Nucleotide sequence of the rrnB 16S ribosomal RNA gene from Mycoplasma capricolum

Summary The nucleotide sequences of the rrnB 16S ribosomal RNA gene and its 5-and 3-flanking regions from Mycoplasma capricolum have been determined. The coding sequence is 1521 base pairs long, being 21 base pairs shorter than that of the Scherichia coli 16S rRNA gene. The 16S rRNA sequence of M. capricolum reveals 74% and 76% identity with that of E. coli and Anacystis nidulans, respectively. The secondary structure model constructed from the M. capricolum 16S rRNA.gene sequence resembles that proposed for E. coli 16S rRNA. A large stem structure can be constructed between the 5- and 3-flanking sequences of the 16S rRNA gene. The flanking regions are extremely rich in AT.     

Organization of ribosomal RNA genes in Mycoplasma capricolum

Summary DNA segments carrying rRNA genes of Mycoplasma capricolum have been cloned and characterized by restriction endonuclease mapping, DNA-RNA hybridization and nucleotide sequencing. The M. capricolum genome has two sets of rRNA gene clusters, where the arrangement is in the order of (5)16S-23S-5S(3). The spacer region between 16S and 23S rDNA is extremely rich in AT and does not carry any tRNA genes. Present address: Division of Hematology and Immunology of Internal Medicine, Kanazawa Medical University, Uchinada-Cho, Kahoku-Gun Ishikawa Pref. 920-02, Japan     

RNase P RNA ofMycoplasma capricolum

There are at least six small stable RNAs inMycoplasma capricolum cells besides tRNAs and rRNAs. One of them, MCS5 RNA, is a homolog of RNase P RNA. The predicted secondary structure of this RNA is essentially the same as that of other eubacterial RNase P RNAs. MCS5 RNA is more similar to the RNase P RNA ofB. subtilis than to that ofE. coli. This is consistent with previous conclusions that mycoplasmas are phylogenetically related to the low G+C Gram-positive bacterial group. The major substrates for MCS5 RNA must be the precursors of tRNAs. The precursor of MCS6 RNA, which is a homolog of theE. coli 10Sa RNA, may also be a substrate for the MCS5 RNA because this RNA has a tRNA-like structure at its 5 and 3 ends.     

Organization of the ribosomal RNA genes in Mycoplasma hyopneumoniae: the 5S rRNA gene is separated from the 16S and 23S rRNA genes

Summary In order to study the organization of the ribosomal RNA genes of Mycoplasma hyopneumoniae the rRNA genes were cloned in phage vectors EMBL3 and EMBL4. By subcloning the restriction fragments into various plasmids and analysing the resulting clones by Southern and Northern blot hybridization, a restriction map of the rRNA genes was generated and the organization of the rRNA genes was determined. The results show that the genes for the 16S and 23S rRNAs are closely spaced and occur only once in the genome, whereas the 5S rRNA gene is separated from the other two genes by more than 4 kb.     

Nucleotide sequence of cytoplasmic 5S ribosomal RNA fromEuglena gracilis

Summary The nucleotide sequence of cytoplasmic 5S ribosomal RNA fromEuglena gracilis has been determined to be: G- _A ^C -G-U-A-C-G-G-C-C-A-U-A-C-U-A-C-C-G-G-G-A-A-U-A-C-A-C-C-U-G-A-A-C-C-C-G--U-C-G-A-U-U-U-C-A-G-A-A-G-U-U-A-A-G-C-C-G-G-G-U-U-A-G-G-C-C-C-A-G-U-U-A-G-U-A-C-U-G-A-G-U-G-G-G-C-G-A-C-C-A-C-U-U-G-G-G-A-A-C-A-C-U-G-G-G-U-G-C-U-G-U-A-C-G-C-U-Up. This RNA is 119 nucleotides long and the sequence of a probable tRNA-binding site is GAUU (position 41–44 from the 5-terminus), which is the same as that of a trypanosoma species,Crithidia fasci-culata. TheEuglena 5S rRNA has a pseudouridine residue at position 38 and 3-terminus is phosphorylated. The 5S rRNA sequence ofEuglena resembles those of several other protozoa and higher animals rather than plants.On leave from Department of Zoology, Hiroshima University, Hiroshima, Japan     

