The Self-Education of the Medical Student and Physician

A euploid/aberrant double stem line mosaicism was found in two cases of the de Lange syndrome with severe abnormalities. In both cases the structural heterozygosity of the aberrant stem line involved, apparently, the loss of chromosomal material from a smaller autosome of Group (6-12) X, probably No. 11. Differences in the cultural characteristics of de Lange cells suggest that the aberrant stem line may not proliferate in culture, so that mosaicism may not be detected. Moreover, the mosaicism may not be present in all tissues, resulting in normal cytogenetic findings as noted in a third case studied. Our findings suggest that the de Lange syndrome is the phenotypic expression of chromosomal mosaicism.     

Mosaic triple X syndrome in a female with primary amenorrhea

BACKGROUND:

Turner''s syndrome is the most common chromosomal abnormality in females, affecting 1 in 2,500 live female births. It is a result of absence of an X chromosome or the presence of a structurally abnormal X chromosome. Its most consistent clinical features are short stature and ovarian failure.

AIM:

The aim of the study was to report a rare case of mosaic triple X syndrome in a female with primary amenorrhea.

MATERIALS AND METHODS:

The chromosomal analysis using GTG banding was carried out, which revealed a mosaicism with 45,XO/47,XXX chromosomal constitution. Fluorescent in situ hybridization was also carried out to further confirm the observation made in the study.

CONCLUSION:

The physical features presented by the female could be due to the 45,XO/47,XXX mosaicism and the karyotype analysis was consistent with the diagnosis and clinical symptoms. Triple X mosaicism was confirmed with conventional and molecular cytogenetic analysis.     

Detection of confined placental mosaicism in trisomy 18 conceptions using interphase cytogenetic analysis

Fluorescence in situ hybridization provides a rapid and accurate technique for detecting chromosomal aneuploidy. It is an excellent method for identifying mosaicism in placental tissues following prenatal diagnosis. Mosaicism, in the form of confined placental mosaicism, occurs im approximately 1%–2% of viable pregnancies studied by chorionic villus sampling at 9–11 weeks of gestation. It has been detected in pregnancies with both diploid and trisomic fetuses and appears to have an important effect on the intrauterine fetal survival. Using both standard cytogenetic analysis and fluorescence in situ hybridization, we have studied 12 placentas from pregnancies with trisomy 18 for the presence of chromosomal mosaicism. These included 2 that were spontaneously aborted, 5 that were terminated after prenatal diagnosis, and 4 that were delivered as either stillborn or liveborn. Significant levels of mosaicism, confined exclusively to cytotrophoblast, were detected in 7 pregnancies. This study demonstrates the usefulness of interphase cytogenetic analysis of uncultured tissues as an alternative method for the detection of mosaicism.     

Cytogenetics and fluorescence in situ hybridization assessment of sex-chromosome mosaicism in Klinefelter's syndrome

A retrospective study was carried out in 152 infertile men to determine the prevalence of sex chromosome abnormalities among non-obstructive azoospermic and severe oligospermic men (n = 51) and to evaluate the feasibility of fluorescence in situ hybridization (FISH) techniques to assess mosaicism in Klinefelter's patients in comparison with conventional cytogenetics. Cytogenetic analysis were performed for 51 infertile men and among 14 chromosomal abnormalities found, nine were compatible with Klinefelter's syndrome. FISH staining with a CEP X/CEP Y probes were performed for Klinefelter's patients and for five of them; testes were biopsied for histopathologic examination. Six Klinefelter's patients showed a non-mosaic 47,XXY and three showed a 47,XXY/46,XY mosaic by G or R banding analysis of 20 cells with a ratio of 17%, 20% and 33%, respectively. FISH analysis confirmed mosaicism in only one patient (the first) in whom a third cells population was found. There was no relationship between the ratios of mosaicism by banding and FISH analysis. Conventional histopathologic findings in five non-mosaic Klinefelter's patients confirm the diagnosis of Sertoli Only Cells syndrome. FISH is recommended in Klinefelter's syndrome to define exactly the cytogenetic statute as mosaic or non-mosaic and then discussing prognosis and decision regarding fertility counseling.     

