Simian virus 40 DNA replication: functional organization of regulatory elements.

The efficiency of simian virus 40 (SV40) DNA replication is dependent on the structural organization of the regulatory region. The enhancing effect of the G + C-rich 21-base-pair (bp) repeats on SV40 DNA replication is position and dose dependent and to some extent orientation dependent. The inverted orientation is about 50% as effective as the normal orientation of the 21-bp repeat region. Movement of the 21-bp repeat region 180 or 370 bp upstream of the ori sequence abolishes its enhancing effect, whereas no replication is detected if the 21-bp repeat region is placed downstream of the ori sequence. The dose-dependent enhancement of the 21-bp repeat of SV40 DNA replication as first described in single transfection by Bergsma et al. (D. J. Bergsma, D. M. Olive, S. W. Hartzell, and K. N. Subramanian, Proc. Natl. Acad. Sci. USA 79:381-385, 1982) is dramatically amplified in mixed transfection. In the presence of the 21-bp repeat region, the 72-bp repeat region can enhance SV40 DNA replication. In the presence of the 21-bp repeats and a competitive environment, the 72-bp repeat region exhibits a cis-acting inhibitory effect on SV40 DNA replication.     

Simian virus 40 gene A function and maintenance of transformation.

Transformants have been isolated after infection of rat embryo cells at 33 C with either wild-type simian virus 40 or with the temperature-sensitive gene A mutants, tsA7 and tsA28. Examination of properties usually associated with transformation such as growth in 1% serum, growth rate, saturation density, and morphology show that these properties are temperature dependent in the tsA transformants characterized, but are not temperature dependent in the wild-type transformants that have been examined. In the most thoroughly characterized tsA transformants the expression of T antigen also appears to be temperature dependent. These data suggest that an active A function is required for the maintenance of transformation in these cells. In the lytic cycle, the A function is involved in the initiation of DNA synthesis. Thus transformation by simian virus 40 may be the direct consequence of the introduction of the simian virus 40 replicon and the presence of its DNA initiator function, which causes the cell to express a transformed phenotype.     

Simian virus 40 (SV40) small t antigen inhibits SV40 DNA replication in vitro.

We describe a biochemical function of simian virus 40 small t antigen, the inhibition of simian virus 40 large T antigen-mediated viral DNA replication in an in vitro replication system. Our results suggest that in this system, small t antigen prevents protein phosphatase 2A-mediated activation of large T antigen.     

Simian virus 40 origin- and T-antigen-dependent DNA replication with Drosophila factors in vitro.

DNA replication of double-stranded simian virus 40 (SV40) origin-containing plasmids, which has been previously thought to be a species-specific process that occurs only with factors derived from primate cells, is catalyzed with an extract derived from embryos of the fruit fly Drosophila melanogaster. This reaction is dependent upon both large T antigen, the SV40-encoded replication initiator protein and DNA helicase, and a functional T-antigen binding site at the origin of DNA replication. The efficiency of replication with extracts derived from Drosophila embryos is approximately 10% of that observed with extracts prepared from human 293 cells. This activity is not a unique property of embryonic extracts, as cytoplasmic extracts from Drosophila tissue culture cells also support T-antigen-mediated replication of SV40 DNA. By using highly purified proteins, DNA synthesis is initiated by Drosophila polymerase alpha-primase in a T-antigen-dependent manner in the presence of Drosophila replication protein A (RP-A; also known as single-stranded DNA-binding protein), but neither human RP-A nor Escherichia coli single-stranded DNA-binding protein could substitute for Drosophila RP-A. In reciprocal experiments, however, Drosophila RP-A was able to substitute for human RP-A in reactions carried out with human polymerase alpha-primase. These results collectively indicate that many of the specific functional interactions among T antigen, polymerase alpha-primase, and RP-A are conserved from primates to Drosophila species. Moreover, the observation that SV40 DNA replication can be performed with Drosophila factors provides a useful assay for the study of bidirectional DNA replication in Drosophila species in the context of a complete replication reaction.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Simian virus 40 DNA replication in nuclear monolayers.