DNA sequence,structure, and phylogenetic relationship of the small subunit rRNA coding region of mitochondrial DNA fromPodospora anserina

Summary DNA sequence analysis and the localization of the 5 and 3 termini by S1 mapping have shown that the mitochondrial (mt) small subunit rRNA coding region fromPodospora anserina is 1980 bp in length. The analogous coding region for mt rRNA is 1962 bp in maize, 1686 bp inSaccharomyces cerevisiae, and 956 bp in mammals, whereas its counterpart inEscherichia coli is 1542 bp. TheP. anserina mt 16S-like rRNA is 400 bases longer than that fromE. coli, but can be folded into a similar secondary structure. The additional bases appear to be clustered at specific locations, including extensions at the 5 and 3 termini. Comparison with secondary structure diagrams of 16S-like RNAs from several organisms allowed us to specify highly conserved and variable regions of this gene. Phylogenetic tree construction indicated that this gene is grouped with other mitochondrial genes, but most closely, as expected, with the fungal mitochondrial genes.     

Uncharged tRNA inhibits guanosine 3'',5''-bis (diphosphate) 3''-pyrophosphohydrolase [ppGppase], the spoT gene product, from Escherichia coli

Summary The spoT gene product from Escherichia coli, the guanosine 3,5-bis(diphosphate) 3-pyrophosphohydrolase [ppGppase] catalyzes the specific release of pyrophosphate from the 3-position of guanosine 3,5-bis(diphosphate) [ppGpp]; this reaction is significantly inhibited in the presence of uncharged tRNA _yeast ^Phe . Little or no inhibition is observed with Phe-tRNA^Phe, tRNA^Phe-CpCpA_oxi-red or ribosomal RNA (16S and 23S).     

Geometry of the dry-state oligomerization of 2′,3′-cyclic phosphates

Summary Evaporation of a solution of thymidine plus either theexo or theendo diastereomer of uridine cyclic 2,3-O, O-phosphorothioate (U > p(S) in 1,2-diaminoethane hydrochloride buffer gave the 2,5 and 3,5 isomers of (P-thio) uridylylthymidine (Up(S)dT) in a ratio of 1:2 with a combined yield of about 20%. These isomers were re-converted to U > p(S) and dT by a reaction that is known to proceed by an in-line mechanism. Both the 2,5 and 3,5 isomers gave as product the same diastereomer of U > p(S) that had been used originally in their formation. These dry-state prebiotic reactions (Verlander, Lohrmann, and Orgel 1973) are thus shown to be stereospecific, and both the 2,5 and 3,5 internucleotide bonds are formed by an in-line mechanism.Abbreviations DAE 1,2-diaminoethane - HPLC high pressure liquid chromatography - RNase bovine pancreatic ribonuclease A, EC 3.1.4.22 - TEAB triethylammonium bicarbonate - tris tris(hydroxymethyl)aminomethane - UMP(S) uridine monophosphorothioate - U > p uridine cyclic 2,3-phosphate - U > p(S) uridine cyclic 2,3-O, O-phosphorothioate - Up(S)dT (P-thio)uridylylthymidine - U2p(R_p-S)5dT (P-thio)uridylylthymidine with theR configuration at phosphorous, and a 2,5 internucleotide linkage     

Cloning and characterization of genes coding for ribosomal RNA inCampylobacter jejuni

