Standardized,systemic phenotypic analysis of Slc12a1I299F mutant mice

Background

Type I Bartter syndrome is a recessive human nephropathy caused by loss-of-function mutations in the SLC12A1 gene coding for the Na⁺-K⁺-2Cl⁻ cotransporter NKCC2. We recently established the mutant mouse line Slc12a1^I299F exhibiting kidney defects highly similar to the late-onset manifestation of this hereditary human disease. Besides the kidney defects, low blood pressure and osteopenia were revealed in the homozygous mutant mice which were also described in humans. Beside its strong expression in the kidney, NKCC2 has been also shown to be expressed in other tissues in rodents i.e. the gastrointestinal tract, pancreatic beta cells, and specific compartments of the ear, nasal tissue and eye.

Results

To examine if, besides kidney defects, further organ systems and/or metabolic pathways are affected by the Slc12a1^I299F mutation as primary or secondary effects, we describe a standardized, systemic phenotypic analysis of the mutant mouse line Slc12a1^I299F in the German Mouse Clinic. Slc12a1^I299F homozygous mutant mice and Slc12a1^I299F heterozygous mutant littermates as controls were tested at the age of 4–6 months. Beside the already published changes in blood pressure and bone metabolism, a significantly lower body weight and fat content were found as new phenotypes for Slc12a1^I299F homozygous mutant mice. Small additional effects included a mild erythropenic anemia in homozygous mutant males as well as a slight hyperalgesia in homozygous mutant females. For other functions, such as immunology, lung function and neurology, no distinct alterations were observed.

Conclusions

In this systemic analysis no clear primary effects of the Slc12a1^I299F mutation appeared for the organs other than the kidneys where Slc12a1 expression has been described. On the other hand, long-term effects additional and/or secondary to the kidney lesions might also appear in humans harboring SLC12A1 mutations.     

No Amelioration of Uromodulin Maturation and Trafficking Defect by Sodium 4-Phenylbutyrate in Vivo: STUDIES IN MOUSE MODELS OF UROMODULIN-ASSOCIATED KIDNEY DISEASE*

Uromodulin (UMOD)-associated kidney disease (UAKD) belongs to the hereditary progressive ER storage diseases caused by maturation defects of mutant UMOD protein. Current treatments of UAKD patients are symptomatic and cannot prevent disease progression. Two in vitro studies reported a positive effect of the chemical chaperone sodium 4-phenylbutyrate (4-PBA) on mutant UMOD maturation. Thus, 4-PBA was suggested as a potential treatment for UAKD. This study evaluated the effects of 4-PBA in two mouse models of UAKD. In contrast to previous in vitro studies, treatment with 4-PBA did not increase HSP70 expression or improve maturation and trafficking of mutant UMOD in vivo. Kidney function of UAKD mice was actually deteriorated by 4-PBA treatment. In transfected tubular epithelial cells, 4-PBA did not improve maturation but increased the expression level of both mutant and wild-type UMOD protein. Activation of NF-κB pathway in thick ascending limb of Henle''s loop cells of UAKD mice was detected by increased abundance of RelB and phospho-IκB kinase α/β, an indirect activator of NF-κB. Furthermore, the abundance of NF-κB1 p105/p50, NF-κB2 p100/p52, and TRAF2 was increased in UAKD. NF-κB activation was identified as a novel disease mechanism of UAKD and might be a target for therapeutic intervention.     

Intersubunit Ionic Interactions Stabilize the Nucleoside Diphosphate Kinase of Mycobacterium tuberculosis

