Isozyme polymorphisms within <Emphasis Type="Italic">Pyrenophora tritici-repentis</Emphasis> population in Argentina

Tan spot caused by Pyrenophora tritici-repentis is an economically important disease of wheat (Triticum aestivum L.) in Argentina. The success of local breeding programs for resistance to the disease depends to a large extent on the genetic variation within the pathogen population. To assay this variability, 155 isolates of P. tritici-repentis obtained from leaves of wheat and Festuca sp. of different localities were assayed and compared for isozyme polymorphisms. Isozyme analysis was performed with polyacrilamide gel electrophoresis in the systems estearase, phosphatase and peroxidase. Variation in the number and relative mobility of the bands by each system was detected in this collection of isolates. Intraspecific polymorphisms were identified in the three systems assayed. The cluster analysis based in bands patterns defined 86 electromorph types among the 155 isolates evaluated according with the Jaccard’s coefficient (CCC = 095). The isozymes patterns were not correlated with the geographic and/or wheat cultivars origin of the P. tritici-repentis isolates.     

Preliminary studies on biological control of the blackpoint complex of wheat in Argentina

Blackpoint is a brownish or black discoloration of wheat kernels and biological control is a complementary strategy to manage the disease. This work evaluated the effect of five strains of Trichoderma harzianum and one strain of T. koningii on the growth of Bipolaris sorokiniana and Alternaria alternata and compared the results of screening tests under controlled conditions and field evaluations on bread and durum wheat ears. Disease incidence, infection percentage and seedling emergence percentage determined in a greenhouse assay were evaluated. Dual cultures showed Trichoderma spp. inhibited significantly the mycelial growth of B. sorokiniana between 36 and 71% and of A. alternata between 41 and 61%. Microscopic examination of B. sorokiniana and A. alternata showed plasmolysis and vacuolization of hyphae of the pathogens in the presence of the antagonists tested. With pre-inoculation of wheat ears at anthesis under field conditions, disease incidence, infection percentage by blotter tests and seedling emergence in the greenhouse did not show significant differences between controls and treatments with Trichoderma spp. This revised version was published online in August 2006 with corrections to the Cover Date.     

Restriction analysis of the amplified ribosomal DNA spacers ITS1 and ITS2 of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis> isolates

The purpose of this study was to examine the genotypic variability of Bipolaris sorokiniana by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis using rDNA. Fifty B. sorokiniana isolates from Brazil and other countries, one Bipolaris oryzae and six Drechslera teres isolates were used. The intragenic spacer regions (ITS1 and ITS2) were the regions used for characterization of isolates. The amplification products for both ITS regions, showed two DNA fragments for all isolates. Two B. sorokiniana isolates presented an intraspecific variability showing a third fragment for the ITS1 region. The dendrograms generated with PCR-RFLP data showed intra- and inter-specific groups. The dendrograms showed that most of Brazilian isolates clustered together forming groups between them, and this behavior was repeated with most isolates from other countries. The dendrograms did not enable the separation of B. sorokiniana isolates by their geographic origin or host type. These results suggest the occurrence of gene flow between different populations of the fungus isolated in geographically distant regions and lends cogency to the occurrence of gene flow between species.     

Effect of <Emphasis Type="Italic">Trichoderma</Emphasis> spp. isolates for biological control of tan spot of wheat caused by <Emphasis Type="Italic">Pyrenophora tritici-repentis</Emphasis> under field conditions in Argentina

Trichoderma spp. have been used as biocontrol agents to protect plants against foliar diseases in several crops, but information from field assays is scarce. In the present work, experiments were carried out to determine the effect of six isolates of Trichoderma harzianum and one isolate of T. koningii on the incidence and severity of tan spot, caused by Pyrenophora tritici-repentis (anamorph: Drechslera tritici-repentis) under field conditions. Significant differences between years, wheat cultivars and treatments were found. In 2003, two of the isolates assayed (T5, T7) showed the best performance against the disease applied as seed treatments or sprayed onto wheat leaves at different stages. The application of six of the treatments on wheat plants significantly reduced disease severity by 16 to 35% in comparison with the control. Disease control provided by isolate T7 was similar to that provided by the fungicide treatment (56% reduction). This is the first report on the efficacy of Trichoderma spp. against tan spot under field conditions in Argentina.     