Simian virus 40 DNA replication has been studied in nuclear monolayers prepared by treatment of monolayers of BSC-1 monkey kidney cells with Nonidet P-40. These nuclear monolayers incorporated [3H]TTP into two types of viral replicative intermediates that sediment as 25-26S and 22-23S species, respectively, in neutral sucrose gradients. The 22-23S species behaves, in dye buoyant density equilibrium gradients, as a late replicative intermediate. Examination of both species in alkaline sucrose gradients revealed the presence of two types of newly synthesized strands: (i) 4-7S strands and (ii) full-length, or nearly full-length, 10-16S strands. At low TTP concentrations (less than 0.5 muM), the two size classes were found in approximately equal amounts. However, at 10 to 50 muM TTP, the proportion of the longer strands increased, with a corresponding decrease in the relative amount of the 4-7S species. Thus, the joining of small, Okazaki-like fragments to the growing chain appears to require a much higher concentration of TTP than the synthesis of the fragments themselves. Replicating simian virus 40 DNA synthesized in the nuclear monolayers is is associated with "M bands", as previously demonstrated for replicating simian virus 40 DNA in cultured whole cells.     

Simian virus 40 DNA replication in vitro: identification of multiple stages of initiation.

A cell-free DNA replication system dependent upon five purified cellular proteins, one crude cellular fraction, and the simian virus 40 (SV40)-encoded large tumor antigen (T antigen) initiated and completed replication of plasmids containing the SV40 origin sequence. DNA synthesis initiated at or near the origin sequence after a time lag of approximately 10 min and then proceeded bidirectionally from the origin to yield covalently closed, monomer daughter molecules. The time lag could be completely eliminated by a preincubation of SV40 ori DNA in the presence of T antigen, a eucaryotic single-stranded DNA-binding protein (replication factor A [RF-A]), and topoisomerases I and II. In contrast, if T antigen and the template DNA were incubated alone, the time lag was only partially decreased. Kinetic analyses of origin recognition by T antigen, origin unwinding, and DNA synthesis suggest that the time lag in replication was due to the formation of a complex between T antigen and DNA called the T complex, followed by formation of a second complex called the unwound complex. Formation of the unwound complex required RF-A. When origin unwinding was coupled to DNA replication by the addition of a partially purified cellular fraction (IIA), DNA synthesis initiated at the ori sequence, but the template DNA was not completely replicated. Complete DNA replication in this system required the proliferating-cell nuclear antigen and another cellular replication factor, RF-C, during the elongation stage. In a less fractionated system, another cellular fraction, SSI, was previously shown to be necessary for reconstitution of DNA replication. The SSI fraction was required in the less purified system to antagonize the inhibitory action of another cellular protein(s). This inhibitor specifically blocked the earliest stage of DNA replication, but not the later stages. The implications of these results for the mechanisms of initiation and elongation of DNA replication are discussed.     

Simian virus 40 origin auxiliary sequences weakly facilitate T-antigen binding but strongly facilitate DNA unwinding.

