Generation of 10,154 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra yezoensis.

A total of 10,154 5'-end expressed sequence tags (EST) were established from the normalized and size-selected cDNA libraries of a marine red alga, Porphyra yezoensis. Among the ESTs, 2140 were unique species, and the remaining 8014 were grouped into 1127 species. Database search of the 3267 non-redundant ESTs by BLAST algorithm showed that the sequences of 1080 species (33.1%) have similarity to those of registered genes from various organisms including higher plants, mammals, yeasts, and cyanobacteria, while 2187 (66.9%) are novel. Codon usage analysis in the coding regions of 101 non-redundant EST groups showing significant similarity to known genes indicated the higher GC contents at the third position of codons (79.4%) than the first (62.2%) and the second position (45.0%), suggesting that the genome has been exposed to high GC pressure during evolution. The sequence data of individual ESTs are available at the web site http://www.kazusa.or.jp/en/plant/porphyra/EST/.     

Nitrite-reducing activity of modified cytochrome c-553 from the red alga Porphyra yezoensis Ueda

Crystalline cytochrome c-553 was obtained from Porphyra yezoensisUeda. The cytochrome in areduced form was modified to show anitrite-reducing activity after appropriate treatment with heat,hydrogen peroxide, or photooxidation using methylene blue asthe electron acceptor, but the reducing activity was far lowerthan that of the nitrite reductase isolated from this alga.The modified cytochrome c-553 was autooxidizable and showedan absorption spectrum resembling that of cytochrome c-553 inthe oxidized form except for slight shifts of the absorptionmaximumin the -band region toward shorter wavelengths. ¹ Present address: Department of Biological Sciences, Universityof Tsukuba, Sakura-Mura, Ibaraki, 300-31 Japan. ² Present address: Department of Fisheries, College of Agricultureand Veterinary Medicine, Nihon University, Shimouma, Setagaya-ku,Tokyo, 154 Japan. (Received June 10, 1975; )     

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).     

Isolation and characterization of the 337 m{micro} UV-absorbing substance in red alga, Porphyra yezoensis UEDA

Using a variety of Sephadex gel filtrations, starch block zoneelectrophoresis, Avicel SF preparative TLC and DEAE cellulosecolumn chromatography, the characteristic 337 mµ UV-absorbingsubstance from marine red alga, Porphyra yezoensis UEDA wasisolated. The molecular weight of this substance was about 1,000,and its chemical composition was 43.11% C, 5.85% H, 7.23% N,34.73% O and 9.08% Na. In vivo it is located in the chloroplast.On irradiation at 378 mµ, it has a fluorescence actionspectrum peak at 470 mµ. Structural studies on this substanceare still underway, but it could be a kind of aminosugar judgingfrom NMR, IR spectra and other chemical properties. ¹This work was partially supported by the grant of the Ministryof Education in 1969 ²Present address: Department of Biochemistry and Biophysics,University of Hawaii, Honolulu, Hawaii 96822, U.S.A. (Received December 21, 1969; )     

Structural features of a gene encoding the vacuolar H+-ATPase c subunit from a marine red alga, Porphyra yezoensis.

We report the nucleotide sequence of a gene encoding the c ('16 kDa') subunit of the vacuolar-type H+-ATPase (V-ATPase) from a marine red alga, Porphyra yezoensis. A cDNA clone was isolated from a leafy gametophyte cDNA library and analyzed for the sequence. The genomic DNA sequence was directly determined by nested PCR. The structural gene contained four introns within a coding sequence of 483 base pairs which encodes a polypeptide of 161-amino acids with four hydrophobic transmembrane-spanning regions. Comparison of the deduced amino acid sequences showed higher similarity to the land plant Oryza sativa (69.1%) than to the Ulvophyceae Acetabularia acetabulum (64.1%). The mRNA was detected both in the leafy gametophytes and filamentous sporophytes.     