The influence of Bipolaris sorokiniana and Drechslera dictyoides metabolites on cell membrane permeability of Festuca pratensis callus

The aim of this study was the evaluation of membrane permeability of callus cells of several Polish meadow fescue cultivars, which were treated with toxins of two leaf spot pathogens Bipolaris sorokiniana and Drechslera dictyoides. Fungus metabolites were obtained by the method described by Lepoivre et al. (1986). Calli of cultivars ‘Skrzeszowicka’, ‘Skawa’, ‘Westa’, POB 282, POB 383, KOA 186 have been selected on medium with metabolites for two weeks. Next the conductivity test of electrolyte leakage and of total ion contents in the examined tissue was done. On the base of this data the membrane permeability coefficients for each cultivar were calculated. Toxins of B. sorokiniana damaged the cell membranes more strongly than metabolites of D. dictyoides. The significant differences of several objects sensitivity to the influence of B. sorokiniana metabolites were stated. These differences were not observed in the case of the influence of D. dictyoides metabolites on the examined tissue.     

Aggressiveness analysis of foliar fungi to leaves of wheat and rice crops

Abstract

The investigations were based on two surveys of wheat and one survey of rice. Alternaria alternata, Curvularia lunata, Helminthosporium tetramera and Bipolaris sorokiniana were isolated and identified from foliage and soil of both wheat and rice crops and their aggressiveness was studied by aggressiveness analysis screened out into different aggressiveness classes. The aggressiveness of isolated fungi was studied on wheat varieties (Inqalab-91 and Chakwal-86) and rice varieties (Basmati-385 and IRRI-6) under controlled conditions. In the foliar aggressiveness test of A. alternata, the overall number of aggressive isolates was higher on wheat varieties than rice. Bipolaris sorokiniana isolates showed foliar blight symptoms on wheat but not on rice varieties. In C. lunata, the overall number of aggressive isolates was higher on wheat. In the foliar aggressiveness test of H. tetramera, the number of non-aggressive isolates was almost the same on wheat and rice varieties. In the present study it became clear that A. alternate, B. sorokiniana, C. lunata and H. tetramera are common foliar pathogens in rice and wheat crops and can cause soil-borne and foliar diseases.     

A new technique for monoconidial culture of the most aggressive isolate in a given population of Bipolaris sorokiniana, cause of foliar spot blotch in wheat and barley

We developed a new technique for monoconidial culture of the most aggressive isolate in a given population of Bipolaris sorokiniana, to facilitate the evaluation of spot blotch resistance in wheat and barley. Blotched portions of infected barley leaves were placed on a glass slide in a moist chamber for production of conidia by associated fungal hyphae. Conidia were collected separately and grown on water agar discs. Individual water agar discs having conidium growth were inoculated on barley leaves. The conidium producing the earliest symptom with the largest lesion was considered most aggressive. This lesion was incubated in a moist chamber and the conidial offspring were tested for pathogenicity. When a uniform infection was observed, a small piece of the lesion was cut using a sterilized scalpel, surface sterilized with NaOCl, and inoculated in the centre of Petri dishes containing potato dextrose agar medium. The inoculated Petri dishes were incubated at 25 ± 1 °C to yield monoconidial cultures of the most aggressive isolate. Variability in symptom expression caused by the most aggressive isolate of a given population was much less than variability in symptom expression caused by all isolates collectively. The techniques will be useful for plant pathologists and breeders in screening for spot blotch resistance in wheat and barley.     

Association of melanin content with conidiogenesis in Bipolaris Sorokiniana of barley (Hordeum vulgare L.)

