The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes.     

Determinants for binding of a 40 kDa protein to the leaders of yeast mitochondrial mRNAs.

An abundant yeast mitochondrial 40 kDa protein (p40) binds with high specificity to the 5'-untranslated region of cytochrome c oxidase subunit II (COX2) mRNA. Using mobility shift and competition assays, we show here that purified p40 complexes with the leaders of all eight mitochondrial mRNAs of Saccharomyces cerevisiae. The location of the protein binding site on the different leaders is not conserved with respect to the AUG start codon. In vitro RNA footprint and deletion experiments have been used to define the p40-binding site on the leaders of COX1 and ATP9 mRNAs. Nucleotides at, and near, a single stranded region are protected or exposed for DEPC modification by binding of p40 to these leaders. Removal of this region from the COX1 messenger shows that it is essential for the protein-RNA interaction. While no obvious sequence similarity can be detected between the single stranded regions in different leaders, a nearby helical segment is conserved. A consensus model for p40-RNA interactions is presented and the possible biological function of p40 is discussed.     

Properties of an abundant RNA-binding protein in yeast mitochondria

We have previously identified a protein with Mr approximately 40,000 (p40) that binds with high specificity and affinity to the 5'-untranslated leaders of mitochondrial mRNAs in yeast. Here we show that this protein is abundant, comprising about 0.4% of total mitochondrial protein. p40 is present in a cytoplasmic (rho degree) petite mutant that lacks mitochondrial protein synthesis and is therefore nuclear encoded. p40 can be detected by immunological techniques in cell lysates of several different pet mutants, specifically disturbed in the translation of individual mitochondrial mRNAs. It is thus not one of the translation factors defined by any of these mutations. In the case of a pet111 mutant, which is specifically blocked in the translation of COX2 mRNA, extracts still display COX2 mRNA binding activity, indicating that p40 complex formation in vitro is not dependent on the presence of PET111.     

In Vivo Analysis of Saccharomyces Cerevisiae Cox2 mRNA 5''-Untranslated Leader Functions in Mitochondrial Translation Initiation and Translational Activation

We have used mutational and revertant analysis to study the elements of the 54-nucleotide COX2 5'-untranslated leader involved in translation initiation in yeast mitochondria and in activation by the COX2 translational activator, Pet111p. We generated a collection of mutants with substitutions spanning the entire COX2 5'-UTL by in vitro mutagenesis followed by mitochondrial transformation and gene replacement. The phenotypes of these mutants delimit a 31-nucleotide segment, from -16 to -46, that contains several short sequence elements necessary for COX2 5'-UTL function in translation. The sequences from -16 to -47 were shown to be partially sufficient to promote translation in a foreign context. Analysis of revertants of both the series of linker-scanning alleles and two short deletion/insertion alleles has refined the positions of several possible functional elements of the COX2 5'-untranslated leader, including a putative RNA stem-loop structure that functionally interacts with Pet111p and an octanucleotide sequence present in all S. cerevisiae mitochondrial mRNA 5'-UTLs that is a potential rRNA binding site.     

A 60-kDa protein from rabbit reticulocytes specifically recognizes the capped 5' end of beta-globin mRNA

The binding of proteins from rabbit reticulocyte lysate to in-vitro-generated beta-globin mRNA and its defined segments was investigated using ultraviolet-cross-linking experiments as well as gel-retardation assays. Under stringent conditions, only three proteins (72, 60 and 50 kDa) were found associated with full-length beta-globin mRNA at different positions. The 72-kDa protein is most likely the poly(A)-binding protein and binds, as expected, to the poly(A) tail, whereas the 50-kDa protein exhibits affinity for the trailer region of beta-globin mRNA. The binding region of the 60-kDa protein is located at the 5' end of beta-globin mRNA. The interaction of this protein is dependent on the presence of the 5' cap structure, as indicated by competition experiments using an uncapped beta-globin-mRNA leader segment. Further competition experiments with beta-globin mRNA, deleted in part in the leader region, suggest that, besides the cap structure, certain sequence elements are necessary for the interaction of the 60-kDa protein and the beta-globin mRNA leader.     

Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported

Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.     

cis- and trans-Acting determinants for translation of psbD mRNA in Chlamydomonas reinhardtii

Chloroplast translation is mediated by nucleus-encoded factors that interact with distinct cis-acting RNA elements. A U-rich sequence within the 5' untranslated region of the psbD mRNA has previously been shown to be required for its translation in Chlamydomonas reinhardtii. By using UV cross-linking assays, we have identified a 40-kDa RNA binding protein, which binds to the wild-type psbD leader, but is unable to recognize a nonfunctional leader mutant lacking the U-rich motif. RNA binding is restored in a chloroplast cis-acting suppressor. The functions of several site-directed psbD leader mutants were analyzed with transgenic C. reinhardtii chloroplasts and the in vitro RNA binding assay. A clear correlation between photosynthetic activity and the capability to bind RNA by the 40-kDa protein was observed. Furthermore, the data obtained suggest that the poly(U) region serves as a molecular spacer between two previously characterized cis-acting elements, which are involved in RNA stabilization and translation. RNA-protein complex formation depends on the nuclear Nac2 gene product that is part of a protein complex required for the stabilization of the psbD mRNA. The sedimentation properties of the 40-kDa RNA binding protein suggest that it interacts directly with this Nac2 complex and, as a result, links processes of chloroplast RNA metabolism and translation.     

