt, when detached from each other, functioned as a binary aptamer probe. We demonstrate that the binary Cy3_apt probe is applicable to the detection of target oligonucleotides or RNA-RNA interaction by tagging with target sequences. This binary probe consists of two folded modules, referred to as a folded binary probe.     

Specific modulation of the anti-DNA autoantibody-nucleic acids interaction by the high affinity RNA aptamer

Anti-DNA autoantibodies are one of the frequently found autoantibodies in systemic lupus erythematosus patient sera. RNA aptamers for the monoclonal G6-9 anti-DNA autoantibody were selected from a random pool of RNA library. Binding affinity of the best aptamer is around 2nM, which is at least 100-fold higher than that of cognate DNA antigen to the autoantibody. Aptamer binds specifically to the G6-9 autoantibody but not to other similar autoantibodies. Minimal binding motif of the aptamer was mapped, providing a hint for a natural epitope of the autoantibody. DNA binding to the G6-9 autoantibody is shown to be efficiently inhibited by the aptamer. Such binding property of the RNA aptamer could be used not only as a modulator for the pathogenic anti-DNA autoantibody, but also as a useful biochemical reagent for elucidating a fine specificity of the autoantibody-nucleic acid interaction.     

Inhibition of the functions of the nucleocapsid protein of human immunodeficiency virus-1 by an RNA aptamer

The nucleocapsid (NC) protein plays many roles in the life cycle of human immunodeficiency virus type-1 (HIV-1). Previously we selected the NC binding RNA aptamers from diverse forms of RNA libraries. Here we used one of the RNA aptamers to the NC protein, N70-13, and tested its effect on NC protein in vitro and in cells. The high affinity RNA aptamer completely abolished NC binding to the stable transactivation response hairpin and psi RNA stem-loops of HIV-1 RNA. When it was expressed in cells as an intramer it inhibited the packaging of viral genomic RNA and therefore promises to be an effective anti-HIV therapeutic tool.     

Antagonistic RNA aptamer specific to a heterodimeric form of human interleukin-17A/F

Interleukin-17 (IL-17) is a pro-inflammatory cytokine produced primarily by a subset of CD4⁺ T cells, called Th17 cells, that is involved in host defense, inflammation and autoimmune disorders. The two most structurally related IL-17 family members, IL-17A and IL-17F, form homodimeric (IL-17A/A, IL-17F/F) and heterodimeric (IL-17A/F) complexes. Although the biological significance of IL-17A and IL-17F have been investigated using respective antibodies or gene knockout mice, the functional study of IL-17A/F heterodimeric form has been hampered by the lack of an inhibitory tool specific to IL-17A/F. In this study, we aimed to develop an RNA aptamer that specifically inhibits IL-17A/F. Aptamers are short single-stranded nucleic acid sequences that are selected in vitro based on their high affinity to a target molecule. One selected aptamer against human IL-17A/F, AptAF42, was isolated by repeated cycles of selection and counterselection against heterodimeric and homodimeric complexes, respectively. Thus, AptAF42 bound IL-17A/F but not IL-17A/A or IL-17F/F. The optimized derivative, AptAF42dope1, blocked the binding of IL-17A/F, but not of IL-17A/A or IL-17F/F, to the IL-17 receptor in the surface plasmon resonance assay in vitro. Consistently, AptAF42dope1 blocked cytokine GRO-α production induced by IL-17A/F, but not by IL-17A/A or IL-17F/F, in human cells. An RNA footprinting assay using ribonucleases against AptAF42dope1 in the presence or absence of IL-17A/F revealed that part of the predicted secondary structure fluctuates between alternate forms and that AptAF42dope1 is globally protected from ribonuclease cleavage by IL-17A/F. These results suggest that the selected aptamer recognizes a global conformation specified by the heterodimeric surface of IL-17A/F.     