Sixty-seven isolates of Bipolaris sorokiniana of barley, belonging to three groups (black, white and mixed) were studied to find an association of melanin with the spore production of the fungus. Conidiogenesis in black, white and mixed subpopulation of B. sorokiniana was positively correlated with melanin content/g of mycelium. Primary hyphae of black and mixed subpopulation differentiated into secondary hyphal structures which subsequently produced conidiophores and conidia. Primary hyphae could not differentiate into secondary hyphae and subsequently conidiophores and conidia in white subpopulation. A melanin containing mutant developed from white subpopulation regained its ability to differentiate into secondary hyphae, conidiophores and conidia. Results showed that melanization of mycelia B. sorokiniana mycelia is an important factor for conidia production.     

Influence of Seed‐borne Cochliobolus sativus (Anamorph Bipolaris sorokiniana) on Crown Rot and Root Rot of Barley and Wheat

The effect of seed‐borne pathogens of wheat and barley on crown and root rot diseases of seven barley cultivars (Jimah‐6, Jimah‐51, Jimah‐54, Jimah‐58, Omani, Beecher and Duraqi) and three wheat cultivars (Cooley, Maissani and Shawarir) was investigated. Bipolaris sorokiniana and Alternaria alternata were detected in seeds of at least eight cultivars, but Fusarium species in seeds of only two barley cultivars (Jimah‐54 and Jimah‐58). Crown rot and root rot symptoms developed on barley and wheat cultivars following germination of infected seeds in sterilized growing media. Bipolaris sorokiniana was the only pathogen consistently isolated from crowns and roots of the emerging seedlings. In addition, crown rot and root rot diseases of non‐inoculated barley cultivars correlated significantly with B. sorokiniana inoculum in seeds (P = 0.0019), but not with Fusarium or Alternaria (P > 0.05). These results indicate the role of seed‐borne inoculum of B. sorokiniana in development of crown rot and root rot diseases. Pathogenicity tests of B. sorokiniana isolates confirmed its role in inducing crown rot and root rot, with two wheat cultivars being more resistant to crown and root rots than most barley cultivars (P < 0.05). Barley cultivars also exhibited significant differences in resistance to crown rot (P < 0.05). In addition, black point disease symptoms were observed on seeds of three barley cultivars and were found to significantly affect seed germination and growth of some of these cultivars. This study confirms the role of seed‐borne inoculum of B. sorokiniana in crown and root rots of wheat and barley and is the first report in Oman of the association of B. sorokiniana with black point disease of barley.     

The discovery of the virulence gene ToxA in the wheat and barley pathogen Bipolaris sorokiniana

Bipolaris sorokiniana is the causal agent of multiple diseases on wheat and barley and is the primary constraint to cereal production throughout South Asia. Despite its significance, the molecular basis of disease is poorly understood. To address this, the genomes of three Australian isolates of B. sorokiniana were sequenced and screened for known pathogenicity genes. Sequence analysis revealed that the isolate BRIP10943 harboured the ToxA gene, which has been associated previously with disease in the wheat pathogens Parastagonospora nodorum and Pyrenophora tritici‐repentis. Analysis of the regions flanking ToxA within B. sorokiniana revealed that it was embedded within a 12‐kb genomic element nearly identical to the corresponding regions in P. nodorum and P. tritici‐repentis. A screen of 35 Australian B. sorokiniana isolates confirmed that ToxA was present in 12 isolates. Sequencing of the ToxA genes within these isolates revealed two haplotypes, which differed by a single non‐synonymous nucleotide substitution. Pathogenicity assays showed that a B. sorokiniana isolate harbouring ToxA was more virulent on wheat lines that contained the sensitivity gene when compared with a non‐ToxA isolate. This work demonstrates that proteins that confer host‐specific virulence can be horizontally acquired across multiple species. This acquisition can dramatically increase the virulence of pathogenic strains on susceptible cultivars, which, in an agricultural setting, can have devastating economic and social impacts.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Morphology,Physiology, and Virulence of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis> Isolates