The solution structure of human mitochondria fission protein Fis1 reveals a novel TPR-like helix bundle

Fis1 in yeast localizes to the outer mitochondrial membrane and facilitates mitochondrial fission by forming protein complexes with Dnm1 and Mdv1. Fis1 orthologs exist in higher eukaryotes, suggesting that they are functionally conserved. In the present study, we cloned the human Fis1 ortholog that was predicted in a database, and determined the protein structure using NMR spectroscopy. Following a flexible N-terminal tail, six alpha-helices connected with short loops construct a single core domain. The C-terminal tail containing a transmembrane segment appears to be disordered. In the core domain, each of two sequentially adjacent helices forms a hairpin-like conformation, resulting in a six helix assembly forming a slightly twisted slab similar to that of a tandem array of tetratrico-peptide repeat (TPR) motif folds. Within this TPR-like core domain, no significant sequence similarity to the typical TPR motif is found. The structural analogy to the TPR-containing proteins suggests that Fis1 binds to other proteins at its concave hydrophobic surface. A simple composition of Fis1 comprised of a binding domain and a transmembrane segment indicates that the protein may function as a molecular adaptor on the mitochondrial outer membrane. In HeLa cells, however, increased levels in mitochondria-associated Fis1 did not result in mitochondrial translocation of Drp1, a potential binding partner of Fis1 implicated in the regulation of mitochondrial fission, suggesting that the interaction between Drp1 and Fis1 is regulated.     

Yeast mitochondrial NAD(+)-dependent isocitrate dehydrogenase is an RNA-binding protein.

We have previously described the characterisation of an abundant mitochondrial protein (p40) that binds specifically to 5'-untranslated leaders of mitochondrial mRNAs in yeast. p40 consists of two polypeptides with M(r) of 40 and 39 kDa. Limited sequence analysis of p40 identifies it as the Krebs cycle enzyme NAD(+)-dependent isocitrate dehydrogenase (Idh). Both enzyme and RNA-binding activities are specifically lost in cells containing disruptions in either IDH1 or IDH2, the nuclear genes encoding the two subunits of the enzyme, thus conclusively identifying p40 as Idh and showing that both activities are dependent on the simultaneous presence of both subunits. Although we still must ascertain whether and how either function of Idh is regulated and whether the two functions are compatible or mutually exclusive, this combination of dehydrogenase activity and RNA-binding in a single protein may be part of a general regulatory circuit linking the need for mitochondrial function to mitochondrial biogenesis.     

Mitochondrial energy-linked nicotinamide nucleotide transhydrogenase: effect of substrates on the sensitivity of the enzyme to trypsin and identification of tryptic cleavage sites

The mitochondrial nicotinamide nucleotide transhydrogenase catalyzes hydride ion transfer between NAD(H) and NADP(H) in a reaction that is coupled to proton translocation across the inner mitochondrial membrane. The enzyme (1043 residues) is composed of an N-terminal hydrophilic segment (approximately 400 residues long) which binds NAD(H), a C-terminal hydrophilic segment (approximately 200 residues long) which binds NADP(H), and a central hydrophobic segment (approximately 400 residues long) which appears to form about 14 membrane-intercalating clusters of approximately 20 residues each. Substrate modulation of transhydrogenase conformation appears to be intimately associated with its mechanism of proton translocation. Using trypsin as a probe of enzyme conformation change, we have shown that NADPH (and to a much lesser extent NADP) binding alters transhydrogenase conformation, resulting in increased susceptibility of several bonds to tryptic hydrolysis. NADH and NAD had little or no effect, and the NADPH concentration for half-maximal enhancement of trypsin sensitivity of transhydrogenase activity (35 microM) was close to the Km of the enzyme for NADPH. The NADPH-promoted trypsin cleavage sites were located 200-400 residues distant from the NADP(H) binding domain near the C-terminus. For example, NADPH binding greatly increased the trypsin sensitivity of the K410-T411 bond, which is separated from the NADP(H) binding domain by the 400-residue-long membrane-intercalating segment. It also enhanced the tryptic cleavage of the R602-L603 bond, which is located within the central hydrophobic segment. These results, which suggest a protein conformation change as a result of NADPH binding, have been discussed in relation to the mechanism of proton translocation by the transhydrogenase.     

The Ff gene 5 single-stranded DNA-binding protein binds to the transiently folded form of an intramolecular G-quadruplex

The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.