The 5'-terminal sequence of Q 6S RNA

[γ-³²P]GTP-Labeled Qβ 6S RNA yielded only one major radioactive oligonucleotide after digestion with pancreatic ribonuclease. Nearest neighbor analysis of this 5′-oligonucleotide demonstrated that approximately 95% of the molecules terminate with the same sequence, pppGpGpCp. This sequence is the complement of the only major 3′-sequence found in this RNA. Both strands of 6S RNA therefore appear to have identical 3′- and 5′-terminal trinucleotide sequences.     

Site-directed mutagenesis: Generation of an extracistronic mutation in bacteriophage Qβ RNA

The preparation in vitro and chemical characterization of bacteriophage Qβ RNA with an extracistronic mutation, a G → A transition in the 16th position from the 3′-terminus, is described. The 5′-terminal region of the Qβ minus strand was synthesized in vitro up to position 14 (inclusive) by using ATP and GTP as the only substrates. The mutagenic nucleotide analog N⁴-hydroxyCMP was then incorporated into position 15 instead of CMP. The minus strand was completed with the four standard ribonucleoside triphosphates, purified and used as a template for the synthesis of plus strands. Of the plus strand product, 33% had a G → A transition in the 16th position from the 3′-end (which corresponds to position 15 of the minus strand), as shown by nucleotide sequence analysis of the terminal T₁ oligonucleotide. The modified RNA was efficiently replicated by Qβ replicase and a preparation containing 55% of the mutant RNA was obtained.The general approach to directed mutagenesis outlined above should allow the introduction of mutations into the 5′ and 3′-terminal regions of Qβ RNA as well as into the intercistronic sequences.     

Interactions of Q beta replicase with Q beta RNA

The interactions of Qβ replicase with Qβ RNA were investigated by treating replicase-Qβ RNA complexes under various conditions with ribonuclease T₁, and by characterizing enzyme-bound RNA fragments recovered by a filter binding technique. Evidence for replicase binding at two internal regions of Qβ RNA was obtained. One region (at about 1250 to 1350 nucleotides from the 5′ end) overlaps with the initiation site for coat protein synthesis; this interaction is thought to be inessential for template activity but rather to be involved in the regulation of protein synthesis. Binding to this site (called the S-site) requires moderate concentrations of salt but no magnesium ions. The other region (at about 2550 to 2870 nucleotides from the 5′ end) is probably essential for template activity; binding to this site (called the M-site) is dependent on the presence of magnesium ions. The nucleotide sequences of the RNA fragments from the two sites were determined and found to have no common features. Under the conditions tested, replicase binding at the 3′ end of Qβ RNA could not be demonstrated, except when initiation of RNA synthesis was allowed to occur in the presence of GTP and host factor. If instead of intact Qβ RNA, a complete RNAase T₁ digest of Qβ RNA was allowed to bind to replicase, oligonucleotides from the S-site and the M-site, and oligonucleotides from a region close to the 3′ end, were found to have the highest affinity to the enzyme.The RNA fragments recovered in highest yield, M-2 and S-3 from the M and S-site, respectively, were isolated on a preparative scale and their enzyme binding properties were studied. In competition assays with random RNA fragments of the same size, selective binding was observed both for the M and the S-site fragment. Partial competition for replicase binding was found if M-2 and S-3 were presented simultaneously to the enzyme. Either fragment, if preincubated with replicase, caused a specific inhibition of initiation of Qβ RNA-directed RNA synthesis, without inhibiting the poly(rC)-directed reaction.The results are discussed in terms of a model of replicase-Qβ RNA recognition. Template specificity is attributed to binding of internal RNA regions to replicase, resulting in a specific spatial orientation of the RNA by which the inherently weak, but essential, interaction at the 3′ end is allowed to occur and to lead to the initiation of RNA synthesis.     

Escherichia coli ribosomes bind to non-initiator sites of Q beta RNA in the absence of formylmethionyl-tRNA.