Most nucleoside diphosphate kinases (NDPKs) are hexamers. The C-terminal tail interacting with the neighboring subunits is crucial for hexamer stability. In the NDPK from Mycobacterium tuberculosis (Mt) this tail is missing. The quaternary structure of Mt-NDPK is essential for full enzymatic activity and for protein stability to thermal and chemical denaturation. We identified the intersubunit salt bridge Arg⁸⁰-Asp⁹³ as essential for hexamer stability, compensating for the decreased intersubunit contact area. Breaking the salt bridge by the mutation D93N dramatically decreased protein thermal stability. The mutation also decreased stability to denaturation by urea and guanidinium. The D93N mutant was still hexameric and retained full activity. When exposed to low concentrations of urea it dissociated into folded monomers followed by unfolding while dissociation and unfolding of the wild type simultaneously occur at higher urea concentrations. The dissociation step was not observed in guanidine hydrochloride, suggesting that low concentration of salt may stabilize the hexamer. Indeed, guanidinium and many other salts stabilized the hexamer with a half maximum effect of about 0.1 M, increasing protein thermostability. The crystal structure of the D93N mutant has been solved.     

The NADPH Metabolic Network Regulates Human αB-crystallin Cardiomyopathy and Reductive Stress in Drosophila melanogaster

Dominant mutations in the alpha-B crystallin (CryAB) gene are responsible for a number of inherited human disorders, including cardiomyopathy, skeletal muscle myopathy, and cataracts. The cellular mechanisms of disease pathology for these disorders are not well understood. Among recent advances is that the disease state can be linked to a disturbance in the oxidation/reduction environment of the cell. In a mouse model, cardiomyopathy caused by the dominant CryAB^R120G missense mutation was suppressed by mutation of the gene that encodes glucose 6-phosphate dehydrogenase (G6PD), one of the cell''s primary sources of reducing equivalents in the form of NADPH. Here, we report the development of a Drosophila model for cellular dysfunction caused by this CryAB mutation. With this model, we confirmed the link between G6PD and mutant CryAB pathology by finding that reduction of G6PD expression suppressed the phenotype while overexpression enhanced it. Moreover, we find that expression of mutant CryAB in the Drosophila heart impaired cardiac function and increased heart tube dimensions, similar to the effects produced in mice and humans, and that reduction of G6PD ameliorated these effects. Finally, to determine whether CryAB pathology responds generally to NADPH levels we tested mutants or RNAi-mediated knockdowns of phosphogluconate dehydrogenase (PGD), isocitrate dehydrogenase (IDH), and malic enzyme (MEN), the other major enzymatic sources of NADPH, and we found that all are capable of suppressing CryAB^R120G pathology, confirming the link between NADP/H metabolism and CryAB.     

The Legs at odd angles (Loa) Mutation in Cytoplasmic Dynein Ameliorates Mitochondrial Function in SOD1G93A Mouse Model for Motor Neuron Disease

Amyotrophic lateral sclerosis (ALS) is a debilitating and fatal late-onset neurodegenerative disease. Familial cases of ALS (FALS) constitute ∼10% of all ALS cases, and mutant superoxide dismutase 1 (SOD1) is found in 15–20% of FALS. SOD1 mutations confer a toxic gain of unknown function to the protein that specifically targets the motor neurons in the cortex and the spinal cord. We have previously shown that the autosomal dominant Legs at odd angles (Loa) mutation in cytoplasmic dynein heavy chain (Dync1h1) delays disease onset and extends the life span of transgenic mice harboring human mutant SOD1^G93A. In this study we provide evidence that despite the lack of direct interactions between mutant SOD1 and either mutant or wild-type cytoplasmic dynein, the Loa mutation confers significant reductions in the amount of mutant SOD1 protein in the mitochondrial matrix. Moreover, we show that the Loa mutation ameliorates defects in mitochondrial respiration and membrane potential observed in SOD1^G93A motor neuron mitochondria. These data suggest that the Loa mutation reduces the vulnerability of mitochondria to the toxic effects of mutant SOD1, leading to improved mitochondrial function in SOD1^G93A motor neurons.     

