Oligonucleotide structure influences the interactions between cationic polymers and oligonucleotides

We examined the effect of oligodeoxynucleotide (ODN) structure on the interactions between cationic polymers and ODNs. Unstructured and hairpin structured ODNs were used to form complexes with the model cationic polymer, poly-L-lysine (pLL), and the characteristics of these polymer-ODN interactions were subsequently examined. We found that hairpin structured ODNs formed complexes with pLL at slightly lower pLL:ODN charge ratios as compared to unstructured ODNs and that, at high charge ratios, greater fractions of the hairpin ODNs were complexed, as measured by dye exclusion. The dissociation of pLL-ODN interactions was tested further by challenge with heparin, which induced complex disruption. Both the kinetics and heparin dose response of ODN release were determined. The absolute amount and the kinetic rate of ODN release from the complexes of pLL and unstructured ODN were greater, as compared to hairpin ODNs. Our results therefore highlight the role of ODN structure on the association-dissociation behavior of polymer-ODN complexes. These findings have implications for the selection of ODN sequences and design of polymeric carriers used for cellular delivery of ODNs.     

Interaction of oligonucleotides with cationic lipids: the relationship between electrostatics, hydration and state of aggregation

Lipoplexes, which are spontaneously formed complexes between oligonucleotide (ODN) and cationic lipid, can be used to deliver ODNs into cells, both in vitro and in vivo. The present study was aimed at characterizing the interactions associated with the formation of lipoplexes, specifically in terms of electrostatics, hydration and particle size. Large unilamellar vesicles (approximately 100 nm diameter), composed of either DOTAP, DOTAP/cholesterol (mole ratio 1:1) or DOTAP/DOPE (mole ratio 1:1) were employed as a model of cationic liposomes. Neutral vesicles ( approximately 100 nm diameter), composed of DOPC/DOPE (mole ratio 1:1), were employed as control liposomes. After ODN addition to vesicles, at different mole ratios, changes in pH and electrical surface potential at the lipid-water interface were analyzed by using the fluorophore heptadecyl-7-hydroxycoumarin. In separate 'mirror image' experiments, liposomes were added at different mole ratios to fluorescein isothiocyanate-labeled ODNs, thus yielding data about changes in the pH near the ODN molecules induced by the complexation with the cationic lipid. Particle size distribution and turbidity fluctuations were analyzed by the use of photon correlation spectroscopy and static light-scattering, respectively. In additional fluorescent probe studies, TMADPH was used to quantify membrane defects while laurdan was used to measure the level of hydration at the water-lipid interface. The results indicate that mutual neutralization of cationic lipids by ODNs and vice versa is a spontaneous reaction and that this neutralization is the main driving force for lipoplex generation. When lipid neutralization is partial, induced membrane defects cause the lipoplexes to exhibit increased size instability.     

Poly(propylacrylic acid) enhances cationic lipid-mediated delivery of antisense oligonucleotides

The use of antisense oligodeoxynucleotides (ODNs) to inhibit the expression of specific mRNA targets represents a powerful technology for control of gene expression. Cationic lipids and polymers are frequently used to improve the delivery of ODNs to cells, but the resulting complexes often aggregate, bind to serum components, and are trafficked poorly within cells. We show that the addition of a synthetic, pH-sensitive, membrane-disrupting polyanion, poly(propylacrylic acid) (PPAA), improves the in vitro efficiency of the cationic lipid, DOTAP, with regard to oligonucleotide delivery and antisense activity. In characterization studies, ODN complexation with DOTAP/ODN was maintained even when substantial amounts of PPAA were added. The formulation also exhibited partial protection of phosphodiester oligonucleotides against enzymatic digestion. In Chinese hamster ovary (CHO) cells, incorporation of PPAA in DOTAP/ODN complexes improved 2- to 3-fold the cellular uptake of fluorescently tagged oligonucleotides. DOTAP/ODN complexes containing PPAA also maintained high levels of uptake into cells upon exposure to serum. Addition of PPAA to DOTAP/ODN complexes enhanced the antisense activity (using GFP as the target) over a range of PPAA concentrations in both serum-free, and to a lesser extent, serum-containing media. Thus, PPAA is a useful adjunct that improves the lipid-mediated delivery of oligonucleotides.     

Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures

Typical methods used for encapsulating antisense oligodeoxynucleotides (ODN) and plasmid DNA in lipid vesicles result in very low encapsulation efficiencies or employ cationic lipids that exhibit unfavorable pharmacokinetic and toxicity characteristics when administered intravenously. In this study, we describe and characterize a novel formulation process that utilizes an ionizable aminolipid (1,2-dioleoyl-3-dimethylammonium propane, DODAP) and an ethanol-containing buffer system for encapsulating large quantities (0.15--0.25 g ODN/g lipid) of polyanionic ODN in lipid vesicles. This process requires the presence of up to 40% ethanol (v/v) and initial formulation at acidic pH values where the DODAP is positively charged. In addition, the presence of a poly(ethylene glycol)-lipid was required during the formulation process to prevent aggregation. The 'stabilized antisense-lipid particles' (SALP) formed are stable on adjustment of the external pH to neutral pH values and the formulation process allows encapsulation efficiencies of up to 70%. ODN encapsulation was confirmed by nuclease protection assays and (31)P NMR measurements. Cryo-electron microscopy indicated that the final particles consisted of a mixed population of unilamellar and small multilamellar vesicles (80--140 nm diameter), the relative proportion of which was dependent on the initial ODN to lipid ratio. Finally, SALP exhibited significantly enhanced circulation lifetimes in mice relative to free antisense ODN, cationic lipid/ODN complexes and SALP prepared with quaternary aminolipids. Given the small particle sizes and improved encapsulation efficiency, ODN to lipid ratios, and circulation times of this formulation compared to others, we believe SALP represent a viable candidate for systemic applications involving nucleic acid therapeutics.     

New effects in polynucleotide release from cationic lipid carriers revealed by confocal imaging, fluorescence cross-correlation spectroscopy and single particle tracking

We report on new insights into the mechanisms of short single and double stranded oligonucleotide release from cationic lipid complexes (lipoplexes), used in gene therapy. Specifically, we modeled endosomal membranes using giant unilamellar vesicles and investigated the roles of various individual cellular phospholipids in interaction with lipoplexes. Our approach uses a combination of confocal imaging, fluorescence cross-correlation spectroscopy and single particle tracking, revealing several new aspects of the release: (a) phosphatidylserine and phosphatidylethanolamine are equally active in disassembling lipoplexes, while phosphatidylcholine and sphingomyelin are inert; (b) in contrast to earlier findings, phosphatidylethanolamine alone, in the absence of anionic phosphatidylserine triggers extensive release; (c) a double-stranded DNA structure remains well preserved after release; (d) lipoplexes exhibited preferential binding to transient lipid domains, which appear at the onset of lipoplex attachment to originally uniform membranes and vanish after initiation of polynucleotide release. The latter effect is likely related to phosphatidyleserine redistribution in membranes due to lipoplex binding. Real time tracking of single DOTAP/DOPE and DOTAP/DOPC lipoplexes showed that both particles remained compact and associated with membranes up to 1-2 min before fusion, indicating that a more complex mechanism, different from suggested earlier rapid fusion, promotes more efficient transfection by DOTAP/DOPE complexes.     

New effects in polynucleotide release from cationic lipid carriers revealed by confocal imaging, fluorescence cross-correlation spectroscopy and single particle tracking

We report on new insights into the mechanisms of short single and double stranded oligonucleotide release from cationic lipid complexes (lipoplexes), used in gene therapy. Specifically, we modeled endosomal membranes using giant unilamellar vesicles and investigated the roles of various individual cellular phospholipids in interaction with lipoplexes. Our approach uses a combination of confocal imaging, fluorescence cross-correlation spectroscopy and single particle tracking, revealing several new aspects of the release: (a) phosphatidylserine and phosphatidylethanolamine are equally active in disassembling lipoplexes, while phosphatidylcholine and sphingomyelin are inert; (b) in contrast to earlier findings, phosphatidylethanolamine alone, in the absence of anionic phosphatidylserine triggers extensive release; (c) a double-stranded DNA structure remains well preserved after release; (d) lipoplexes exhibited preferential binding to transient lipid domains, which appear at the onset of lipoplex attachment to originally uniform membranes and vanish after initiation of polynucleotide release. The latter effect is likely related to phosphatidyleserine redistribution in membranes due to lipoplex binding. Real time tracking of single DOTAP/DOPE and DOTAP/DOPC lipoplexes showed that both particles remained compact and associated with membranes up to 1-2 min before fusion, indicating that a more complex mechanism, different from suggested earlier rapid fusion, promotes more efficient transfection by DOTAP/DOPE complexes.     