Escherichia coli ribosomes and Qβ [³²P]RNA were incubated with or without fMet-tRNA under protein initiation conditions, treated with RNase A, and centrifuged through a sucrose density gradient. The sample incubated with fMet-tRNA gave a main radioactivity peak in the 70 S region, which consisted predominantly of coat cistron initiator fragments. After incubation without fMet-tRNA, equal amounts of radioactivity were found in the 70 S and the 30 S regions, but in both peaks almost all of the radioactivity was duo to three RNase A-resistant oligonucleotides, A-G-A-G-G-A-G-G-Up (P-2a), A-G-G-G-G-G-Up (P-15) and G-G-A-A-G-G-A-G-Cp (P-4). These three oligonucleotides are derived from three different RNA regions, none of which is close to a protein initiation site. All three fragments show striking complementarity to the 3′-terminal region of E. coli 16 S RNA. Ribosomes incubated with an RNase A digest of Qβ [³²P]RNA bound almost exclusively oligonucleotide P-2a; treatment with cloacin DF13 cleaved off a complex consisting of a 49-nucleotide long segment of 16 S rRNA and oligonucleotide P-2a. These experiments show that the interaction of 30 S ribosomes with the “Shine-Dalgarno” region preceding the initiator codon of the Qβ coat cistron is insufficient to direct correct placement of the ribosome on the viral RNA, and that an additional contribution from the interaction of fMet-tRNA with the initiator triplet is required for ribosome binding to the initiator region.     

Nucleotide sequence of nuclear 5S RNA of mouse cells

The nucleotide sequence of nuclear 5S RNA of mouse cells was determined. The 5S RNA is 117 nucleotides long with one mole each of m₃^2,2,7G, Gm, Am and Cm, two moles of Um, and three moles of ψ as modified nucleosides, and it is rich in uridylate residues (about 36 %). The 5′-terminal hexanucleotide-containing cap structure, m₃^2,2,7GpppAm-Um-A-C-U-, is identical with that of U1 RNA. This RNA contains sequences complementary to the terminal sequences of the introns of heterogeneous nuclear RNAs.     

Replication of RNA viruses: specific binding of the Q RNA polymerase to Q RNA

The specific binding in vitro of the Qβ RNA polymerase to Qβ RNA has been detected by the formation of an enzyme-Qβ RNA complex that did not exchange bound RNA molecules and was not dissociated by 0.8 m NaCl. Formation of this nondissociating complex required GTP and two host protein factors, but not ATP, CTP, UTP, or Mg²⁺ ions. GDP, GMP, dGTP, ITP, and β,γ-methylene GTP did not replace GTP in the reaction. Complex formation at 0 °C was not observed, and the rates of the reaction at 30 °C and 25 °C were 41% and 23%, respectively, of the rate at 37 °C. The reaction occurred with intact Qβ RNA and with polycytidylic acid template but not with bacterial or other bacteriophage RNA. With limiting amounts of enzyme, the amount of Qβ RNA bound in the nondissociating complex was the same as the amount of [γ-³²P]GTP incorporated into nascent RNA chains, indicating a close relationship between complex formation and the initiation of RNA synthesis. The two reactions appear to be separate, however, because in the absence of Mg²⁺ ions, when complex formation occurred readily, no RNA synthesis could be detected either by incorporation of labeled substrate into acid-insoluble material or by formation of short RNA chains still attached to the enzyme. In the presence of factor protein and GTP, a maximum of one active enzyme molecule was bound per molecule of Qβ RNA template, as determined by a liquid polymer phase-separation procedure. These results suggest that formation of the nondissociating complex measures recognition by the Qβ RNA polymerase of a single Qβ RNA site utilized for the initiation of synthesis.     

Yeast viral double-stranded RNAs have heterogeneous 3′ termini

The yeast virus, ScV, is communicated only by mating. It has two separately encapsidated dsRNAs. One of these, L, codes for the major capsid polypeptide. The other, M, codes for a polypeptide toxic to yeasts without ScV-M particles. Defective interfering particles containing fragments of M (S) displace ScV-M when they arise. We have shown that five independently isolated S dsRNAs are all derived by internal deletion of M. The 3′ ends of all the ScV dsRNAs are markedly heterogeneous. For instance, half of the first 35 nucleotides at one 3′ end of M and S are variable. Conserved sequences at the 3′ ends of M and S are AAACACCCAUCA_OH and AUUUCUUUAUUUUUCA_OH. Conserved sequences at the 3′ ends of L are UAAAAAUUUUUCA_OH and AAAAAUXCA_OH, where X is variable. We propose that the sequence AUUUUUCA_OH is a recognition sequence for the capsid-associated single-stranded RNA polymerase activity. Since all the viral RNAs have pppGp 5′ termini, their 3′ termini probably extend one nucleotide beyond the terminal pppGp.     

In vitro synthesis of a possible precursor RNA by purified vesicular stomatitis virus.

