Functional analysis of the Agrobacterium tumefaciens octopine Ti-plasmid left and right T-region border fragments

Summary Border fragments of the octopine Ti-plasmid were tested for their ability to restore tumorigenicity of an avirulent mutant carrying a deleted right border. It was found that neither introduction of left border fragments nor that of small right border fragments at the position of the deletion resulted in a complete restoration of oncogenicity. However, insertion of a larger right border fragment in the deletion mutant gave fully oncogenic strains. In the latter case sequences to the right side of the right border repeat were found to be responsible for a complete restoration of oncogenicity. Also a left border repeat inserted together with this enhancer sequence fully restored the oncogenicity of the deletion mutant. The enhancer-sequence on itself was not able to mediate the transfer of the T-region to the plant cell. Border fragments inserted in inverted orientation in the deletion mutant were able to mediate the transfer of the T-region to the plant cell, but at a reduced frequency.     

Agrobacterium tumefaciens transfers extremely long T-DNAs by a unidirectional mechanism.

During crown gall tumorigenesis, part of the Agrobacterium tumefaciens tumor-inducing (Ti) plasmid, the T-DNA, integrates into plant DNA. Direct repeats define the left and right ends of the T-DNA, but tumorigenesis requires only the right-hand repeat. Virulence (vir) genes act in trans to mobilize the T-DNA into plant cells. Transfer of T-DNA begins when the VirD endonuclease cleaves within the right-hand border repeat. Although the T-DNA right-border repeat promotes T-DNA transmission best in its normal orientation, an inverted right border exhibits reduced but significant activity. Two models may account for this diminished tumorigenesis. The right border may function bidirectionally, with strong activity only in its wild-type orientation, or it may promote T-DNA transfer in a unidirectional manner such that, with an inverted right border, transfer proceeds around the entire Ti plasmid before reaching the T-DNA. To determine whether a substantial portion of the Ti plasmid is transferred to plant cells, as predicted by the unidirectional-transfer hypothesis, we examined T-DNAs in tumors induced by strains containing a Ti plasmid with a right border inverted with respect to the T-DNA oncogenes. These tumors contained extremely long T-DNAs corresponding to most or all of the Ti plasmid. To test whether the right border can function bidirectionally, we inserted T-DNAs with either a properly oriented or an inverted right border into a specific site in the A. tumefaciens chromosome. A border situated to transfer the oncogenes first directed T-DNA transfer even from the bacterial chromosome, whereas a border in the opposite (inverted) orientation did not transfer the oncogenes to plant cells. Our results indicate that the right-border repeat functions in a unidirectional manner.     

Overdrive is a T-region transfer enhancer which stimulates T-strand production in Agrobacterium tumefaciens.

Introduction of a left or right synthetic border repeat together with the overdrive sequence in an octopine Ti-plasmid deletion mutant, lacking the right border, resulted in the complete restoration of the oncogenicity of the mutant strain. However introduction of a border repeat without the overdrive, only restored oncogenicity partially. The overdrive sequence turned out to be able to stimulate the synthetic border mediated T-region transfer, independent of its orientation and position relative to the border repeat. Furthermore the distance between border repeat and overdrive could be enlarged, without a loss of overdrive activity. Here we enlarged the distance between the two sequences up to 6714bp. These results were confirmed by estimating the amount of single stranded T-DNA molecules from induced agrobacteria, containing the various border constructs.     

Function of heterologous and pseudo border repeats in T region transfer via the octopine virulence system of Agrobacterium tumefaciens

The successful transfer of the Ti plasmid T region to the plant cell is mediated by its 24 bp border repeats. Processing of the T-region prior to transfer to the plant cell is started at the right border repeat and is stimulated by a transfer enhancer sequence called overdrive. Left and right border repeats differ somewhat in nucleotide sequence; moreover, the repeats of different Ti and Ri plasmids are slightly different. Our data indicate that these differences do not have a significant influence on border activity. However, the overdrive sequence is essential for the efficient transfer of a T region via an octopine transfer system. Our data suggest that an overdrive sequence must also be present next to the right border repeats of the nopaline Ti plasmid and the agropine of octopine and nopaline Ti plasmids express some differences in T-DNA processing activities. of cotopine and nopaline Ti plasmids express some differences in T-DNA processing activities.Furthermore, we demonstrate that certain pseudo border repeats, sequences that resemble the native 24 bp border repeat and naturally occur within the octopine Ti plasmid T-region, are able to mediate T region transfer to the plant cell, albeit with much reduced efficiency as compared to wild-type border repeats.     