Oligonucleotide delivery by a cationic derivative of the polyene antibiotic amphotericin B. II: study of the interactions of the oligonucleotide/cationic vector complexes with lipid monolayers and lipid unilamellar vesicles

We report a study of the behavior of oligodeoxyribonucleotide (ODN)/amphotericin B3-(N'-dimethylamino)propylamide (AMA) complexes, in the presence of lipid monolayers and large unilamellar vesicles. This study follows the recent discovery of the capacity of AMA, as a new cationic vector, to enhance ODN cellular uptake and efficacy. It aims at investigating the internalization mode of a nucleic acid by AMA. A first study at the air-water interface of AMA and AMA/ODN by surface pressure measurement shows that only free AMA would adsorb at the air-water interface. Second, in the presence of zwitterionic phospholipid- and sterol-containing mixture, ODN-AMA interactions in solution would be higher than lipid-AMA interactions at the interface. In monolayer or with large unilamellar vesicles, AMA monomers adsorb mainly at the phospholipid interface. These results favor a crossing mechanism through AMA channel formation, despite the size of ODN.     

Polyethylenimine but not cationic lipid improves antisense activity of 3'-capped phosphodiester oligonucleotides

Lipofectin, which is a mixture of neutral lipid with a cationic lipid, has been widely used to enhance cellular delivery of phosphorothioate, 2'-sugar-modified, and chimeric antisense oligonucleotides. Phosphodiester oligonucleotides delivered with Lipofectin usually do not elicit antisense activity probably because cationic lipid formulations do not sufficiently protect unmodified oligonucleotides from nuclease degradation. We show that a cationic polymer, polyethylenimine (PEI), improves the uptake and antisense activity of 3'-capped 20-mer and 12-mer antisense phosphodiester oligonucleotides (PO-ODN) targeted to different regions of Ha-ras mRNA and to the 3'-untranslated region (3'-UTR) of C-raf kinase. In contrast, PEI, which forms a very stable complex with the 20-mer phosphorothioate oligonucleotide (PS-ODN), does not enhance its antisense activity. Using fluorescently labeled carriers and ODN, we show that PEI-PS-ODN particles are very efficiently taken up by cells but PS-ODN is not dissociated from the carrier. Our results indicate that carrier-ODN particle size and stability and ODN release kinetics vary with the chemical nature of the ODN and the carrier being transfected into the cells. The very low cost of PEI compared with cytofectins and the increased affinity for target mRNA and decreased affinity for proteins of PO-ODN compared with PS-ODN make the use of PEI-PO-ODN very attractive.     

Characterization of the inhibitory effect of PEG-lipid conjugates on the intracellular delivery of plasmid and antisense DNA mediated by cationic lipid liposomes

Poly(ethylene glycol)-lipid (PEG-lipid) conjugates are widely used in the field of liposomal drug delivery to provide a polymer coat that can confer favorable pharmacokinetic characteristics on particles in the circulation. More recently these lipids have been employed as an essential component in the self-assembly of cationic and neutral lipids with polynucleic acids to form small, stable lipid/DNA complexes that exhibit long circulation times in vivo and accumulate at sites of disease. However, the presence of a steric barrier lipid might be expected to inhibit the transfection activity of lipid/DNA complexes by reducing particle-membrane contact. In this study we examine what effect varying the size of the hydrophobic anchor and hydrophilic head group of PEG-lipids has on both gene and antisense delivery into cells in culture. Lipid/DNA complexes were made using unilamellar vesicles composed of 5 mole% PEG-lipids in combination with equimolar dioleoylphosphatidylethanolamine and the cationic lipid dioleyldimethylammonium chloride. Using HeLa and HepG2 cells we show that under the conditions employed PEG-lipids had a minimal effect on the binding and subsequent endocytosis of lipid/DNA complexes but they severely inhibited active gene transfer and the endosomal release of antisense oligodeoxynucleotides into the cytoplasm. Decreasing the size of the hydrophobic anchor or the size of the grafted hydrophilic PEG moiety enhanced DNA transfer by the complexes.     