The complete simian virus 40 (SV40) origin of DNA replication (ori) consists of a required core sequence flanked by two auxiliary sequences that together increase the rate of DNA replication in monkey cells about 25-fold. Using an extract of SV40-infected monkey cells that reproduced the effects of ori-auxiliary sequences on DNA replication, we examined the ability of ori-auxiliary sequences to facilitate binding of replication factors and to promote DNA unwinding. Although the replicationally active form of T antigen in these extracts had a strong affinity for ori-core, it had only a weak but specific affinity for ori-auxiliary sequences. Deletion of ori-auxiliary sequences reduced the affinity of ori-core for active T antigen by only 1.6-fold, consistent with the fact that saturating concentrations of T antigen in the cell extract did not reduce the stimulatory role of ori-auxiliary sequences in replication. In contrast, deletion of ori-auxiliary sequences reduced the efficiency of ori-specific, T-antigen-dependent DNA unwinding in cell extracts at least 15-fold. With only purified T antigen in the presence of topoisomerase I to unwind purified DNA, ori-auxiliary sequences strongly facilitated T-antigen-dependent DNA conformational changes consistent with melting the first 50 base pairs. Under these conditions, ori-auxiliary sequences had little effect on the binding of T antigen to DNA. Therefore, a primary role of ori-auxiliary sequences in DNA replication is to facilitate T-antigen-dependent DNA unwinding after the T-antigen preinitiation complex is bound to ori-core.     

Simian virus 40 mutants carrying two temperature-sensitive mutations.

Five temperature-sensitive mutants of simian virus 40 containing two temperature-sensitive mutations were isolated. The double mutant of the A and D complementation groups, like the D mutants, failed to complement by conventional complementation analysis and did not induce host DNA synthesis at 40 degrees C. However, under conditions that suppressed the D defect, the A:D double mutant expressed only the A defect. Thus, viral DNA replication dropped rapidly after this mutant was shifted from permissive to restrictive temperatures. The A:D double mutant failed to transfrom at the restrictive temperature when subconfluent Chinese hamster lung monolayers were used. Double mutants of A:B, A:C, and A:BC complementation groups, like their A parent, were defective in viral DNA replication, in the induction of host DNA synthesis and in the transformation of secondary Chinese hamster lung cells at the nonpermissive temperature.     

Simian virus 40 sequences between 0.168 and 0.424 map units are not required for abortive transformation.

We have isolated a simian virus 40 deletion mutant, F8dl, that lacks the sequences from 0.168 to 0.424 map units. The deleted sequences represent over 60% of the coding region for large T antigen. Despite this deletion, F8dl abortively transformed rat cells as efficiently as wild-type simian virus 40. From this result, we conclude that the region of the simian virus 40 genome between 0.168 and 0.424 map units is not essential for abortive transformation. Since abortive transformation requires the expression of the simian virus 40 maintenance functions, we also infer that the sequences deleted from F8dl are not required to maintain transformation.     

Simian virus 40 DNA replication in vitro: specificity of initiation and evidence for bidirectional replication.

We recently described a soluble cell-free system derived from monkey cells that is capable of replicating exogenous plasmid DNA molecules containing the simian virus 40 (SV40) origin of replication (J.J. Li, and T.J. Kelly, Proc. Natl. Acad. Sci. U.S.A. 81:6973-6977, 1984). Replication in the system is completely dependent upon the addition of the SV40 large T antigen. In this report we describe additional properties of the in vitro replication reaction. Extracts prepared from cells of several nonsimian species were tested for the ability to support origin-dependent replication in the presence of T antigen. The activities of extracts derived from human cell lines HeLa and 293 were approximately the same as those of monkey cell extracts. Chinese hamster ovary cell extracts also supported SV40 DNA replication in vitro, but the extent of replication was approximately 1% of that observed with human or monkey cell extracts. No replication activity was detectable in extracts derived from BALB/3T3 mouse cells. The ability of these extracts to support replication in vitro closely parallels the ability of the same cells to support replication in vivo. We also examined the ability of various DNA molecules containing sequences homologous to the SV40 origin to serve as templates in the cell-free system. Plasmids containing the origins of human papovaviruses BKV and JCV replicated with an efficiency 10 to 20% of that of plasmids containing the SV40 origin. Plasmids containing Alu repeat sequences (BLUR8) did not support detectable DNA replication in vitro. Circular DNA molecules were found to be the best templates for DNA replication in the cell-free system; however, linear DNA molecules containing the SV40 origin also replicated to a significant extent (10 to 20% of circular molecules). Finally, electron microscopy of replication intermediates demonstrated that the initiation of DNA synthesis in vivo takes place at a unique site corresponding to the in vivo origin and that replication is bidirectional. These findings provide further evidence that replication in the cell-free system faithfully mimics SV40 DNA replication in vivo.     