Fermentation properties of low-quality red alga Susabinori Porphyra yezoensis by intestinal bacteria

Susabinori (Porphyra yezoensis), a red alga, is cultured and processed into a sheet-style dried food, nori, in Japan. But significant amounts of cultured susabinori, which has a low protein content is discarded because of its low quality. The protein content of nori has been reported to be correlated inversely with the carbohydrate content. In this study, we examined the relationship between the protein content and the fermentation of nori by means of bfidobacteria. nori with a low protein content (25% on dry base) was strongly fermented by bifidobacteria, whereas nori with a high protein content (41% on dry base) was not. nori with a low protein content contained large amounts of glycerol galactoside (GG, floridoside: 2-O-glycerol-alpha-D-galactoside, isofloridoside: 1-O-glycerol-alpha-D-galactoside), more than 10% w/w in the dried condition, and GG was the main substrate for fermentation by bifidobacteria. GG was not digested by digestive enzymes, and was not absorbed in the small intestine. These results suggest that GG can be used as a substrate for fermentation by bifidobacteria, and possibility of GG as a prebiotic.     

Effects of cell wall synthesis on cell polarity in the red alga Porphyra yezoensis

Polarity is a fundamental cell property essential for differentiation, proliferation and morphogenesis in unicellular and multicellular organisms. We have recently demonstrated that phosphatidylinositol 3-kinase (PI3K) activity is required for the establishment of anterior-posterior axis, leading to asymmetrical localization of F-actin in migrating monospores of the red alga Porphyra yezoensis. We also showed that the formation of the apical-basal axis via adhesion of monospores to the substratum after the cessation of migration requires newly synthesized proteins and does not depend on PI3K activity. However, little is known about the mechanism and regulation of axis conversion during development of monospores. In this addendum, we report our investigation as to the role of the cell wall in axis conversion. Our results indicate that inhibition of cell wall synthesis prevented the development of germlings. Also, defects in the cell wall disrupted the asymmetrical distribution of F-actin and inhibited the adhesion to the substratum that is required for establishment of apical-basal axis. Hence, we conclude that the cell wall is critical for the maintenance of cell polarity in migrating cells, which is indirectly involved in axis conversion via enabling monospores to adhere to the substratum.Key words: BFA, cell polarity, cell wall, F-actin, monospores, PI3K, Porphyra yezoensisThe initial establishment of cell polarity, which is exhibited in asymmetrical cell division and directional migration, depends on asymmetrical cues that lead to reorganization of the cytoskeleton and polarized distribution of cortical proteins and membrane lipids.^1–3 For directional migration of Dictyostelium cells and leukocytes, cells in the axialized form can rapidly change their body shape along with the formation of cell polarity in response to external impulses such as cAMP and cytokines, enabling them to migrate toward the external impulse with driving and contractile forces provided by asymmetrically distributed cytoskeletal elements.^4,5 Evidence is growing that in both asymmetrical cell division and migration, intracellular compartmentalization of phosphatidylinositol 3-kinase (PI3K) and phosphatidylinositol polyphosphate phosphatases is responsible for the asymmetrical and reciprocal distributions of PI(3,4,5)P₃ and PI(4,5)P₂ on plasma membranes. This helps cells to define their polarity by organizing polarized localization of F-actin and myosin.^6–8We used the monospores of the red alga Porphyra yezoensis to elucidate the molecular mechanisms involved in the establishment of cell polarity in plants. Migration and asymmetrical cell division are both observed during the early development of monospores released from monosporangia produced at the marginal region of the thallus.^9,10 Thus, monospores are thought to be unique and useful materials for investigating polarity determination in plant cells. In the early development of monospores, there are two different cellular axes: the anterior-posterior axis during migration and the apical-basal axis in asymmetrical cell division and upward growth of a thallus. The use of {"type":"entrez-nucleotide","attrs":{"text":"LY294002","term_id":"1257998346","term_text":"LY294002"}}LY294002, a PI3K inhibitor, prevented the migration of monospores because the anterior-posterior axis cannot be established. This is evidence that the PI3K activity is essential for the establishment of cell polarity and asymmetric distribution of F-actin for migration of monospores.¹⁰ Thus, the formation of the former axis requires PI3K activity and asymmetrical distribution of F-actin.¹⁰ These results are similar to those observed in Dictyostelium cells and leukocytes, suggesting that the role of PI3K-dependent F-actin asymmetry in the establishment of cell polarity might be evolutionarily conserved in migrating eukaryotic cells. However, it is still unclear whether PI(3,4,5)P₃ corresponds to D3-phosphorylated phosphatidylinositol in P. yezoensis, since this phosphoinositide has not yet been detected in any plant cell.