Nucleotides that are essential but not conserved; a sufficient L-tryptophan site in RNA

Conservation is often used to define essential sequences within RNA sites. However, conservation finds only invariant sequence elements that are necessary for function, rather than finding a set of sequence elements sufficient for function. Biochemical studies in several systems—including the hammerhead ribozyme and the purine riboswitch—find additional elements, such as loop–loop interactions, required for function yet not phylogenetically conserved. Here we define a critical test of sufficiency: We embed a minimal, apparently sufficient motif for binding the amino acid tryptophan in a random-sequence background and ask whether we obtain functional molecules. After a negative result, we use a combination of three-dimensional structural modeling, selection, designed mutations, high-throughput sequencing, and bioinformatics to explore functional insufficiency. This reveals an essential unpaired G in a diverse structural context, varied sequence, and flexible distance from the invariant internal loop binding site identified previously. Addition of the new element yields a sufficient binding site by the insertion criterion, binding tryptophan in 22 out of 23 tries. Random insertion testing for site sufficiency seems likely to be broadly revealing.     

Effects of single nucleotide changes on the binding and activity of RNA aptamers to human papillomavirus 16 E7 oncoprotein

A virally-encoded oncoprotein (E7 from human papillomavirus 16, involved in the initiation of cell transformation) was the target for RNA aptamer development by the process of systematic evolution of ligands by exponential enrichment (SELEX). A number of aptamers were identified, one of which was shown to inhibit the interaction between E7 and its major binding partner, pRb. Aptamers with very similar sequences (more than 92% similarity in the random regions) did not share this activity. This study demonstrates the potential of aptamers to be highly specific, with small differences in aptamer sequence having profound effects on function.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Toward Ribosomal RNA Catalytic Activity in the Absence of Protein

The ribosome is the ribonucleoprotein particle responsible for translation of genetic information into proteins. The RNA component of the ribosome has been implicated as the catalytic entity for peptide bond formation based on protease resistance and structural data indicating an all-RNA active site. Nevertheless, peptidyl transfer by ribosomal RNA (rRNA) alone has not been demonstrated. In an attempt to show such activity we generated a minimal construct that comprises much of the 23S rRNA peptidyl transferase center, including the central loop and the A- and P-loops. This minimal rRNA domain was inactive in peptide bond formation under all conditions tested. The RNA was subsequently subjected to six rounds of in vitro selection designed to enrich for this activity. The result was a mutated rRNA sequence that could catalyze the covalent linkage of an A-site and P-site substrate; however, the product did not contain a peptide bond. The current study is an example of an in vitro derived alternate function of rRNA mutants and illustrates the evolutionary possibility that the protoribosome may have used amino acids as substrates before it gained the ability to join them into peptides. Though peptidyl transferase activity in the absence of protein remains elusive, the ease with which alternate catalytic activity was selected from rRNA with a small number of mutations suggests that rRNA may have inherent activity. This study represents a step on the path toward isolating that native activity. Electronic Supplementary Material The online version of this article (doi:) contains supplementary material, which is available to authorized users. [Reviewing Editor: Dr. Niles Lehman]     

An adaptable pentaloop defines a robust neomycin-B RNA aptamer with conditional ligand-bound structures

Aptamers can be highly specific for their targets, which implies precise molecular recognition between aptamer and target. However, as small polymers, their structures are more subject to environmental conditions than the more constrained longer RNAs such as those that constitute the ribosome. To understand the balance between structural and environmental factors in establishing ligand specificity of aptamers, we examined the RNA aptamer (NEO1A) previously reported as specific for neomycin-B. We show that NEO1A can recognize other aminoglycosides with similar affinities as for neomycin-B and its aminoglycoside specificity is strongly influenced by ionic strength and buffer composition. NMR and 2-aminopurine (2AP) fluorescence studies of the aptamer identified a flexible pentaloop and a stable binding pocket. Consistent with a well-structured binding pocket, docking analysis results correlated with experimental measures of the binding energy for most ligands. Steady state fluorescence studies of 2AP-substituted aptamers confirmed that A16 moves to a more solvent accessible position upon ligand binding while A14 moves to a less solvent accessible position, which is most likely a base stack. Analysis of binding affinities of NEO1A sequence variants showed that the base in position 16 interacts differently with each ligand and the interaction is a function of the buffer constituents. Our results show that the pentaloop provides NEO1A with the ability to adapt to external influences on its structure, with the critical base at position 16 adjusting to incorporate each ligand into a stable pocket by hydrophobic interactions and/or hydrogen bonds depending on the ligand and the ionic environment.