The RNA products synthesized $\text{in vitro}$ by the virion-associated RNA polymerase of purified vesicular stomatitis virus have previously been shown to contain two distinct 5′-terminal sequences. The mRNA species contain the blocked 5′-terminal G(5′)ppp(5′)A-A-C-A-G sequence and the initiated lead-in RNA segment (approximately 50 bases) contains the unblocked 5′ ppA-C-G sequence. In the present studies, using inosine 5′-triphosphate in place of GTP it is shown that RNA species as large as 14.5S contain an unblocked 5′-ppA-C-(I) sequence indicating that the GTP analogue permits synthesis of a possible precursor of viral mRNA $\text{in vitro}$.     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

Replication of RNA viruses: structure of a 6 s RNA synthesized by the Q RNA polymerase

The in vitro synthesis of RNA catalyzed by the Qβ RNA polymerase has been studied using a single-stranded 6 s RNA template. Whereas Qβ RNA replication results in the synthesis predominantly of single-stranded Qβ RNA, the predominant reaction product of 6 s RNA replication was found to be double stranded. When treated with formaldehyde to dissociate complementary base pairs, 6 s RNA exhibited a decrease in molecular weight as indicated by its slower sedimentation rate and faster electrophoretic mobility. 6 s RNA also exhibited a hyperchromic thermal transition indicative of double-stranded RNA and differing markedly from that of single-stranded RNA. The T_m of this transition increased linearly with the logarithm of ionic strength. Renaturation of 6 s RNA below the T_m occurred slowly and was also dependent upon ionic strength.     

Base composition of terminal polynucleotides isolated from mouse ascite nucleolar RNA.

Two species of high molecular weight RNA were isolated from the nucleoli of mouse ascite tumor cells. The 3′-terminal nucleotide fragments of these high molecular weight RNA species were obtained after digestion of the RNA with RNase T₁, oxidation of the terminus with sodium periodate and isolation on aminoethyl cellulose. The terminal fragments behaved differently upon chromatography on DEAE-cellulose. These fragments contained different base compositions as follows: fragment A — Ap 24.7%, Cp 50.3%, and Up 25.0%; fragment B — Ap 40.7%, Cp 16.8%, and Up 43.5%. The terminal polynucleotide sequences of the 41S and 45S RNAs are -Gp(Ap, Up, 2Cp)X_OH and -Gp(2Ap, 2Up, Cp)X_OH respectively where X is unknown at the present. These data are discussed in regard to the various models proposed for the organization of nucleotide sequences of rRNA within the nucleolar precursors.     

Nucleotide sequence of the 3′ terminus of E. coli 16S ribosomal RNA

The 3′-terminal T1 oligonucleotide of E. coli 16S ribosomal RNA has been sequenced, using U2 and silkworm nucleases, and was found to be A-U-C-A-C-C-U-C-C-U-U-A_OH. This result is discussed in view of previously reported conflicting sequences and with respect to suggested functional roles for this region of 16S RNA.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

The nucleotide sequence of nuclear 4.8S RNA of mouse cells

The nucleotide sequence of nuclear 4.8S RNA has been determined. The 4.8S RNA consists of 108 nucleotide residues with one mole each of m²G, m⁶A and Gm, 3 moles each of ψ and Am and 4 moles of Cm as modified nucleosides. This RNA has pppG as the 5′-terminal nucleotide and contains a sequence complementary to some of the splice junctions of mRNA precursors.     

Extreme ends of the genome are conserved and rearranged in the defective interfering RNAs of semliki forest virus

We have analyzed Semliki Forest virus defective interfering RNA molecules, generated by serial undiluted passaging of the virus in baby hamster kidney cells. The 42 S RNA genome (about 13 kb ²) has been greatly deleted to generate the DI RNAs, which are heterogeneous both in size (about 2 kb) and sequence content. The DI RNAs offer a system for exploring binding sites for RNA polymerase and encapsidation signals, which must have been conserved in them since they are replicated and packaged. In order to study the structural organization of DI RNAs, and to analyze which regions from the genome have been conserved, we have determined the nucleotide sequences of (1) a 2.3 kb long DI RNA molecule, DI309, (2) 3′-terminal sequences (each about 0.3 kb) of two other DI RNAs, and (3) the nucleotide sequence of 0.4 kb at the extreme 5′ end of the 42 S RNA genome.The DI309 molecule consists of a duplicated region with flanking unique terminal sequences. A 273-nucleotide sequence is present in four copies per molecule. The extreme 5′-terminal nucleotide sequence of the 42 S RNA genome is shown to contain domains that are conserved in the two DI RNAs of known structure: DI309, and the previously sequenced DI301 (Lehtovaara et al., 1981). Here we report which terminal genome sequences are conserved in the DI RNAs, and how they have been modified, rearranged or amplified.