Bipolaris sorokiniana is a phytopathogenic fungus that causes diseases in cereal crops. The high morphological, physiological, and genetic variability makes the control of this fungus a difficult task. The aim of this work was to study the virulence, morphological, and physiological variability of B. sorokiniana isolates. For this, 35 B. sorokiniana isolates from different geographic regions in Brazil and other countries were used. The isolates were evaluated for their morphological variability, considering mycelium color, sector formation, and growth rate. Based on these morphological characteristics, the isolates were grouped in five different morphological groups. Extracellular enzymes activity in solid medium, virulence in wheat seeds and seedlings, and analysis of total proteins by SDS-PAGE were evaluated for all isolates. Variations among the isolates were found for enzymatic activity, and esterase was the enzyme that showed the highest activity indices. The results obtained from infection of seeds and seedlings showed that isolates from the same geographical region and morphological group had different degrees of virulence. The total protein profile shown by the isolates varied in the number of bands and intensity, where some of them may be used to characterize the specie.     

The effects of culture media, solid substrates, and relative humidity on growth, sporulation and conidial discharge of Valdensinia heterodoxa

Valdensinia heterodoxa (Sclerotiniacae) is a potential fungal bioherbicide for control of salal (Gaultheria shallon). The effect of culture media, substrates and relative humidity (RH) on growth, sporulation and conidial discharge of V. heterodoxa was determined for two isolates PFC2761 and PFC3027 in vitro. Culture media significantly affected the growth, sporulation, and conidial discharge of V. heterodoxa. Of eight agar media used, colony radial growth was optimal on salal oatmeal agar and salal potato dextrose agar for isolates PFC2761 and PFC3027, respectively; whereas sporulation was at an optimum on salal oatmeal agar for both isolates. Of the eight liquid media tested, mycelial production was highest on wheat bran–salal–potato dextrose broth. Growth on solid substrates greatly stimulated sporulation and conidial discharge of V. heterodoxa. Of the 12 solid substrates used, the greatest numbers of discharged conidia were observed from wheat bran and wheat bran–salal within 14 d of sporulation. Sporulation on solid substrates continued for 42 d. RH significantly affected the sporulation and conidial discharge for both isolates across all solid substrates tested. No conidia were produced or discharged below 93 % RH on wheat bran–salal and millet. With an increase of the RH from 93 to 97 %, sporulation and the number of discharged conidia increased significantly for both isolates on wheat bran–salal, but not on millet.     

Vegetative growth and sporulation ofBipolaris sorokiniana on sequentially older infected leaves ofPoa pratensis exposed to postemergence herbicides

Poa pratensis was exposed to the postemergence herbicides 2,4-D, MCPP, and dicamba at concentrations of 10^–6 M applied to the soil surface. Sequentially older leaf blades were inoculated withBipolaris sorokiniana and detached to determine the effect of the herbicides on saprophytic hyphal growth and sporulation on the tissue of each older leaf. 2,4-D and dicamba stimulated hyphal growth in vitro from leaf tissue of all ages; MCPP had no effect on hyphal growth. All herbicides increased sporulation byB. sorokiniana on leaf tissue of all ages. Both hyphal growth and sporulation increased progressively on tissue from sequentially older leaves ofP. pratensis exposed to dicamba.Journal Paper No. J-14985 of the Iowa Agriculture and Home Economics Experiment Station, Ames, Iowa, USA, Project No. 2616.     

Relationship between quantum efficiency of PSII and cold-induced plant resistance to fungal pathogens