^11,12In addition to D3-phosphorylated phosphatidylinositols, it is well known that the cell wall plays an essential role in the establishment of cell polarity, a phenomenon documented in the brown algae Fucus.^13–15 It has been demonstrated that the cell wall is required for the fixation, but not the formation, of the apical-basal axis.^13,14 In this case, polarized secretion via Golgi apparatus is needed for synthesis of the cell wall.¹⁵ In fact, we observed that monospores whose migration was inhibited by treatment with PI3K and cytoskeleton inhibitors have no cell wall,¹⁰ suggesting the importance of the cell wall in formation and/or maintenance of the cell axis in P. yezoensis.To confirm this possibility, we used Brefeldin A (BFA), a specific inhibitor of polysaccharide biosynthesis required for cell wall formation via Golgi-derived vesicle trafficking. As shown in Figure 1A, part a, the cell wall was synthesized during migration of monospores. However, when freshly released monospores were treated with BFA for 3 h, there was no cell wall synthesis in monospores with a rounded shape or in migrating monospores with a tapered shape (Fig. 1A, part b). This evidence led us to conclude that Golgi-derived vesicle trafficking is responsible for cell wall formation in these monospores. These results also indicated that the anterior-posterior axis during migration can be established without cell wall synthesis. Indeed, F-actin accumulated at the leading edge in the migrating monospores in the presence of BFA (Fig. 1A, part d).Open in a separate windowFigure 1Effect of BFA on the cell wall synthesis, F-actin localization and development of monospores. (A) Freshly released monospores were treated with (parts b–d) or without (part a) BFA (MP Biomedicals) at 20 µM for 3 h incubation. The cell wall (parts a and b) and F-actin (parts c and d) were stained with 0.01% Fluorescent Brightener 28 (Sigma) and 5 U· mL⁻¹ Alex Flour 488 phalloidin (Molecular probe), respectively. Migrating monospores are indicated by arrowheads. (Part c) Cell with a round shape, (Part d) cell with a tapered shape during migration. Upper and lower photographs in each panel show bright field and fluorescent images, respectively. Direction of migrating monospores is indicated by an arrow. Scale bars: (Parts a and b) 10 µm; (Parts c and d) 5 µm. (B) Freshly released monospores were treated with (parts b–d) or without (part a) BFA at 20 µM for 24 h incubation. The cell wall (parts a and b) and F-actin (parts c and d) were stained with 0.01% Fluorescent Brightener 28 and 5 U· mL⁻¹ Alex Flour 488 phalloidin, respectively. Migrating monospores are indicated by arrowheads. (Part c) Cell with a round shape, (Part d) cell with a tapered shape during migration. Upper and lower photographs in each panel show bright field and fluorescent images, respectively. Direction of migrating monospores is indicated by an arrow. Scale bars: (Parts a and b) 10 µm; (Parts c and d) 5 µm. (C) Dose-dependent effect of BFA on early development of monospores. Freshly released monospores were treated with an increasing concentration (2–20 µM) of BFA for 24 h, and the number of germlings was counted. Data are presented as mean ± SD (n = 3).Next, we analyzed the relationship between cell wall synthesis and development of germlings to confirm the functional significance of cell wall synthesis in the establishment of apical-basal axis. In the control medium, the cell wall was observed in 2-celled germlings 24 h after monospores release (Fig. 1B, part a), while the BFA-treated monospores still retained the migrating form in which the cell wall was not synthesized (Fig. 1B, part b) and the adhesion of monospores to the substratum and development of germlings was prevented (Fig. 1B, parts b–d). Moreover, the rate of the development of germlings from monospores decreased in a dose-dependent manner after 24 h incubation with BFA (Fig. 1C). Notably, it is significant that the polarized localization of F-actin in migrating cells was destroyed during BFA treatment (Fig. 1B, part d), suggesting the involvement of the cell wall in the maintenance of the asymmetrical distribution of F-actin in migrating monospores. Thus, the cell wall is indispensable for maintenance of anterior-posterior axis in migrating cells. Moreover, since adhering is trigger of the formation of the apical-basal axis, synthesis of cell wall could enable cells to develop further into germlings. We therefore concluded that cell wall plays a role indirectly in axis conversion during the development of monospores. Future work should be focused on the nature of the cell wall factors involved in the maintenance of cell axis and the adhesion to the substratum and how the function and expression of these factors are regulated.In summary, the establishment and maintenance of cell polarity during development of monospores is under complex regulation. Dissecting the molecular mechanisms of this regulatory system could help in further understanding the interrelation among PI3K signaling, the actin-based system and cell wall formation, which can provide new insight into the machinery regulating the establishment and maintenance of cell polarity in plants.     