The DNA fragments coding for ribosomal RNA inCampylobacter jejuni have been cloned from a genomic library ofC. jejuni constructed inEscherichia coli. Clones carrying DNA Sequences for rRNA were identified by hybridization of 5-end-labeled rRNA fromC. jejuni to colony blots of transformants from this gene library. Cloned DNA sequences homologous to each of 5S, 16S, and 23S rRNA were idenfified by hybridization of labeled plasmid DNA to Northern blots of rRNA. The gene coding for 23S rRNA was found to be located on a 5.5kb HindIII fragment, while the 5S and 16S rRNA genes were on HindIII fragments of 1.65 and 1.7 kb, respecitively. The DNA fragment containing the 16S rRNA gene was characterized by restriction endonuclease mapping, and the location of the 16S rRNA gene on this fragment was determined by hybridization of 5-end-labeled rRNA to restriction fragments and also by DNA sequence determination. It appears that the major portion of the coding region for 16S rRNA is located on the 1.7-kb HindIII fragment, while a small portion is carried on an adjacent HindIII fragment of 7.5 kb. Cloned rRNA genes fromC. jejuni were used to study the organization of the rDNA inC. jejuni and other members of the genùsCampylobacter.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Nuclease S1 analysis of eubacterial 5S rRNA secondary structure

Summary Single-strand-specific nuclease S₁ was employed as a structural probe to confirm locations of unpaired nucleotide bases in 5S rRNAs purified from prokaryotic species of rRNA superfamily I. Limited nuclease S₁ digests of 3- and 5-end-labeled [³²P]5S rRNAs were electrophoresed in parallel with reference endoribonuclease digests on thin allel with reference endoribonuclease digests on thin sequencing gels. Nuclease S₁ primary hydrolysis patterns were comparable for 5S rRNAs prepared from all 11 species examined in this study. The locations of base-paired regions determined by enzymatic analysis corroborate the general features of the proposed universal five-helix model for prokaryotic 5S rRNA, although the results of this study suggest a significant difference between prokaryotic and eukaryotic 5S rRNAs in the evolution of helix IV. Furthermore, the extent of base-pairing predicted by helix IV needs to be reevaluated for eubacterial species. Clipping patterns in helices II and IV appear to be consistent with a secondary structural model that undergoes a conformational rearrangement between two (or more) structures. Primary clipping patterns in the helix II region, obtained by S₁ analysis, may provide useful information concerning the tertiary structure of the 5S rRNA molecule.     

Adenosine-5′-phosphosulfate (APS) as sulfate donor for assimilatory sulfate reduction in Rhodospirillum rubrum

Crude extracts of Rhodospirillum rubrum catalyzed the formation of acid-volatile radioactivity from (³⁵S) sulfate, (³⁵S) adenosine-5-phosphosulfate, and (³⁵S) 3-phosphoadenosine-5-phosphosulfate. An enzyme fraction similar to APS-sulfotransferases from plant sources was purified 228-fold from Rhodospirillum rubrum. It is suggested here that this enzyme is specific for adenosine-5-phosphosulfate, because the purified enzyme fraction metabolized adenosine-5-phosphosulfate, however, only at a rate of 1/10 of that with adenosine-5-phosphosulfate. Further, the reaction with 3-phosphoadenosine-5-phosphosulfate was inhibited with 3-phosphoadenosine-5-phosphate whereas this nucleotide had no effect on the reaction with adenosine-5-phosphosulfate. For this activity with adenosine-5-phosphosulfate the name APS-sulfotransferase is suggested. This APS-sulfotransferase needs thiols for activity; good rates were obtained with either dithioerythritol or reduced glutathione; other thiols like cysteine, 2-3-dimercaptopropanol or mercaptoethanol are less effective. The electron donor methylviologen did not catalyze this reaction. The pH-optimum was about 9.0; the apparent K _m for adenosine-5-phosphosulfate was determined to be 0.05 mM with this so far purified enzyme fraction. Enzyme activity was increased with K₂SO₄ and Na₂SO₄ and was inhibited by 5-AMP. These properties are similar to assimilatory APS-sulfotransferases from spinach and Chlorella.Abbreviations APS adenosine-5-phosphosulfate - PAPS 3-phosphoadenosine-5-phosphosulfate - 5-AMP adenosine-5-monophosphate - 3-AMP adenosine-3-monophosphate - 3-5-ADP 3-phosphoadenosine-5-phosphate (PAP) - DTE dithiorythritol - GSH reduced glutathione - BAL 2-3-dimercaptopropanol     