<Emphasis Type="Italic">X</Emphasis> Chromosome Inactivation in Cells from an Individual heterozygous for Two <Emphasis Type="Italic">X</Emphasis>-Linked Genes

THE Lyon hypothesis of X chromosome inactivation predicts that in mammalian females, somatic cells are mosaic with respect to whether the active X chromosome is of maternal or paternal origin and that this chromosomal mosaicism is heritable somatically¹. Studies of cell clones derived from females who were heterozygous for genes at one of several X-linked loci^2–6 have provided good evidence for such mosaicism. Proof that only one of the two X chromosomes, however, is active in any given cell rests on the demonstration that the cell or its clone expresses all of the X-linked genes from one parent and none from the other parent. For this purpose it is useful to examine cloned cells from female subjects for genetic markers representing allelic genes at two or more of the parental loci. This study was undertaken to determine whether genes at the X-linked loci for glucose-6-phosphate dehydrogenase (G6PD) and phosphoglycerate kinase (PGK) are consistently expressed in the eis position in cloned cells as would be expected from a single parental contribution.     

Males with chronic myeloid leukemia and the 45, XO,Ph1 chromosome pattern

Two cases of chronic myeloid leukemia in which the cytogenetic clone was 45, XO, Ph¹ are described and compared with 20 cases recorded in the literature. The 45, XO line is peculiar to the leukemic cells and is not a manifestation of constitutional mosaicism. It probably arises from a 46, XY, Ph¹ line by loss of the Y chromosome. Because of the few cases reported, one cannot be certain that these men have a better prognosis, although the median survival time suggests that this is so. Infertility is not part of this disorder.     

High resolution array-CGH analysis of single cells

Heterogeneity in the genome copy number of tissues is of particular importance in solid tumor biology. Furthermore, many clinical applications such as pre-implantation and non-invasive prenatal diagnosis would benefit from the ability to characterize individual single cells. As the amount of DNA from single cells is so small, several PCR protocols have been developed in an attempt to achieve unbiased amplification. Many of these approaches are suitable for subsequent cytogenetic analyses using conventional methodologies such as comparative genomic hybridization (CGH) to metaphase spreads. However, attempts to harness array-CGH for single-cell analysis to provide improved resolution have been disappointing. Here we describe a strategy that combines single-cell amplification using GenomePlex library technology (GenomePlex^® Single Cell Whole Genome Amplification Kit, Sigma-Aldrich, UK) and detailed analysis of genomic copy number changes by high-resolution array-CGH. We show that single copy changes as small as 8.3 Mb in single cells are detected reliably with single cells derived from various tumor cell lines as well as patients presenting with trisomy 21 and Prader–Willi syndrome. Our results demonstrate the potential of this technology for studies of tumor biology and for clinical diagnostics.     

Hypomelanosis of Ito: involvement of chromosome aberrations in this syndrome

The authors report on cytogenetic results of six patients with hypomelanosis of Ito. Karyotypes from peripheral lymphocytes prometaphases and skin fibroblasts metaphases were normal. A review of the literature revealed no specific chromosomal abnormality but a close association between mosaicism and HI syndrome. The X-chromosome was involved in 53% of the abnormal cases.     