The aim of the presented work was to study whether the efficiency of photosynthesis may influence resistance of hardened plants to disease. Seedlings of spring barley, meadow fescue and winter oilseed rape were chilled at 5 °C for 2, 4 or 6 weeks and at these deadlines the changes in cell membrane permeability (expressed as electrolyte leakage), chlorophyll fluorescence (initial fluorescence - F₀, maximal fluorescence - F_m, quantum yield of PSII - F_v/F_m) and net photosynthesis rate (F_N) were measured. Also, the influence of cold on the degree of plant resistance to economically important pathogens -Bipolaris sorokiniana or Phoma lingam was estimated. Two, four or six week-hardened plants were artificially infected: barley and fescue by B. sorokiniana, and oilseed rape by P. lingam. Hardening at 5 °C stimulated resistance of barley, fecue and rape to their specific pathogens. Six-week long acclimation was the most effective for plant resistance. Cold significantly changed cell membrane permeability and decreased chlorophyll fluorescence (F₀, F_m and F_v/F_m) of all studied plant species, while net photosynthesis rate was found to decrease only in barley. The results indicate that cold-induced resistance of plants to pathogens was correlated with a decrease in cell membrane permeability. In the case of fescue and barley a significant connection between the quantum yield of PSII and their resistance to B. sorokiniana was shown. Additionally, the resistance of barley to fungus was depended on net photosynthesis rate. In general this research shows that the efficiency of photosynthesis may be used as an indicator of plant resistance to disease.     

Entomopathogenic fungi of Eurygaster integriceps Puton (Hemiptera: Scutelleridae): collection and characterization for development

Exploratory activities were done in Syria, Turkey, Iran, Uzbekistan, Kazakhstan, The Kyrghyz Republic, and Russia to locate entomopathogenic fungi of Eurygaster integriceps. Isolates from the entomopathogenic genera Beauveria, Paecilomyces, and Verticillium were collected. Beauveria bassiana was the most commonly recovered species. Thirty-one isolates of the 221 recovered were examined at 20, 25, 30, and 35 °C for 20 days for growth and sporulation. Growth and sporulation were generally highest at 25 °C. None of the isolates grew at 35 °C, and at 30 °C growth was retarded with no conidia being produced. Single- and multiple-concentration bioassays were conducted on greenhouse-grown wheat plants and in pine litter to evaluate virulence of fungi from several sources to E. integriceps. When tested at a single concentration, mortality after 15 days ranged from 66 to >95% in the litter assays and 50 to 91% in the plant assays. There was a distinct concentration response for most of the isolates tested in the multiple-concentration assay, particularly in the in-litter environment. In litter, mortality tended to develop earlier than in on-plant assays. Several isolates of B. bassiana and one Metarhizium anisopliae displayed consistently high virulence against E. integriceps and were more virulent than two commercial strains. Our results demonstrate the potential of entomopathogenic fungi for management of E. integriceps in overwintering sites and in wheat fields.     

Biofabricated Silver Nanoparticles Act as a Strong Fungicide against Bipolaris sorokiniana Causing Spot Blotch Disease in Wheat

The present study is focused on the extracellular synthesis of silver nanoparticles (AgNPs) using culture supernatant of an agriculturally important bacterium, Serratia sp. BHU-S4 and demonstrates its effective application for the management of spot blotch disease in wheat. The biosynthesis of AgNPs by Serratia sp. BHU-S4 (denoted as bsAgNPs) was monitored by UV–visible spectrum that showed the surface plasmon resonance (SPR) peak at 410 nm, an important characteristic of AgNPs. Furthermore, the structural, morphological, elemental, functional and thermal characterization of bsAgNPs was carried out using the X-ray diffraction (XRD), electron and atomic microscopies, energy dispersive X-ray (EDAX) spectrometer, FTIR spectroscopy and thermogravimetric analyzer (TGA), respectively. The bsAgNPs were spherical in shape with size range of ∼10 to 20 nm. The XRD and EDAX analysis confirmed successful biosynthesis and crystalline nature of AgNPs. The bsAgNPs exhibited strong antifungal activity against Bipolaris sorokiniana, the spot blotch pathogen of wheat. Interestingly, 2, 4 and 10 µg/ml concentrations of bsAgNPs accounted for complete inhibition of conidial germination, whereas in the absence of bsAgNPs, conidial germination was 100%. A detached leaf bioassay revealed prominent conidial germination on wheat leaves infected with B. sorokiniana conidial suspension alone, while the germination of conidia was totally inhibited when the leaves were treated with bsAgNPs. The results were further authenticated under green house conditions, where application of bsAgNPs significantly reduced B. sorokiniana infection in wheat plants. Histochemical staining revealed a significant role of bsAgNPs treatment in inducing lignin deposition in vascular bundles. In summary, our findings represent the efficient application of bsAgNPs in plant disease management, indicating the exciting possibilities of nanofungicide employing agriculturally important bacteria.     