Deviating T-DNA transfer fromAgrobacterium tumefaciens to plants

We analyzed 29 T-DNA inserts in transgenicArabidopsis thaliana plants for the junction of the right border sequences and the flanking plant DNA. DNA sequencing showed that in most lines the right border sequences transferred had been preserved during integration, corroborating literature data. Surprisingly, in four independent transgenic lines a complete right border repeat was present followed by binary vector sequences. Cloning of two of these T-DNA inserts by plasmid rescue showed that in these lines the transferred DNA consisted of the complete binary vector sequences in addition to the T-region. On the basis of the structure of the transferred DNA we propose that in these lines T-DNA transfer started at the left-border repeat, continued through the vector part, passed the right border repeat, and ended only after reaching again this left-border repeat.     

Frequent collinear long transfer of DNA inclusive of the whole binary vector during Agrobacterium-mediated transformation

When Agrobacterium was used to transform Nicotiana plumbaginifolia protoplasts and Arabidopsis thaliana roots and seedlings, a large number of plants were found in which not only the T-region defined by the border repeat sequences but the entire binary vector was integrated, as determined by both PCR and Southern analysis techniques. N. plumbaginifolia protoplast co-cultivation experiments yielded 3 out of 5 transformants with collinear sequence past the left border. In Arabidopsis root transformation experiments, 33% (6/18) of the transformants had T-DNA which exceeded the left border repeat. Vacuum infiltration of Arabidopsis seedlings produced even a greater percentage of transformants with sequences outside the left border repeat (62%, 39/63). The long transfer DNA cosegregated with the T-region encoded hygromycin resistance in the T2 progeny eliminating the possibility that long transfer DNA was of extrachromosomal or Agrobacterium origin. The high frequency of long transfer after vacuum infiltration of A. thaliana needs to be considered when analyzing T-DNA tagged mutants.     

Overdrive, a T-DNA transmission enhancer on the A. tumefaciens tumour-inducing plasmid

During crown gall tumorigenesis a specific segment of the Agrobacterium tumefaciens tumour-inducing (Ti) plasmid, the T-DNA, integrates into plant nuclear DNA. Similar 23-bp direct repeats at each end of the T region signal T-DNA borders, and T-DNA transmission (transfer and integration) requires the right-hand direct repeat. A chemically synthesized right border repeat in its wild-type orientation promotes T-DNA transmission at a low frequency; Ti plasmid sequences which normally flank the right repeat greatly stimulate the process. To identify flanking sequences required for full right border activity, we tested the activity of a border repeat surrounded by different amounts of normal flanking sequences. Efficient T-DNA transmission required a conserved sequence (5' TAAPuTPy-CTGTPuT-TGTTTGTTTG 3') which lies to the right of the two known right border repeats. In either orientation, a synthetic oligonucleotide containing this conserved sequence greatly stimulated the activity of a right border repeat, and a deletion removing 15 bp from the right end of this sequence destroyed it stimulatory effect. Thus, wild-type T-DNA transmission required both the 23-bp right border repeat and a conserved flanking sequence which we call overdrive.     

DNA from the A6S/2 crown gall tumor contains scrambled Ti-plasmid sequences near its junctions with plant DNA

The A6S/2 tumor incited on tobacco by Agrobacterium tumefaciens harboring the octopine-type A6 Ti plasmid contains one insert of Ti-plasmid sequences (the T DNA). This 13 kb insert is derived from a colinear sequence in the Ti plasmid (the T region) and becomes attached to plant DNA in the nucleus of the host cell. We have determined the DNA sequence encompassing the left end of the T region of the A6 Ti plasmid and the corresponding portion of the A6S/2 T DNA. The two sequences are identical for at least 806 bp. To the left of the divergence point, the tumor contains five partially overlapping sequences that are direct or inverted repeats of sequences to the right of the divergence point. The Ti plasmid contains only the right member of each of these repeats. We have also performed heteroduplex studies that indicate that this T DNA has a 520 bp inverted repeat of an internal sequence at the right end near its junction with plant DNA. The repeated sequences near the ends of the T DNA resemble the repeats of adenovirus type 12 sequences found near its junction with host DNA. We discuss data suggesting that the 23 bp to the immediate right of the divergence point of the A6 left junction form a site important in some step in the transfer of T-region DNA from the bacteria to the plant.     