Analysis of chromosomal equipment in spermatozoa of a 46,XY/47,XY/+8 male by means of multicolour fluorescent in situ hybridization: confirmation of a mosaicism and evaluation of risk for offspring

Trisomy 8 is generally associated with chromosomal mosaicism and occurs de novo, with relatively well-defined clinical manifestations, ranging from minimal effects to severe malformations. Mosaicism is often difficult to ascertain and the confirmation of diagnosis requires several chromosomal investigations on a variety of tissues. We present a case of mosaic trisomy 8 fortuitously found in a healthy 30-year-old man during a cytogenetic investigation for several spontaneous abortions: 8% of the lymphocyte metaphases showed a 47,XY,+8 karyotype. Fluorescent in situ hybridization (FISH) with the probes pJM.128 and L1.84 was performed on decondensed interphase spermatozoa. Of the 25 000 analysed cells, 398 spermatozoa (1.59%) exhibited a hybridization pattern compatible with a chromosome 8 disomy; the frequency was higher than in either sperm control populations (0.17% and 0.21%). This result is in agreement with the existence of trisomy 8 mosaicism in the gonads and germ cells. FISH on decondensed interphase spermatozoa spreads is thus an easy non-invasive procedure that can be used to complement mosaicism diagnosis in tissue other than blood. Moreover, FISH provides interesting data for characterizing the risk for offspring. Received: 11 July 1996 / Revised: 26 August 1996     

Clinical outcome and follow-up of the first reported case of Russell-Silver syndrome with the unique combination of maternal uniparental heterodisomy 7 and mosaic trisomy 7

BACKGROUND: Russell-Silver syndrome (RSS) has been associated with maternal uniparental disomy (UPD) for chromosome 7 although the etiology of the syndrome is still unknown. Cases of RSS associated with maternal UPD7 have involved isodisomies, heterodisomies, and mixed isodisomy with heterodisomy simultaneously. This publication is a follow-up report of the postnatal clinical outcome of the first prenatally suspected case of combined mosaic trisomy 7 with maternal uniparental disomy of chromosome 7 (UPD7). CASE: The diagnosis of RSS in the proband was suspected prenatally because trisomy 7 mosaicism (47,XX,+7[13]/46,XX[19]) and maternal uniparental heterodisomy 7 were both found in amniotic fluid cells. Cord blood karyotype analysis showed only disomic cells (46,XX[50]), whereas postpartum chorionic villus analysis was completely trisomic for chromosome 7 (47,XX,+7[19]). Postnatally, the diagnosis of RSS was confirmed by physical findings, her trisomy 7 mosaicism was confirmed by cytogenetic analysis of her skin biopsy (47,XX,+7[9]/46,XX[20]) and her UPD7 was confirmed on both peripheral blood and skin biopsy using microsatellite markers. During infancy, the proband experienced growth deficiency, persistent hypoglycemia, and psychomotor developmental delay. CONCLUSIONS: Trisomic rescue as a life-saving mechanism, with subsequent chromosomal mosaicism in combination with UPD may occur more frequently in RSS than has been reported. Systematic testing of cases suspected prenatally or postnatally would be informative regarding the individual contribution of each factor. Imprinting, loss of heterozygosity for recessive genes, and mosaicism may explain the short stature, asymmetry, and the variable expression of the phenotype. The contribution of these mechanisms to the syndrome should be evaluated in these cases.     

Macrocephaly-cutis marmorata telangiectatica congenita: report of a patient with a translocation

Cutis marmorata telangiectatica congenita (CMTC) is a rare cutaneous disorder. More than one half of the patients with CMTC have additional extra-cutaneous associated congenital anomalies. A subset of patients with CMTC have macrocephaly, the M-CMTC syndrome. This is a report on a patient with the M-CMTC syndrome and a de novo translocation t(2;17)(p11;p13). The etiology and pathology of the M-CMTC syndrome is unknown. Suggestions for the cause for M-CMTC include the occurrence of a new dominant mutation in a single gene, deletion of multiple contiguous genes at a level beyond the resolution of conventional karyotyping and chromosomal mosaicism. This patient did not have chromosomal mosaicism, however he had a translocation. It can be postulated that in the present patient the translocation breakpoints disrupted one or more genes entailing skin lesions but also other features: mental retardation, macrocephaly and facial dysmorphia.     