Effect of light on the nucleotide composition of rRNA of wheat seedlings

Both qualitative and quantitative differences in the minor nucleotide constituents of rRNA from normally grown and from etiolated wheat plants (Triticum aestivum L.) were established. Using different degradation methods and separation techniques the 18S+26S RNA of 8-day-old wheat seedlings grown in the light was found to contain 5-methylcytidine, 3-methylcytidine, 5-methyluridine, 3-methyluridine, 5-carboxymethyluridine, 1-methyladenine, N-methyladenine, 5-hydroxymethylcytidine, O²-methyluridine, O²-methylcytidine, pseudouridine, O²-methylpseudouridine, N²,N²-dimethylguanine, 1-methylguanine, ribothymidine and some unknown minor constituents. On the other hand, there were only a few minor nucleotides in the rRNA of etiolated wheat seedlings. Cycloheximide, a cytoplasmic protein synthesis inhibitor, simulated etiolation in that it reduced the number of minor nucleotides in rRNA, whereas chloramphenicol, a chloroplast protein synthesis inhibitor, had no significant effect on the minor nucleotide content of rRNA. This finding suggests that illumination may cause de novo synthesis of cytoplasmic modifying enzymes leading to the formation of highly modified rRNAs.Abbreviations m⁶A N⁶-methyladenine - m¹A 1-methyladenine - 5hmc 5-hydroxymethylcytidine - Cm O²-methylcytidine - m⁵C 5-methylcytidine - m³C 3-methylcytidine - m¹G 1-methylguanine - m ₂ ² G N², N²-dimethylguanine - pseudouridine - m O²-methylpseudouridine - Um O²-methyluridine - m³U 3-methyluridine - m⁵U 5-methyluridine - cm⁵U 5-carboxymethyluridine - rT ribothymidine - Pur purine - Pyr pyrimidine - RNase ribonuclease - UV ultra violet - p phosphate     

Nuclear protein 780BP from cauliflower binds an element in the 780 gene promoter of T-DNA

A 16 bp site of protein binding has been identified in the promoter of the 780 gene of T-DNA. Specific DNA-protein interactions were demonstrated between a double-stranded oligonucleotide containing this element (5-TTGAAAAATCAACGCT-3) and a protein isolated from nuclear extracts of cauliflower inflorescences. Specific bases required for this binding activity (780 binding protein; 780BP) were defined by kinetic competition studies with mutated oligonucleotides, methylation interference assays and DNAse I footprinting. 780BP binding was not competed with up to 1000-fold excess of previously characterized plant regulatory elements such as as-1, the LRE, and the ocs, G-box, and AT-rich elements. In addition, 780BP was shown to bind sequences overlapping a mammalian hormone receptor element with greater affinity than the 780 element.     