Identification of a Novel Mouse Brachyury (<Emphasis Type="Italic">T</Emphasis>) Allele Causing a Short Tail Mutation in Mice

Mutations in T-box genes are associated with numerous disease states in humans. The objective of this paper was to characterize the T ^shao , a specific T-box mutation, in mice. T ^shao , a short-tailed mutant mouse strain in a B6 background, was obtained by ethylnitrosourea mutagenesis. Microsatellite genomic scans mapped the location of the mutation. RT–PCR was used to amplify the identified region and the product was sequenced. DNA of the region was sequenced and scanned for mutations. Tails of T ^shao mice were mostly curly with tail length ranging from less than 1 cm (tail bud) to half of the normal length. T ^shao presented single dominance gene inheritance, and homozygous mutant mice died approximately at E10. Scans of the F2 generation mapped the mutant gene to chromosome 17, near D17Mit143. The Brachyury (T) gene was identified as a potential candidate gene in this location. To confirm this, RT–PCR was performed on RNA from intercrossed 8.5-day embryos, and products were sequenced. A 67-nucleotide deletion in exon 2 of the mutant T gene was identified. Further sequencing of the genomic DNA from this region identified a T to A transversion at the 67th nucleotide of exon 2. The T ^shao mutation is a result of a deletion in exon 2 causing the early termination and loss of function of protein encoded by the T gene, manifesting as a short tail phenotype.     

Detection of Mutant Uromodulin in Transgenic Mouse Harboring a Mutant Human UMOD Gene

Uromodulin is the most abundant protein secreted in urine, and the mutated form of the uromodulin gene is associated with uromodulin-associated kidney disease (UAKD). Although uromodulin accumulates in the kidney of UAKD patients, it is unclear whether this is the wildtype or mutant form. In this study, we established a liquid chromatography (LC)-mass spectrometry/mass spectrometry (MS/MS)-based method for the detection of uromodulin mutants, using the C148W mutant as a target molecule. Membrane and cytosolic fractions of kidney samples from transgenic (Tg) mice expressing the C148W uromodulin mutant were shown to contain human uromodulin by western blotting, and mutant uromodulin with the C148W mutant sequence was observed by proteomic and selected reaction monitoring analyses. Our LC-MS/MS-based method is therefore useful for detection of mutant uromodulin that is undetectable by western blotting alone.     

Detection of mutant uromodulin in transgenic mouse harboring a mutant human UMOD gene

Uromodulin is the most abundant protein secreted in urine, and the mutated form of the uromodulin gene is associated with uromodulin-associated kidney disease (UAKD). Although uromodulin accumulates in the kidney of UAKD patients, it is unclear whether this is the wildtype or mutant form. In this study, we established a liquid chromatography (LC)-mass spectrometry/mass spectrometry (MS/MS)-based method for the detection of uromodulin mutants, using the C148W mutant as a target molecule. Membrane and cytosolic fractions of kidney samples from transgenic (Tg) mice expressing the C148W uromodulin mutant were shown to contain human uromodulin by western blotting, and mutant uromodulin with the C148W mutant sequence was observed by proteomic and selected reaction monitoring analyses. Our LC-MS/MS-based method is therefore useful for detection of mutant uromodulin that is undetectable by western blotting alone.     

Metabolic alterations caused by the mutation and overexpression of the Tmem135 gene