Sodium exclusion and potassium retention by the red marine alga,Porphyra perforata

Cells of the red marine alga, Porphyra perforata, accumulate potassium and exclude sodium, chloride, and calcium. Various metabolic inhibitors including dinitrophenol, anoxia, and p-chloromercuribenzoate partially abolish the cells' ability to retain potassium and exclude sodium. Iodoacetate induces potassium loss only in the dark; reduced sulfur compounds offer protection against the effects of p-chloromercuribenzoate; dinitrophenol stimulates respiration at concentrations which cause potassium loss and sodium gain. Following exposure to anoxia potassium accumulation and sodium extrusion take place against concentration gradients. These movements are retarded by sodium cyanide, but are stimulated by light. Sodium entry, following long exposure to 0.6 M sucrose, occurs rapidly with the concentration gradient, while potassium entry against the concentration gradient takes place slowly, and is prevented by cyanide.     

Fatty acid oxidizing activity in a red marine alga, Porphyra sp

A crude enzyme solution prepared from fronds of Porphyra sp. showed remarkable oxygen uptake activity when linoleic acid was added as a substrate. Fatty acid oxidizing activity was mainly present in the soluble fraction of the crude homogenate. The activity was purified 769-fold from mature fronds by ammonium sulfate fractionation, ion-exchange and hydrophobic chromatography. SDS-PAGE analysis of the purified proteins indicated that its subunit size was about 13 kDa. Gel filtration chromatography equipped with a photodiode array detector revealed that the activity was associated with a protein having a molecular weight of 12,500-13,000. It eluted with a chromophore having the maximum absorbance at 417 nm, thus, the protein was suggested to be a heme protein. The spectrophotometric property of the protein was highly similar to that of cytochrome c suggesting that it has heme c as a prosthetic group. The protein showed highest oxygenation activity against linoleic acid, and alpha-linolenic acid and arachidonic acid followed, but oleic acid could not be oxidized. From linoleic acid the protein formed 9- and 13-hydroperoxides to the same extent, and both were shown to be racemic. These results showed that the oxidizing activity is accountable to a cytochrome, but not to a typical lipoxygenase.     