The catalysis of nucleotide polymerization by compounds of divalent lead

Summary Soluble lead salts and a number of lead-containing minerals catalyze the formation of oligonucleotides from nucleoside 5-phosphorimidazolides. The effectiveness of lead compounds correlates strongly with their solubility. Under optimal conditions we were able to obtain 18% of pentamer and higher oligomers from ImpA. Reactions involving ImpU gave smaller yields.Abbreviations A adenosine - U uridine - Im imidazole - MeIm 1-methyl-imidazole - EDTA ethylenediaminetetraacetic acid - pA adenosine 5-phosphate - pU uridine 5-phosphate - Ap adenosine cyclic 2:3-phosphate - ATP adenosine 5-triphosphate - AppA P₁,P₂-diadenosine 5-diphosphate - pNp (N = A,U) nucleotide 2(3), 5-diphosphate - ImpA adenosine 5-phosphoreimidazolide - ImpU uridine 5-phosphorimidazolide - A ²pA adenylyl-[25]-adenosine - A ³pA adenylyl-[35]-adenosine - pA ²pA 5-phospho-adenylyl-[25]-adenosine - pA ³pA 5-phospho-adenylyl-[35]-adenosine - pUpU 5-phospho-uridylyl-uridine - pApU 5-phospho-adenylyl-uridine - pUpA 5-phospho-uridylyladenine - (pA)n (n, 2,3,4,) oligoadenylates with 5 terminal phosphate - ImpApA 5-phosphorimidazolide of adenylyl adenosine - (pA) ₅₊ pentamer and higher oligoadenylates with 5 terminal phosphate - (Ap)nA (n = 2,3,4) oligoadenylates without terminal phosphates In the following we do not specify the nature of the internucleotide linkageIn the following we do not specify the nature of the internucleotide linkage     

Sequence studies on the soybean chloroplast 16S–23S rDNA spacer region

The sequence of the ribosomal spacer region of soybean chloroplast DNA including the 3 end of the 16S rRNA gene, the tRNA^Ala and tRNA^Ile genes (but not their introns), the three intergenic regions and the 5 end of the 23S rRNA gene, has been determined. This sequence has been compared to corresponding regions of other angiosperm chloroplast DNAs. Secondary structure models are proposed for the entirety of the intergenic regions a, b and c and for the flanking rRNA regions. A model for a common secondary structure of the ribosomal spacer intergenic regions from chloroplasts of higher plants is proposed, which is supported by comparative evidence.     

Pre-moult foraging trips and moult locations of Emperor penguins at the Mawson Coast

The movements of nine breeding adult emperor penguins Aptenodytes forsteri from two colonies, Auster (67° 23S 64° 04E) and Taylor Glacier (67° 28S 60° 54E), were determined by satellite telemetry on their pre-moult foraging trips. While preparing for their annual moult the penguins travelled for 22–38 days and reached distances of up to 618 km from the colony. Six of the nine tracked penguins were followed to three different moult locations all to the west of their breeding colonies and near other known emperor penguins colonies, such as Kloa Point (66°38S, 59°23E) and Fold Island (67°17S, 59°23E). Sea-ice conditions changed throughout the tracking period; as the birds travelled north the sea-ice contracted south.     

Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon

The nucleotide sequences of the rRNA genes and the 5 flanking region were determined for R. salmoninarum ATCC 33209^T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5 leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S–23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S–5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries.     

Catalysis of the peptide bond formation by 50 S subunits of E. Coli ribosomes with N-(formyl) methionine ester of adenylic acid as peptide donor

50 S subunits of E. coli ribosomes catalyze the reaction of the 2(3)-N-(formyl) methionine ester of adenosine 5-phosphate and Phe-tRNA resulting in peptide bond synthesis. Cytidine 5-phosphate stimulates this process on 50 S ribosomal subunits as well as on intact ribosomes. The obtained data show that the areas of the peptidyltransferase donor site which binds the 3-terminal fragment of peptidyl-tRNA possess completely formed structures on 50 S ribosomal subunits.     

5S and 5.8S ribosomal RNA evolution in the suborder tetrahymenina (Ciliophora: Hymenostomatida)

Summary The nucleotide sequences of the 5S and 5.8S rRNAs of eight strains of tetrahymenine ciliates have been determined. The sequences indicate a clear distinction betweenTetrahymena paravorax and its suggested conspecificT. vorax, but leave the taxonomic distinction betweenT. vorax andT. leucophrys in doubt. The rRNA sequences of sixTetrahymena species and of three other species of the suborder Tetrahymenina have been used to deduce evolutionary schemes in which ancestral rRNA sequences and changes are proposed. These schemes suggest the predominant acceptance of GA and CT transitions in the 5S rDNA during the evolution of the suborder.