Mitochondria are dynamic organelles that undergo fission and fusion. While they are essential for cellular metabolism, the effect of dysregulated mitochondrial dynamics on cellular metabolism is not fully understood. We previously found that transmembrane protein 135 (Tmem135) plays a role in the regulation of mitochondrial dynamics in mice. Mice homozygous for a Tmem135 mutation (Tmem135^{FUN025/FUN025}) display accelerated aging and age-related disease pathologies in the retina including the retinal pigment epithelium (RPE). We also generated a transgenic mouse line globally overexpressing the Tmem135 gene (Tmem135 TG). In several tissues and cells that we studied such as the retina, heart, and fibroblast cells, we observed that the Tmem135 mutation causes elongated mitochondria, while overexpression of Tmem135 results in fragmented mitochondria. To investigate how abnormal mitochondrial dynamics affect metabolic signatures of tissues and cells, we identified metabolic changes in primary RPE cell cultures as well as heart, cerebellum, and hippocampus isolated from Tmem135^{FUN025/FUN025} mice (fusion > fission) and Tmem135 TG mice (fusion < fission) using nuclear magnetic resonance spectroscopy. Metabolomics analysis revealed a tissue-dependent response to Tmem135 alterations, whereby significant metabolic changes were observed in the heart of both Tmem135 mutant and TG mice as compared to wild-type, while negligible effects were observed in the cerebellum and hippocampus. We also observed changes in Tmem135^{FUN025/FUN025} and Tmem135 TG RPE cells associated with osmosis and glucose and phospholipid metabolism. We observed depletion of NAD⁺ in both Tmem135^{FUN025/FUN025} and Tmem135 TG RPE cells, indicating that imbalance in mitochondrial dynamics to both directions lowers the cellular NAD⁺ level. Metabolic changes identified in this study might be associated with imbalanced mitochondrial dynamics in heart tissue and RPE cells which can likely lead to functional abnormalities.Impact statementMitochondria are dynamic organelles undergoing fission and fusion. Proper regulation of this process is important for healthy aging process, as aberrant mitochondrial dynamics are associated with several age-related diseases/pathologies. However, it is not well understood how imbalanced mitochondrial dynamics may lead to those diseases and pathologies. Here, we aimed to determine metabolic alterations in tissues and cells from mouse models with over-fused (fusion > fission) and over-fragmented (fusion < fission) mitochondria that display age-related disease pathologies. Our results indicated tissue-dependent sensitivity to these mitochondrial changes, and metabolic pathways likely affected by aberrant mitochondrial dynamics. This study provides new insights into how dysregulated mitochondrial dynamics could lead to functional abnormalities of tissues and cells.     

Mutant Glycyl-tRNA Synthetase (Gars) Ameliorates SOD1G93A Motor Neuron Degeneration Phenotype but Has Little Affect on Loa Dynein Heavy Chain Mutant Mice

Background

In humans, mutations in the enzyme glycyl-tRNA synthetase (GARS) cause motor and sensory axon loss in the peripheral nervous system, and clinical phenotypes ranging from Charcot-Marie-Tooth neuropathy to a severe infantile form of spinal muscular atrophy. GARS is ubiquitously expressed and may have functions in addition to its canonical role in protein synthesis through catalyzing the addition of glycine to cognate tRNAs.

Methodology/Principal Findings

We have recently described a new mouse model with a point mutation in the Gars gene resulting in a cysteine to arginine change at residue 201. Heterozygous Gars^C201R/+ mice have locomotor and sensory deficits. In an investigation of genetic mutations that lead to death of motor and sensory neurons, we have crossed the Gars^C201R/+ mice to two other mutants: the TgSOD1^G93A model of human amyotrophic lateral sclerosis and the Legs at odd angles mouse (Dync1h1^Loa) which has a defect in the heavy chain of the dynein complex. We found the Dync1h1^Loa/+;Gars^C201R/+ double heterozygous mice are more impaired than either parent, and this is may be an additive effect of both mutations. Surprisingly, the Gars^C201R mutation significantly delayed disease onset in the SOD1^G93A;Gars^C201R/+ double heterozygous mutant mice and increased lifespan by 29% on the genetic background investigated.

Conclusions/Significance

These findings raise intriguing possibilities for the study of pathogenetic mechanisms in all three mouse mutant strains.     

Lamin A/C Mutants Disturb Sumo1 Localization and Sumoylation in Vitro and in Vivo

A-type lamins A and C are nuclear intermediate filament proteins in which mutations have been implicated in multiple disease phenotypes commonly known as laminopathies. A few studies have implicated sumoylation in the regulation of A-type lamins. Sumoylation is a post-translational protein modification that regulates a wide range of cellular processes through the attachment of small ubiquitin-related modifier (sumo) to various substrates. Here we showed that laminopathy mutants result in the mislocalization of sumo1 both in vitro (C2C12 cells overexpressing mutant lamins A and C) and in vivo (primary myoblasts and myopathic muscle tissue from the Lmna^{H222P /H222P} mouse model). In C2C12 cells, we showed that the trapping of sumo1 in p.Asp192Gly, p.Gln353Lys, and p.Arg386Lys aggregates of lamin A/C correlated with an increased steady-state level of sumoylation. However, lamin A and C did not appear to be modified by sumo1. Our results suggest that mutant lamin A/C alters the dynamics of sumo1 and thus misregulation of sumoylation may be contributing to disease progression in laminopathies.     