Microhomologies between T-DNA ends and target sites often occur in inverted orientation and may be responsible for the high frequency of T-DNA-associated inversions

Sequence analysis of left and right border integration sites of independent, single-copy T-DNA inserts in Arabidopsis thaliana revealed three previously unrecognized concomitants of T-DNA integration. First, genomic pre-insertion sites shared sequence similarity not only with the T-DNA left and right border regions, as was previously reported, but also at high frequency with the inverted complement of the T-DNA right border region. Second, palindromic sequences were frequently found to overlap or lie adjacent to genomic target sites, suggesting a high recombinogenic potential for palindromic elements during T-DNA integration and a possible role during the primary contact between the T-DNA and the target DNA. Third, “filler” DNA sequences between genomic pre-insertion site DNA and T-DNA often derive from sequences in the T-DNA left and right border regions that are clustered around palindromic sequences in these T-DNA regions, suggesting that these palindromic elements are “hot spots” for filler DNA formation. The discovery of inverted sequence similarities at the right border suggests a previously unrecognized mode of T-DNA integration that involves heteroduplex formation at both T-DNA borders and with opposite strands of the target DNA. Scanning for sequence similarities in both direct and inverted orientation may increase the probability and/or effectiveness of anchoring the T-DNA to the target DNA. Variations on this scheme may also account for inversion events at the target site of T-DNA integration and inverted T-DNA repeat formation, common sequence organization patterns associated with T-DNA integration. Electronic Supplementary Material Supplementary material is available in the online version of this article at and is accessible for authorized users.     

A second T-region of the soybean-supervirulent chrysopine-type Ti plasmid pTiChry5, and construction of a fully disarmed vir helper plasmid

Agrobacterium tumefaciens Chry5, which is particularly virulent on soybeans, induces tumors that produce a family of Amadori-type opines that includes deoxyfructosyl glutamine (Dfg) and its lactone, chrysopine (Chy). Cosmid clones mapping to the right of the known oncogenic T-region of pTiChry5 conferred Amadori opine production on tumors induced by the nopaline strain C58. Sequence analysis of DNA held in common among these cosmids identified two 25-bp, direct repeats flanking an 8.5-kb segment of pTiChry5. These probable border sequences are closely related to those of other known T-regions and define a second T-region of pTiChry5, called T-right (TR), that confers production of the Amadoriopines. The oncogenic T-left region (TL) was located precisely by identifying and sequencing the likely border repeats defining this segment. The two T-regions are separated by approximately 15 kb of plasmid DNA. Based on these results, we predicted that pKYRT1, a vir helper plasmid derived from pTiChry5, still contains all of TR and the leftmost 9 kb of TL. Consistent with this hypothesis, transgenic Arabidopsis thaliana plants selected for with a marker encoded by a binary plasmid following transformation with KYRT1 co-inherited production of the Amadori opines at high frequency. All opine-positive transgenic plants also contained TR-DNA, while those plants that lacked TR-DNA failed to produce the opines. Moreover, A. thaliana infected with KYRT1 in which an nptII gene driven by the 35S promoter of Cauliflower mosaic virus was inserted directly into the vir helper plasmid yielded kanamycin-resistant transformants at a low but detectable frequency. These results demonstrate that pKYRT1 is not disarmed, and can transfer Ti plasmid DNA to plants. A new vir helper plasmid was constructed from pTiChry5 by two rounds of sacB-mediated selection for deletion events. This plasmid, called pKPSF2, lacks both of the known T-regions and their borders. pKPSF2 failed to transfer Ti plasmid DNA to plants, but mobilized the T-region of a binary plasmid at an efficiency indistinguishable from those of pKYRT1 and the nopaline-type vir helper plasmid pMP90.     

Right-border sequences enable the left border of an Agrobacterium tumefaciens nopaline Ti-plasmid to produce single-stranded DNA

The T-region of nopaline-type Ti-plasmids (the portion of the plasmid that is transferred to plant cells) of Agrobacterium tumefaciens is delimited by 23–25 bp direct repeats. They are nicked by the products of the virD locus and the presence of these nicked sites is correlated with the synthesis of single-stranded T-region copies. Despite previous indications to the contrary, we show that the pTiT37 T-region left border is capable of producing single-stranded DNA with high efficiency and that its ability to do so is totally dependent on right border-proximal cis-acting sequences, most probably overdrive, located several kilobases from the border. The absence of overdrive does not affect the single-strand nicking activity of the virD product but only the production of single-stranded copies from the nicked substrate.     