Toll-like receptors as adjuvant receptors

Poly(ethylene glycol)-lipid (PEG-lipid) conjugates are widely used in the field of liposomal drug delivery to provide a polymer coat that can confer favorable pharmacokinetic characteristics on particles in the circulation. More recently these lipids have been employed as an essential component in the self-assembly of cationic and neutral lipids with polynucleic acids to form small, stable lipid/DNA complexes that exhibit long circulation times in vivo and accumulate at sites of disease. However, the presence of a steric barrier lipid might be expected to inhibit the transfection activity of lipid/DNA complexes by reducing particle-membrane contact. In this study we examine what effect varying the size of the hydrophobic anchor and hydrophilic head group of PEG-lipids has on both gene and antisense delivery into cells in culture. Lipid/DNA complexes were made using unilamellar vesicles composed of 5 mole% PEG-lipids in combination with equimolar dioleoylphosphatidylethanolamine and the cationic lipid dioleyldimethylammonium chloride. Using HeLa and HepG2 cells we show that under the conditions employed PEG-lipids had a minimal effect on the binding and subsequent endocytosis of lipid/DNA complexes but they severely inhibited active gene transfer and the endosomal release of antisense oligodeoxynucleotides into the cytoplasm. Decreasing the size of the hydrophobic anchor or the size of the grafted hydrophilic PEG moiety enhanced DNA transfer by the complexes.     

Abrogation of the Fc gamma receptor IIA-mediated phagocytic signal by stem-loop Syk antisense oligonucleotides.

The role of Syk kinase in Fc gamma receptor (Fc gamma R) IIA-mediated phagocytosis was examined with two forms of antisense oligodeoxynucleotides (ODNs) designed to hybridize to human Syk mRNA. Monocytes were incubated with linear and stem-loop antisense ODNs targeted to Syk mRNA. When complexed with cationic liposomes, stem-loop Syk antisense ODN with phosphorothioate modification exhibited stability in fetal bovine and human serum. The stem-loop Syk antisense ODN at a concentration of 0.2 microM inhibited Fc gamma RIIA-mediated phagocytosis by 90% and completely eliminated Syk mRNA and protein in monocytes, whereas scrambled-control ODNs had no effect. The Syk antisense ODNs did not change beta-actin mRNA levels and Fc gamma RII cell-surface expression. In addition, stem-loop Syk antisense ODN inhibited Fc gamma RI and Fc gamma RIIIA-mediated phagocytosis. These data indicate the efficacy of stem-loop Syk antisense ODN for targeting and degrading Syk mRNA and protein and the importance of Syk kinase in Fc gamma receptor-mediated phagocytosis. Immunoblotting assay demonstrated that Fc gamma RII tyrosine phosphorylation after Fc gamma RII cross-linking did not change in the absence of Syk protein. These results indicate that Syk kinase is required for Fc gamma RIIA-mediated phagocytic signaling and that Fc gamma RII cross-linking leads to tyrosine phosphorylation of Fc gamma RII independent of Syk kinase.     

Oligodeoxynucleotides containing C-7 propyne analogs of 7-deaza-2'-deoxyguanosine and 7-deaza-2'-deoxyadenosine.

The synthesis, hybridization properties and antisense activities of oligodeoxynucleotides (ODNs) containing 7-(1-propynyl)-7-deaza-2'-deoxyguanosine (pdG) and 7-(1-propynyl)-7-deaza-2'-deoxyadenosine (pdA) are described. The suitably protected nucleosides were synthesized and incorporated into ODNs. Thermal denaturation (Tm) of these ODNs hybridized to RNA demonstrates an increased stability relative to 7-unsubstituted deazapurine and unmodified ODN controls. Antisense inhibition by these ODNs was determined in a controlled microinjection assay and the results demonstrate that an ODN containing pdG is approximately 6 times more active than the unmodified ODN. 7-Propyne-7-deaza-2'-deoxyguanosine is a promising lead analog for the development of antisense ODNs with increased potency.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Preparation and some properties of giant liposomes and proteoliposomes

Optimal conditions for formation of giant liposomes and proteoliposomes were investigated. A suspension of small unilamellar vesicles made of various phospholipids in a buffer of 0-3 M KCl, 0.1 mM EDTA, and 20 mM MOPS (pH 7.0) was subjected to a freeze-thaw treatment. Giant multilamellar liposomes of diameter ranging from 10 to 60 microns were found to form from phospholipid mixtures containing phosphatidylethanolamine as a major component and phosphatidylserine as a minor component. The concentration of KCl optimal for the giant vesicle formation was 30-500 mM. By applying a patch-pipette to a giant liposome, suitable conditions for obtaining a high-resistance (giga-ohm) seal were sought. It was found that use of a patch-pipette of relatively small tip diameter (less than 1 micron), the presence of divalent metal cations in the suspension medium and inflation of vesicles in a hypotonic solution facilitated giga-seal formation. In a suspension of asolectin (soybean phospholipid) vesicles which had been subjected to the freeze-thaw treatment, giant unilamellar vesicles were found. They could be held on the tip of a suction pipette and impaled with a microelectrode filled with an EGTA solution. Small unilamellar proteoliposomes were prepared by the cholate-dialysis method from asolectin and sarcoplasmic reticulum vesicles, and were subjected to a freeze-thaw cycle. When the ratio of exogenous phospholipid to protein was larger than 10, giant multilamellar vesicles were formed.(ABSTRACT TRUNCATED AT 250 WORDS)     