Viable <Emphasis Type="Italic">Ednra</Emphasis><Superscript><Emphasis Type="Italic">Y129F</Emphasis></Superscript> mice feature human mandibulofacial dysostosis with alopecia (MFDA) syndrome due to the homologue mutation

Animal models resembling human mutations are valuable tools to research the features of complex human craniofacial syndromes. This is the first report on a viable dominant mouse model carrying a non-synonymous sequence variation within the endothelin receptor type A gene (Ednra c.386A>T, p.Tyr129Phe) derived by an ENU mutagenesis program. The identical amino acid substitution was reported recently as disease causing in three individuals with the mandibulofacial dysostosis with alopecia (MFDA, OMIM 616367) syndrome. We performed standardized phenotyping of wild-type, heterozygous, and homozygous Ednra ^Y129F mice within the German Mouse Clinic. Mutant mice mimic the craniofacial phenotypes of jaw dysplasia, micrognathia, dysplastic temporomandibular joints, auricular dysmorphism, and missing of the squamosal zygomatic process as described for MFDA-affected individuals. As observed in MFDA-affected individuals, mutant Ednra ^Y129F mice exhibit hearing impairment in line with strong abnormalities of the ossicles and further, reduction of some lung volumetric parameters. In general, heterozygous and homozygous mice demonstrated inter-individual diversity of expression of the craniofacial phenotypes as observed in MFDA patients but without showing any cleft palates, eyelid defects, or alopecia. Mutant Ednra ^Y129F mice represent a valuable viable model for complex human syndromes of the first and second pharyngeal arches and for further studies and analysis of impaired endothelin 1 (EDN1)–endothelin receptor type A (EDNRA) signaling. Above all, Ednra ^Y129F mice model the recently published human MFDA syndrome and may be helpful for further disease understanding and development of therapeutic interventions.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Development of a novel pink-eyed dilution mouse model showing progressive darkening of the eyes and coat hair with aging

Oca2^p-cas (oculocutaneous albinism II; pink-eyed dilution castaneus) is a coat color mutant gene on mouse chromosome 7 that arose spontaneously in wild Mus musculus castaneus mice. Mice homozygous for Oca2^p-cas usually exhibit pink eyes and gray coat hair on the non-agouti genetic background, and this ordinary phenotype remains unchanged throughout life. During breeding of a mixed strain carrying this gene on the C57BL/6J background, we discovered a novel spontaneous mutation that causes darkening of the eyes and coat hair with aging. In this study, we developed a novel mouse model showing this unique phenotype. Gross observations revealed that the pink eyes and gray coat hair of the novel mutant young mice became progressively darker in color by approximately 3 months after birth. Light and transmission-electron microscopic observations revealed a marked increase in melanin pigmentation of coat hair shafts and choroid of the eye in the novel mice compared to that in the ordinary mice. Sequence analysis of Oca2^p-cas revealed a 4.1-kb deletion involving exons 15 and 16 of its wild-type gene. However, there was no sequence difference between the two types of mutant mice. Mating experiments suggested that the novel mutant phenotype was not inherited in a simple fashion, due to incomplete penetrance. The novel spontaneous mutant mouse is the first example of progressive hair darkening animals and is an essential animal model for understanding of the regulation mechanisms of melanin biosynthesis with aging.     