Protoplast isolation and regeneration in the marine red alga Porphyra nereocystis

We have developed a method for isolating viable protoplasts from the blade phase of the epiphytic marine red alga Porphyra nereocystis Anderson, using a two-step enzymatic digestion with commercially available enzymes. The first step uses papain, the second step uses abalone acetone powder. The method is rapid and gives a high yield of viable protoplasts. In liquid culture in enriched seawater medium, the protoplasts can undergo regeneration along three pathways: they directly form filaments resembling the conchocelis phase of Porphyra; they form calli with relatively thick-walled, pigmented cells; and they indirectly form blades from the edges of these calli. Porphyra nereocystis protoplasts also may serve as an alternative propagation method in aquaculture and be useful for studies of cell-wall formation, cell division, and thallus differentiation. They may also be used in somatic selection, somatic hybridization and gene-transfection experiments.Abbreviations AAP abalone acetone powder - PAP papain - FDA fluorescein diacetate This paper is dedicated to the memory of the late Dr. Munenao Kurogi (1921–1988), Professor Emeritus of Hokkaido UniversityThis research was supported by the Washington Sea Grant Program (National Oceanic and Atmospheric Administration). We thank Professor Y. Fujita (Nagasaki University, Japan), Professor S.-J. Wang (Shanghai University of Fisheries, P.R. China) and Dr. H. Kito (Seikai Regional Fisheries Research Laboratory, Nagasaki, Japan) for sharing their experience with Porphyra protoplast production with us. We thank J.S. Charleston for expert technical assistance in preparation of the electron-microscopy specimens. We also thank Dr. S.K. Herbert and John Carrier (Friday Harbor Laboratories) and Dr. John Merrill and D. Gillingham (American Sea Vegetable Co. and Applied Algal Research, Seattle) for collections of P. nereocystis.     

Ferredoxin from a red alga, Porphyra umbilicalis.

A plant-algal type ferredoxin was isolated from the red alga, Porphyra umbilicalis. In its oxidised form the ferredoxin had absorption maxima at 277, (281), 323, 420 and 462 nm. Two atoms each of non-haem iron and labile sulphur were present per molecule protein. The midpoint potential of the protein was -400 mV and it effectively mediated electron transport in the NADP-photoreduction system of barley. The amino acid composition of Porphyra umbilicalis ferredoxin was determined as (Lys4, His2, Arg1, Asx10, Thr8, Ser7, Glx16-17, Pro3, Gly7, Ala8, Cys5, Val6, Met1, Ile5, Leu8, Tyr5, Phe2). The minimum molecular weight of approximately 11000 was confirmed by sedimentation-equilibrium studies in the analytical ultracentrifuge. Approaching half of the total amino acid sequence was determined by means of an automatic sequencer.     

Potassium-dependent sodium extrusion by cells of Porphyra perforata,a red marine alga

Potassium-free artificial sea water causes a loss of cell potassium and a gain of cell sodium in Porphyra perforata, which is not attributable to an inhibition of respiration. On adding KCl or RbCl to such low potassium, high sodium tissues, net accumulation of potassium or rubidium takes place, accompanied by net extrusion of sodium. Rates of potassium or rubidium accumulation and sodium extrusion are proportional to the amount of KCl or RbCl added only at low concentrations. Saturation of rates is evident at KCl or RbCl concentrations above 20-30 mM, suggesting the role of an ion carrier mechanism of transport. Evidence for and against mutually dependent sodium extrusion and potassium or rubidium accumulation is discussed.     

Isolation of a bacterium that causes anaaki disease of the red algae Porphyra yezoensis

Anaaki disease causes severe damage to the red algae Porphyra yezoensis from which the Japanese traditional food 'nori'is produced. The causative agent of anaaki disease was isolated by several repeats of single-colony isolation and infection experiments, and was identified as Flavobacterium sp. LAD-1. The bacterium showed hydrolytic activity toward porphyran but not toward other polysaccharides composing the thallus of Porphyra , such as β-1,3-xylan or β-1,4-mannan. The bacterium also showed β-D-galactosidase activity.     