Molekularzytogenetische Methoden und Array-Diagnostik in der Pr?natalmedizin

In addition to the widely used cytogenetic standard approaches, molecular methods are being increasingly used in prenatal diagnostics. While molecular cytogenetics, e.g., fluorescence in situ hybridization (FISH), has been used for many years in invasive prenatal diagnostics, array-based diagnostics are only now being implemented in this field. FISH is prenatally applied for determination of size of a mosaic cell clone, for exclusion of a microdeletion, or for further clarification of structural chromosomal aberrations. Array CGH (comparative genomic hybridization) is used more conservatively in prenatal diagnostics, mostly for further clarification in sonographically abnormal fetuses and to diagnose breakpoints in cases with proven chromosomal changes. In the future, array CGH will gain further importance, but already provides a valuable supplement to the diagnostic approaches of the cytogenetic and the molecular-based methods.     

The arrangement of length heterogeneity in repeating units of amplified and chromosomal ribosomal DNA from Xenopus laevis

Non-transcribed spacer regions of Xenopus laevis ribosomal DNA have been found which vary in length between 1.8 × 10⁶ and 5.5 × 10⁶ daltons. Length variation of rDNA² repeats exists within a single nucleolar organizer. Amplified rDNA contains repeats of the same size classes but often in different abundance than the chromosomal rDNA of the same animal. If a certain repeat length is preferred during amplification in an individual, it is also preferred in siblings with the same chromosomal rDNA composition. Thus, preference for a size class in amplification is inherited. Some animals selectively amplify repeat lengths which are rarely found in their chromosomal rDNA; others amplify their most abundant size class.The intramolecular arrangement of length variability was analyzed by the electron microscopy of heteroduplex molecules. Long single strands from two separate preparations of amplified and chromosomal rDNA each were reannealed with an homogeneous cloned spacer-containing rDNA fragment (CD30), and the size of adjacent heteroduplex regions was determined. The arrangement of length heterogeneity is very different in the two types of rDNA. Most, if not all, tandem repeats along a single molecule of amplified rDNA are equal in length. This observation supports a rolling circle mechanism for amplification. In contrast, between 50% and 68% of adjacent repeats in a given molecule of chromosomal rDNA differ in length. For one of the chromosomal rDNA preparations analyzed, the frequency of non-identical nearest-neighbors is compatible with random scrambling of repeats of different lengths. This result bears on the mechanism by which tandem genes evolve. It rules out sudden correction mechanisms of tandem genes such as the “master-slave” or certain “expansion-contraction” models, which predict that tandem genes will be identical.     

Low level chromosome instability in embryonic cells of primary aneuploid mice

Karyotypic analyses of Down syndrome patients have identified a low level of chromosome mosaicism, suggesting that the primary aneuploid status of the cells promotes further chromosomal segregation errors. Sycp3-null female mice produce aneuploid oocytes, which after fusion with normal haploid sperm, result in offspring with systemic whole chromosome, aneuploid embryo cells. Using the Sycp3-null female as a model, we observe an increase in the number of embryonic cells at E7.0 that exhibit abnormal chromosomal bridges at the anaphas estage of mitosis. This result suggests that global changes in gene expression patterns resulting from primary aneuploidy can affect mitotic chromosome segregation, resulting in a low level of chromosomal instability. The increased level of chromosomal instability could in the absence of mitotic checkpoints, lead to chromosomal mosaicism within the adult organism, as seen in Down syndrome patients.     