Ctf4p facilitates Mcm10p to promote DNA replication in budding yeast

Ctf4p (chromosome transmission fidelity) has been reported to function in DNA metabolism and sister chromatid cohesion in Saccharomyces cerevisiae. In this study, a ctf4^S143F mutant was isolated from a yeast genetic screen to identify replication-initiation proteins. The ctf4^S143F mutant exhibits plasmid maintenance defects which can be suppressed by the addition of multiple origins to the plasmid, like other known replication-initiation mutants. We show that both ctf4^S143F and ctf4Δ strains have defects in S phase entry and S phase progression at the restrictive temperature of 38 °C. Ctf4p localizes in the nucleus throughout the cell cycle but only starts to bind chromatin at the G1/S transition and then disassociates from chromatin after DNA replication. Furthermore, Ctf4p interacts with Mcm10p physically and genetically, and the chromatin association of Ctf4p depends on Mcm10p. Finally, deletion of CTF4 destabilizes Mcm10p and Pol α in both mcm10-1 and MCM10 cells. These data indicate that Ctf4p facilitates Mcm10p to promote the DNA replication.     

Compound Heterozygosity of the Functionally Null Cdh23v-ngt and Hypomorphic Cdh23ahl Alleles Leads to Early-onset Progressive Hearing Loss in Mice

The waltzer (v) mouse mutant harbors a mutation in Cadherin 23 (Cdh23) and is a model for Usher syndrome type 1D, which is characterized by congenital deafness, vestibular dysfunction, and prepubertal onset of progressive retinitis pigmentosa. In mice, functionally null Cdh23 mutations affect stereociliary morphogenesis and the polarity of both cochlear and vestibular hair cells. In contrast, the murine Cdh23^ahl allele, which harbors a hypomorphic mutation, causes an increase in susceptibility to age-related hearing loss in many inbred strains. We produced congenic mice by crossing mice carrying the v niigata (Cdh23^v-ngt) null allele with mice carrying the hypomorphic Cdh23^ahl allele on the C57BL/6J background, and we then analyzed the animals’ balance and hearing phenotypes. Although the Cdh23^v-ngt/ahl compound heterozygous mice exhibited normal vestibular function, their hearing ability was abnormal: the mice exhibited higher thresholds of auditory brainstem response (ABR) and rapid age-dependent elevation of ABR thresholds compared with Cdh23^ahl/ahl homozygous mice. We found that the stereocilia developed normally but were progressively disrupted in Cdh23^v-ngt/ahl mice. In hair cells, CDH23 localizes to the tip links of stereocilia, which are thought to gate the mechanoelectrical transduction channels in hair cells. We hypothesize that the reduction of Cdh23 gene dosage in Cdh23^v-ngt/ahl mice leads to the degeneration of stereocilia, which consequently reduces tip link tension. These findings indicate that CDH23 plays an important role in the maintenance of tip links during the aging process.     

UNC93B1 and Nucleic Acid-sensing Toll-like Receptors Mediate Host Resistance to Infection with Leishmania major

The mammalian homolog B1 of Unc-93 Caenorhabditis elegans known as UNC93B1 is a chaperone protein that mediates translocation of the nucleic acid-sensing Toll-like receptors (TLRs) from the endoplasmic reticulum to the endolysosomes. The triple deficient (UNC93B1 mutant) mice have a functional single point mutation in the UNC93B1 that results in non-functional TLR3, TLR7, and TLR9. Herein, we demonstrate that UNC93B1 mutant mice, in the C57BL/6 (resistant) genetic background, are highly susceptible to Leishmania major infection. Enhanced swelling of the footpad was associated with high levels of interleukin 10, decreased levels of interferon γ, and increased parasitism. None of the single TLR3, TLR7, and TLR9 knock-out (KO) mice resemble the UNC93B1 mutant phenotype upon infection with L. major. Whereas the double TLR7/TLR9 KO showed a partial phenotype, the triple TLR3/TLR7/TLR9 KO mice were as susceptible as the UNC93B1 mutant mice, when infected with Leishmania parasites. Finally, we demonstrate that treatment with either anti-interleukin 10 receptor monoclonal antibody or recombinant interleukin 12 restored a robust anti-parasite T_H1 response and reverted the susceptible phenotype of UNC93B1 mutant mice. Altogether, our results indicate the redundant and essential role of nucleic acid-sensing TLR3, TLR7 and TLR9 in inducing interleukin 12, development of a T_H1 response, and resistance to L. major infection in resistant C57BL/6 mice.