Effects of Conidia of Various Aspergillus Species on Apoptosis of Human Pneumocytes and Bronchial Epithelial Cells

Aspergillus species can cause mycoses in human and animals. Previously, we demonstrated that A. fumigatus conidia from a human isolate inhibited apoptosis in human pneumocytes and bronchial epithelial cells. In the current study, we studied the effects of A. fumigatus conidia non-human origin and A. flavus, A. nidulans, A. niger and A. oryzae conidia on human cells apoptosis. Human pneumocytes or bronchial epithelial cells were simultaneously exposed to apoptotic inductors and aspergilli conidia. The cell cultures were analyzed by flow cytometry, immunoblotting, and examination of nuclear morphology. Similar to A. fumigatus conidia, A. flavus conidia inhibited cellular apoptosis while A. nidulans, A. niger and A. oryzae conidia did not affect apoptosis. We further studied the species specificity of conidia: there were no differences in the inhibition of apoptosis by A. fumigatus conidia from either human or bird isolates. In order to determine whether the inhibition of apoptosis by conidia is limited to certain strains, the effect on human cell apoptosis of different A. fumigatus human clinical isolates and A. fumigatus of environmental origin was evaluated. All A. fumigatus isolates inhibited apoptosis; an anti-apoptotic factor was released by conidia. For TNF-induced apoptosis, the anti-apoptotic effect of conidia of all isolates was found to be associated with a reduction of caspase-3 in human cells. The results suggest that suppression of apoptosis may play a role in reducing the efficacy of host defense mechanisms during infection with Aspergillus species. F. Féménia and D. Huet made an equal contribution to this work.     

The study of mycolytic properties of aerobic spore-forming bacteria producing extracellular chitinases

The mycolytic activity of 27 strains of antagonistic bacilli belonging to two taxonomic groups (18 strains of Bacillus subtilis and 9 strains of Paenibacillus ehimensis) capable of induced synthesis of chitinolytic enzymes was studied. Most of the B. subtilis strains neither displayed visible mycolytic effects on the phytopathogenic fungus Bipolaris sorokiniana in vitro, nor produced chitinases in the presence of an autoclaved mycelium. On the contrary, P. ehimensis strains grown under conditions favorable for induction of chitinases and other hydrolases exhibited a pronounced lytic effect on B. sorokiniana and actively grew by utilizing mycelium as the sole source of carbon and nitrogen. Comparison of the mycolytic activities of extracellular hydrolases in the studied strains demonstrated low correlation between chitinase production and the ability of the strains to degrade the cell walls of B. sorokiniana. Characterization of enzyme profiles in the studied strains revealed that β-1,3-glucanase was a more significant factor than chitinase for determining the mycolytic potential of bacteria and their ability to utilize the mycelium of phytopathogenic fungi as a growth substrate.     

Dissemination of entomopathogenic fungi using Busseola fusca male as vector

The stem borer, Busseola fusca (Fuller), is an important pest of maize Zea mays L. and sorghum Sorghum bicolor (L.) in eastern and southern Africa. To control this pest, biological control methods including the use of entomopathogenic fungi are being considered. The pathogenicity of one isolate of Metarhizium anisopliae (Metsch.) Sorok. and one isolate of Beauveria bassiana Bals. (Vuill.) were first tested on different developmental stages of B. fusca including eggs, neonate, 2nd and 3rd-instar larvae. Both fungal isolates were pathogenic to all the stages tested. However, differences in mortality were observed among larvae that hatched from treated egg masses. Experiments were conducted thereafter to test whether B. fusca males could serve as a vector for fungal conidia to contaminate B. fusca females and subsequently eggs and larvae. Results demonstrated that B. fusca males successfully transferred inoculum to females during copulation, which in turn transmitted it to the eggs they laid on maize plants, resulting in the decrease of leaf damages.