Specific Lipoplex-Mediated Antisense Against Bcl-2 in Breast Cancer Cells: A Comparison between Different Formulations

G3139 is an antisense oligonucleotide (ODN) that can down-regulate bcl-2, thus potentially acting as a potent anticancer drug. However, effective therapy requires efficient ODN delivery, which may be achieved by employing G3139 lipoplexes. Yet, lipofection is a complex, multifactorial process that is still poorly understood. In order to shed more light on this issue, we prepared 18 different G3139 lipoplex formulations and compared them in terms of their capability to transfect MCF-7 breast cancer cells. Each formulation was composed of a cationic lipid and sometimes a helper lipid. The cationic lipid was either DOTAP (N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride), DC-CHOL (3β[N-(N′,N′-dimethylaminoethane)carbamoyl]-cholesterol), or CCS (ceramide carbomoyl spermine). The helper lipid was either DOPC, DOPE, or cholesterol. Each lipid combination existed in two different structural forms — either large unilamellar vesicles (～100 nm LUV) or unsized heterolamellar vesicles (UHV). Cell proliferation assays were used to evaluate the cytotoxicity of G3139 lipoplexes, control cationic lipid assemblies, and free G3139. Western blots were used to confirm the specific activity of G3139 as an anti-bcl-2 antisense agent. We determined that treatment of MCF-7 cells with G3139:CCS lipoplexes (UHV-derived) produced a maximal 50-fold improvement in antisense efficacy compared to treatment with free G3139. The other G3139 lipoplexes were not superior to free G3139. Thus, successful lipofection requires precise optimization of lipoplex lipid composition, structure, and concentration.     

Specific lipoplex-mediated antisense against Bcl-2 in breast cancer cells: a comparison between different formulations

G3139 is an antisense oligonucleotide (ODN) that can down-regulate bcl-2, thus potentially acting as a potent anticancer drug. However, effective therapy requires efficient ODN delivery, which may be achieved by employing G3139 lipoplexes. Yet, lipofection is a complex, multifactorial process that is still poorly understood. In order to shed more light on this issue, we prepared 18 different G3139 lipoplex formulations and compared them in terms of their capability to transfect MCF-7 breast cancer cells. Each formulation was composed of a cationic lipid and sometimes a helper lipid. The cationic lipid was either DOTAP (N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride), DC-CHOL (3ss[N-(N',N'-dimethylaminoethane)carbamoyl]-cholesterol), or CCS (ceramide carbomoyl spermine). The helper lipid was either DOPC, DOPE, or cholesterol. Each lipid combination existed in two different structural forms--either large unilamellar vesicles (approximately 100 nm LUV) or unsized heterolamellar vesicles (UHV). Cell proliferation assays were used to evaluate the cytotoxicity of G3139 lipoplexes, control cationic lipid assemblies, and free G3139. Western blots were used to confirm the specific activity of G3139 as an anti-bcl-2 antisense agent. We determined that treatment of MCF-7 cells with G3139:CCS lipoplexes (UHV-derived) produced a maximal 50-fold improvement in antisense efficacy compared to treatment with free G3139. The other G3139 lipoplexes were not superior to free G3139. Thus, successful lipofection requires precise optimization of lipoplex lipid composition, structure, and concentration.     