Mutational analysis of the conserved domains of a T-region border repeat of Agrobacterium tumefaciens

Left-and right-border repeats, which surround the T-region, contain two conserved regions separated by 5 bp that are not conserved. At the onset of T-DNA processing virD-encoded proteins introduce a nick in the largest of these conserved regions (12 bp) at a specific position in the bottom strand between a guanine and thymine nucleotide [2, 33]. In this paper we describe the effect of several site-directed mutations in the right-border repeat on tumorigenicity of Agrobacterium in plants. Our data show that mutations introduced directly around the nick site do not seriously affect the tumorigenicity of Agrobacterium, whereas mutations in the right part of this 12 bp conserved region do so. Furthermore, it appeared that the second conserved region (5 bp) is also essential for border activity and that the distance between the two conserved regions is important to obtain optimal border activity.     

Binary Agrobacterium vectors for plant transformation.

A vector molecule for the efficient transformation of higher plants has been constructed with several features that make it efficient to use. It utilizes the trans acting functions of the vir region of a co-resident Ti plasmid in Agrobacterium tumefaciens to transfer sequences bordered by left and right T-DNA border sequences into the nuclear genome of plants. The T-region contains a dominant selectable marker gene that confers high levels of resistance to kanamycin, and a lac alpha-complementing region from M13mp19 that contains several unique restriction sites for the positive selection of inserted DNA.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Role of DNA topology in Mu transposition: mechanism of sensing the relative orientation of two DNA segments

DNA strand transfer at the initiation of Mu transposition normally requires a negatively supercoiled transposon donor molecule, containing both ends of Mu in inverted repeat orientation. We propose that the specific relative orientation of the Mu ends is needed only to energetically favor a particular configuration that the ends must adopt in a synaptic complex. The model was tested by constructing special donor DNA substrates that, because of their catenation or knotting, energetically favor this same configuration of the Mu ends, even though they are on separate molecules or in direct repeat orientation. These structures are efficient substrates for the strand transfer reaction, whereas appropriate control structures are not. The result eliminates tracking or protein scaffold models for orientation preference. Several other systems in which the relative orientation of two DNA segments is sensed may utilize the same mechanism.     

Structure and expression of DNA transferred to tobacco via transformation of protoplasts with Ti-plasmid DNA: co-transfer of T-DNA and non T-DNA sequences

Summary The T-DNA structure and organization in tissues obtained via transformation of tobacco protoplasts with Ti-plasmid DNA was found to be completely different from the T-DNA introduced via Agrobacterium tumefaciens. It is often fragmented. Overlapping copies of T-DNA, having various sizes, as well as separated fragments of T-DNA were detected. The border sequences of 23 basepairs (bp), flanking the T-region in the Ti-plasmid as direct repeats are not used as preferred sequences for integration. Similar results were obtained with a T-region clone lacking one of the T_L-borders. This clone, which carried the cytokinin locus and only the right border sequence of T_L and the left border sequence of T_R, still had the capacity to transform protoplasts. Also the Vir-region of the Ti-plasmid is not required for integration of foreign DNA via DNA transformation. This is demonstrated by the results with the T-region clone mentioned and by the transforming capacity of a Ti-plasmid carrying a mutated Vir-region. Nevertheless, in a number of Ti-plasmid DNA transformants Vir-region fragments were found to be stably integrated. Furthermore, it has been established that co-transformation can occur with plant cells. Besides the detection of Ti-plasmid fragments from outside the T-region also DNA sequences originating from two DNA sources, which were both independently present in transformation experiments, have been found in some DNA transformants, e.g. calf thymus DNA, which was used as carrier DNA. No expression of the co-transferred DNA was observed. In total three phenotypical classes of DNA transformants were isolated. Although the T-DNA was often scrambled, polyA⁺ mRNA studies indicated that the different phenotypes studied can be explained by the presence of active T-DNA genes with known functions.     