Cell suspension culture from Porphyra linearis (Rhodophyta) a multicellular marine red alga

A cell-suspension culture suitable for continuous propagation was established from protoplasts of the red alga Porphyra linearis Grev., an edible, winter annual species of nori. Protoplast-derived cells that did not regenerate into thalli were used to establish a culture line of uniform-sized (average about 25 μm diam.) cells, which resembled the vegetative cells of this species in the leafy thallus phase. Cell division occurred about once per 24 to 30 h in uncrowded (1–2 cells per culture well) culture. This cell-suspension culture has now been maintained as continuously growing subcultures for more than four years without formation of organized thalli; however, the latter can be obtained at will by altering culture conditions (lowering temperature from 20° to 10 °C, lengthening photoperiod from 10: % MathType!MTEF!2!1!+-% feaafiart1ev1aaatCvAUfeBSjuyZL2yd9gzLbvyNv2CaerbuLwBLn% hiov2DGi1BTfMBaeXatLxBI9gBaerbd9wDYLwzYbItLDharqqtubsr% 4rNCHbGeaGqiVu0Je9sqqrpepC0xbbL8F4rqqrFfpeea0xe9Lq-Jc9% vqaqpepm0xbba9pwe9Q8fs0-yqaqpepae9pg0FirpepeKkFr0xfr-x% fr-xb9adbaqaaeGaciGaaiaabeqaamaabaabaaGcbaWaa0aaaeaaca% aIXaGaaGinaaaaaaa!3777!\[\overline {14} \] or 8 : % MathType!MTEF!2!1!+-% feaafiart1ev1aaatCvAUfeBSjuyZL2yd9gzLbvyNv2CaerbuLwBLn% hiov2DGi1BTfMBaeXatLxBI9gBaerbd9wDYLwzYbItLDharqqtubsr% 4rNCHbGeaGqiVu0Je9sqqrpepC0xbbL8F4rqqrFfpeea0xe9Lq-Jc9% vqaqpepm0xbba9pwe9Q8fs0-yqaqpepae9pg0FirpepeKkFr0xfr-x% fr-xb9adbaqaaeGaciGaaiaabeqaamaabaabaaGcbaWaa0aaaeaaca% aIXaGaaGOnaaaaaaa!3779!\[\overline {16} \] to 14: % MathType!MTEF!2!1!+-% feaafiart1ev1aaatCvAUfeBSjuyZL2yd9gzLbvyNv2CaerbuLwBLn% hiov2DGi1BTfMBaeXatLxBI9gBaerbd9wDYLwzYbItLDharqqtubsr% 4rNCHbGeaGqiVu0Je9sqqrpepC0xbbL8F4rqqrFfpeea0xe9Lq-Jc9% vqaqpepm0xbba9pwe9Q8fs0-yqaqpepae9pg0FirpepeKkFr0xfr-x% fr-xb9adbaqaaeGaciGaaiaabeqaamaabaabaaGcbaWaa0aaaeaaca% aIXaGaaGimaaaaaaa!3773!\[\overline {10} \] or 16: % MathType!MTEF!2!1!+-% feaafiart1ev1aaatCvAUfeBSjuyZL2yd9gzLbvyNv2CaerbuLwBLn% hiov2DGi1BTfMBaeXatLxBI9gBaerbd9wDYLwzYbItLDharqqtubsr% 4rNCHbGeaGqiVu0Je9sqqrpepC0xbbL8F4rqqrFfpeea0xe9Lq-Jc9% vqaqpepm0xbba9pwe9Q8fs0-yqaqpepae9pg0FirpepeKkFr0xfr-x% fr-xb9adbaqaaeGaciGaaiaabeqaamaabaabaaGcbaWaa0aaaeaaca% aI4aaaaaaa!36C0!\[\overline 8 \] and increasing irradiance from 10 to ≥ 30 μmol m^-2 s^-1). This appears to be the first continuous non-clonal cell-suspension culture developed for a multicellular alga. NRCC No. 30272.     

Isolation of Porphyran-Degrading Marine Microorganisms from the Surface of Red Alga,Porphyra yezoensis

Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from the 11 POR-degradable microorganism groups.