Replication asynchrony between homologs 15q11.2: Cytogenetic evidence for genomic imprinting

Summary Replication kinetics of the Prader-Willi syndrome critical region (15q11.2) was investigated in seven normal healthy adult females using RBG replication bands. Replication asynchrony between homologs 15q11.2 was identified consistently in about 40% of cells in all individuals. It was limited to the stages in which Xp22, Xp11, Xq13 and Xq24/26 were visible in the late-replicating X chromosome. This asynchrony suggested that replication timing overlapped between 15q11.2 and the early replicating R-bands of the late X chromosome in some cells, and that the difference in replication timing between homologs was probably related to genomic imprinting; the latter has been suggested as a pathogenetic basis of Prader-Willi syndrome. As a result of an analysis of the proportions of asynchronous and synchronous cells in each replication stage, two types of cells were deduced providing 11 methylation mosaicism of genomic imprinting was assumed. The first type was composed of cells with normal replication in one homolog and delayed replication in the other. The second type was composed of cells with normal replication in both homologs. Our results provide cytogenetic evidence of methylation mosaicism for mammalian genomic imprinting.     

Mosaic down syndrome with a marker: molecular cytogenetic characterization of the marker chromosome

Down syndrome is a complex disorder characterized by well defined and distinctive phenotypic features. Approximately 2-3% of all live-born Down individuals are mosaics. Here we report a boy with suspected Down syndrome showing mosaicism for two different cell lines where one cell line is unexpected. The cytogenetic analysis by G-banding revealed a karyotype of 47 XY+21 [20]/46,X+marker [30]. Further, molecular cytogenetic analysis with spectral karyotyping identified the marker as a derivative of Y chromosome. The delineation of Y chromosomal DNA was done by quantitative real-time PCR and aneuploidy detection by quantitative fluorescence PCR. The Y-short tandem repeats typing was performed to estimate the variation in quantity as well as to find out the extent of deletion on Y chromosome using STR markers. Fluorescence in situ hybridization using Y centromeric probe was also performed to confirm the origin of the Y marker. Further fine mapping of the marker was carried out with three bacterial artificial chromosome clones RP11-20H21, RP11-375P13, RP11-71M14, which defined the hypothetical position of the deletion. In our study we defined the extent of deletion of the marker chromosome and also discussed it in relation with mosaicism. This is the first report of mosaic Down syndrome combined with a second de novo mosaic marker derived from the Y chromosome.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

The quantitative PCR technique resolves ambiguities concerning a small rearrangement of human chromosome 6q12-13

Karyotype analysis, performed on the basis of chromosome banding pattern, is a standard method used for identification of chromosomal aberrations, both numerical and structural. The application of classic cytogenetic techniques fails, however, to solve all diagnostic problems in certain types of chromosome aberrations. In this study, quantitative polymerase chain reaction technique (Q-PCR) application was applied to verify a cytogenetic diagnosis, which assumed that a difference observed in the banding pattern of homologous chromosome 6q12-13 region of a foetus had resulted from an inversion and/or duplication of the region in question. The obtained results indicate a possibility to use the Q-PCR method in the diagnostics of unbalanced chromosomal aberrations.     

Clinical genealogical and molecular genetic study of patients with mental retardation

The results of clinical, genealogical, cytogenetic and molecular genetic studies of 113 patients from 96 families with different forms of mental retardation from Ukraine are presented. This study was held as part of the CHERISH project of the 7-th Framework Program. The aim of the project is to improve diagnostics of mental retardation in children in Eastern Europe and Central Asia through detailed analysis of known chromosomal and gene's aberrations and to find the new gene-candidates that cause mental retardation. All patients have normal chromosome number (46XY or 46XX). The cases with fragile-X syndrome were eliminated using molecular genetic methods. Genome rearrangements were found among 28 patients using cytogenetic analysis, multiplex ligation-dependent probe amplification (MLPA analysis) ofsubtelomeric regions and array-based comparative genomic hybridisation (array CGH screening). In 10 cases known pathogenic CNV's were identified, 11 cases are unknown aberrations; their pathogenicity is being determined. The rest cases are known nonpathogenic gene rearrangements. Obtained results show the strong genetic heterogeneity of hereditary forms of mental retardation. The further studies will allow to identificate genes candidates and certain mutations in these genes that may be associated with this pathology.