T-DNA vector backbone sequences are frequently integrated into the genome of transgenic plants obtained by Agrobacterium-mediated transformation

Transgenic Arabidopsis and tobacco plants (125) derived from seven Agrobacterium-mediated transformation experiments were screened by polymerase chain reaction and DNA gel blot analysis for the presence of vector `backbone' sequences. The percentage of plants with vector DNA not belonging to the T-DNA varied between 20% and 50%. Neither the plant species, the explant type used for transformation, the replicon type nor the selection seem to have a major influence on the frequency of vector transfer. Only the border repeat sequence context could have an effect because T-DNA vector junctions were found in more than 50% of the plants of three different transformation series in which T-DNAs with octopine borders without inner border regions were used. Strikingly, many transgenic plants contain vector backbone sequences linked to the left T-DNA border as well as vector junctions with the right T-DNA border. DNA gel blots indicate that in most of these plants the complete vector sequence is integrated. We assume that integration into the plant genome of complete vector backbone sequences could be the result of a conjugative transfer initiated at the right border and subsequent continued copying at the left and right borders, called read-through. This model would imply that the left border is not frequently recognized as an initiation site for DNA transfer and that the right border is not efficiently recognized as a termination site for DNA transfer.     

T-DNA is organized predominantly in inverted repeat structures in plants transformed with Agrobacterium tumefaciens C58 derivatives

Summary The detailed structural organization of DNA sequences transferred to the plant genome via Agrobacterium tumefaciens has been determined in 11 transgenic tomato plants that carry the transferred DNA (T-DNA) at a single genetic locus. The majority (seven) of these plants were found to carry multiple copies of T-DNA arranged in inverted repeat structures. Such a high frequency of inverted repeats among transgenotes has not been previously reported and appears to be characteristic of transformation events caused by C58/pGV3850 strains of Agrobacterium. The inverted repeats were found to be centered on either the left or the right T-DNA boundary and both types were observed at similar frequency. In several plants both types of inverted repeat were found to coexist in the same linear array of elements. Direct repeats were observed in two plants, each time at the end of an array of inverted repeat elements, and at a lower frequency than inverted repeats. The junctions between T-DNA elements and plant DNA sequences and the junctions between adjacent T-DNA elements were mapped in the same 11 plants, allowing the determination of the distribution of junction points at each end for both types of junction. Based on a total of 17 distinct junctions at the right end of T-DNA and 19 at the left end, the distribution of junction points was found to be much more homogeneous at the right end than at the left end. Left end junctions were found to be distributed over a 3 kb region of T-DNA with two thirds of the junctions within 217 bp of the left repeat. Two thirds of the right end junctions were found to lie within 11 bp of the right repeat with the rest more than 39 bp from the right repeat. T-DNA::plant DNA junctions and T-DNA::T-DNA inverted repeat junctions showed similar distributions of junction points at both right and left ends. The possibilities that T-DNA inverted repeats are unstable in plants and refractory to cloning in wild type Escherichia coli is discussed. Two distinct types of mechanisms for inverted repeat formation are contrasted, replication and ligation mechanisms.     

Activation of Agrobacterium tumefaciens vir gene expression generates multiple single-stranded T-strand molecules from the pTiA6 T-region: requirement for 5'' virD gene products.

Agrobacterium tumefaciens transfers its Ti-plasmid T-DNA to plant cells. This process is initiated by plant-induced activation of the Ti-plasmid virulence loci, resulting in the generation of single stranded (ss) cleavages of the Ti-plasmid T-DNA border sequences (border nicks) and ss linear unipolar T-DNA molecules (T-strands). A single T-strand is produced from the two-border T-region of the pGV3850 nopaline plasmid. In this paper the induced molecular events for the complex T-region of the pTiA6 octopine plasmid are analyzed. This T-region carries four T-DNA borders delimiting three T-DNA elements (TR, TC and TL). Induction of pTiA6 generates cleavages independently at its border repeats, and six distinct T-strand species corresponding to TR, TR/TC, TR/TC/TL, TC, TC/TL and TL. These T-strand molecules are linear and correspond to the bottom strand of the pTiA6 T-region. Thus, borders can function for both initiation and termination of T-strand synthesis. We propose that the different pTiA6 T-strands are independently generated, and that the distribution of border nicks within the parental T-region determines which T-strand is produced. To identify genes involved in T-strand production, pTiA6 virulence (vir) and chromosomal virulence (chv) mutant strains were analyzed. VirA and VirG, the vir regulatory loci are required. Furthermore, the two 5' cistrons of virD are required for both border nicks and T-strands, suggesting that these genes encode the border endonuclease, and that T-strand production is dependent on border nicks. That no mutants are defective for T-strands alone suggests that functions encoded outside of vir and chv might mediate some of the later reactions of T-strand synthesis.