Simian virus 40 large T-antigen-dependent DNA replication is activated by protein phosphatase 2A in vitro.

The simian virus 40 large T antigen (T) is a multifunctional phosphoprotein. We found that T-dependent simian virus 40 DNA replication is substantially inhibited by okadaic acid. This result suggests that DNA replication is activated by dephosphorylation in vitro. We show here that the target activated by dephosphorylation, which stimulates DNA replication, is T and that the phosphatase involved is protein phosphatase 2A.     

Occurrence of reiterated sequences in an untranslated region of Simian virus 40 DNA determined by nucleotide sequence analysis.

An earlier report (Subramanian, Dhar, and Weissman, 1977c) presented the nucleotide sequence of Eco RII-G fragment of SV40 DNA, which contains the origin of DNA replication. The nucleotide sequence of Eco RII-N fragment located next to Eco RII-G on the physical map of SV40 DNA is presented in this report. Eco RII-N is found to be a tandem duplication of the last 55 nucleotides of Eco RII-G. This tandem repeat is immediately preceded by two other reiterated sequences occurring within Eco RII-G, one of them being a tandem repeat of 21 nucleotides and the other a nontandem repeat of 10 nucleotides. These repetitive sequences occur in close proximity to the origin of DNA replication which is known to contain other specialized sequences such as a few palindromes (one of which is 27 long and possesses a perfect 2-fold axis of symmetry), one "true" palindrome, and a long A/T-rich cluster. The repeats (and the replication origin) occur within an untranslated region of SV40 DNA flanked by (the few) structural genes coding for the "late" proteins on the one side and that (those) coding for the "early" protein(s) on the other side. The reiterated sequences are comparable in some respects to repetitive sequences occurring in eucaryotic DNAs. Possible biological functions of the repeats are discussed.     

Simian virus 40 minichromosomes contain torsionally strained DNA molecules.

Sundin and Varshavsky (J. Mol. Biol. 132:535-546, 1979) found that nearly two-thirds of simian virus 40 (SV40) minichromosomes obtained from nuclei of SV40-infected cells become singly nicked or cleaved across both strands after digestion with staphylococcal nuclease at 0 degrees C. The same treatment of SV40 DNA causes complete digestion rather than the limited cleavages produced in minichromosomal DNA. We have explored this novel behavior of the minichromosome and found that the nuclease sensitivity is dependent upon the topology of the DNA. Thus, if minichromosomes are pretreated with wheat germ DNA topoisomerase I, the minichromosomal DNA is completely resistant to subsequent digestion with staphylococcal nuclease at 0 degrees C. If the minichromosome-associated topoisomerase is removed, virtually all of the minichromosomes are cleaved to nicked or linear structures by the nuclease treatment. The cleavage sites are nonrandomly located; instead they occur at discrete loci throughout the SV40 genome. SV40 minichromosomal DNA is also cleaved to nicked circles and full-length linear fragments after treatment with the single strand-specific endonuclease S1; this cleavage is also inhibited by pretreatment with topoisomerase I. Thus, it may be that the nuclease sensitivity of minichromosomes is due to the transient or permanent unwinding of discrete regions of their DNA. Direct comparisons of the extent of negative supercoiling of native and topoisomerase-treated SV40 minichromosomes revealed that approximately two superhelical turns were removed by the topoisomerase treatment. The loss of these extra negative supercoils from the DNA probably accounts for the resistance of the topoisomerase-treated minichromosomes to the staphylococcal and S1 nucleases. These findings suggest that the DNA in SV40 intranuclear minichromosomes is torsionally strained. The functional significance of this finding is discussed.