Subcellular trafficking of antisense oligonucleotides and down-regulation of bcl-2 gene expression in human melanoma cells using a fusogenic liposome delivery system

Antisense oligonucleotides (ODN) targeted to specific genes have shown considerable potential as therapeutic agents. The polyanionic charges carried by these molecules, however, present a barrier to efficient cellular uptake and consequently their biological effects on gene regulation are compromised. To overcome this obstacle, a rationally designed carrier system is desirable for antisense delivery. This carrier should assist antisense ODN penetrate the cell membrane and, once inside the cell, then release the ODN and make them available for target binding. We have developed a carrier formulation employing programmable fusogenic vesicles (PFV) as the antisense delivery mediator. This study investigates the intracellular fate of PFV–ODN and bioavailability of antisense ODN to cells. The subcellular distribution of PFV and ODN was examined by monitoring the trafficking of FITC-labeled ODN and rhodamine/phosphatidylethanolamine (Rh-PE)-labeled PFV using confocal microscopy. Fluorescently tagged ODN were first co-localized with the liposomal carrier in the cytoplasm, presumably in endosome/lysosome compartments, shortly after incubation of PFV–ODN with HEK 293 and 518A2 cells. Between 24 and 48 h incubation, however, separation of FITC–ODN from the carrier and subsequent accumulation in the nucleus was observed. In contrast, the Rh-PE label was localized to the cell cytoplasm. The enhanced cellular uptake achieved using the PFV carrier, compared to incubation of free ODN with cells, and subsequent release of ODN from the carrier resulted in significant down-regulation of mRNA expression. Specifically, G3139, an antisense construct targeting the apoptotic antagonist gene bcl-2, was examined in the human melanoma cell line 518A2. Upon exposure to PFV-encapsulated G3139, cells displayed a time-dependent reduction in bcl-2 message levels. The bcl-2 mRNA level was reduced by 50% after 24 h treatment and by ~80% after 72 h when compared to cells treated with free G3139, empty PFV or PFV–G3622, a control ODN sequence. Our results establish that ODN can be released from PFV after intracellular uptake and can then migrate to the nucleus and selectively down-regulate target mRNA.     

The lateral diffusion of selectively aggregated peptides in giant unilamellar vesicles

We have systematically investigated the effect of aggregation of a transmembrane peptide on its diffusion in dimyristoylphosphatidylcholine and in palmitoyloleoylphosphatidylcholine model membranes. The hydrophobic segment of the b subunit from E. coli F(1)F(0)-ATP synthase was modified with a histidine tag at the carbonyl terminus and was aggregated selectively by using a series of multivalent, dendritic chelating agents with nitrilotriacetic acid functional groups. Peptide complexes ranging from monomers to hexamers were formed and studied in giant unilamellar vesicles. The rate of diffusion for the transmembrane peptide complexes were found to depend on the size of the complex. The results agree with predictions from the free area model for monomers and dimers, and the hydrodynamic continuum model for tetramers, pentamers, and hexamers. Comparisons with diffusion of lipids confirm that the diffusion of a transmembrane peptide is enhanced by coupling of density fluctuations between the two monolayers.     

Antisense inhibition of IGF receptor expression in HaCaT keratinocytes: a model for antisense strategies in keratinocytes

Antisense strategies targeting skin conditions are attractive in concept, with a number of possible pathologic conditions, such a psoriasis, apparently suitable for such an approach. Because in vitro screening of candidate sequences is usually desirable, we have attempted to use a range of new generation cationic lipids to produce significant antisense oligodeoxynucleotide (ODN) uptake in an immortalized keratinocyte cell line (HaCaT). A large number of commercially available lipids were screened for the ability to induce nuclear ODN localization: Tfx-50, Tfx-20, Tfx-10, Superfect, Cytofectin GSV, Perfect lipids 1-8, Lipofectin, and Lipofectamine. All lipids were used at a range of concentrations (1-20 microg/ml) and with a range of ODN concentrations (1-1000) nM). Of all lipids used, only Cytofectin GSV and Superfect produced significant (>30% of cells) levels of nuclear positive cells, with Superfect also producing significant toxicity at the effective concentration used. Only two treatments produced a significant reduction in target mRNA: insulin-like growth factor-1 receptor (IGF-1R)-ODN 64 complexed with Cytofectin GSV (27.1% +/- 3.5% of IGF-1R mRNA in untreated cells,p < 0.01) and ODN 64 complexed with 10 microg/ml Lipofectin (62.2% +/- 3.4% of IGF-1R mRNA in untreated cells, p < 0.05). Only one treatment, ODN 64 complexed with Cytofectin GSV, produced a reduction in cell growth and survival as assessed by amido black assay. These results demonstrate that in HaCaT keratinocytes, Cytofectin GSV alone of all commercially available cationic lipids was effective in delivering antisense ODN into cell nuclei such that a profound antisense effect could be demonstrated.