A conformational switch‐based aptasensor for the chemiluminescence detection of microRNA

A simple microRNA (miRNA) aptasensor has been developed combining the conformational switch of a streptavidin aptamer and isothermal strand displacement amplification. In the presence of its target miRNA, the allosteric molecular beacon (aMB) probe immobilized on the plate can be ‘switched on' and release the streptavidin aptamer. At the same time, Klenow fragment (3′→5′ exo‐) is utilized to initiate DNA‐strand displacement, which starts the target recycling process. Based on the aptamer' high binding affinity and subsequent catalytic chemiluminescence (CL) detection, this CL strategy is highly specific in distinguishing mature miRNAs in same family. It exhibits a dynamic range of four orders of magnitude with a detection limit of 50 fM, and shows great potential for miRNA‐related clinical practices and biochemical research.     

Kinetic optimization of a protein‐responsive aptamer beacon

Aptamers have been utilized as biosensors because they can be readily adapted to sensor platforms and signal transduction schemes through both rational design and selection. One highly generalizable scheme for the generation of the so‐called aptamer beacons involves denaturing the aptamer with antisense oligonucleotides. For example, rational design methods have been utilized to adapt anti‐thrombin aptamers to function as biosensors by hybridizing an antisense oligonucleotide containing a quencher to the aptamer containing a fluorescent label. In the presence of thrombin, the binding equilibrium is shifted, the antisense oligonucleotide dissociates, and the beacon lights up. By changing the affinity of the antisense oligonucleotide for the aptamer beacon, it has proven possible to change the extent of activation of the beacon. More importantly, modulating interactions between the antisense oligonucleotide and the aptamer strongly influences the kinetics of activation. Comparisons across multiple, designed aptamer beacons indicate that there is a strong inverse correlation between the thermodynamics of hybridization and the speed of activation, a finding that should prove to be generally useful in the design of future biosensors. By pre‐organizing the thrombin‐binding quadruplex within the aptamer the speed of response can be greatly increased. By integrating these various interactions, we were ultimately able to design aptamer beacons that were activated by threefold within 1 min of the addition of thrombin. Biotechnol. Bioeng. 2009;103: 1049–1059. © 2009 Wiley Periodicals, Inc.     

A simple and sensitive resonance Rayleigh scattering method for determination of As(III) using aptamer‐modified nanogold as a probe

A simple and selective aptamer (ssDNA)‐modified nanogold probe (AussDNA) was prepared for the determination of trace As(III) in HEPES buffer solution (pH 8.2) containing 0.05 mol/L NaCl. The method coupled the aptamer reaction of AussDNA–As(III) and the resonance Rayleigh scattering (RRS) of nanogold aggregations at 278 nm. When the As(III) concentration increased, the RRS intensity at 278 nm increased to form more nanogold aggregation and a stable As(III)–ssDNA complex. Under selected conditions, the increased RRS intensity (ΔI) was linear to the concentration of As(III) in the range 3.8–230.4 ng/mL, with a detection limit of 1.9 ng/mL. This RRS method was applied to detect As(III) in water samples, with simplicity, sensitivity and selectivity. Copyright © 2013 John Wiley & Sons, Ltd.     

A validated HPLC method for the determination of dimethyl‐4,4′‐dimethoxy‐5,6,5′,6′‐dimethylene dioxybiphenyl‐2,2′‐dicarboxylate (DDB) with fluorescence detection in raw material and pill form: application to an in vitro dissolution test and a content uniformity test

A simple, sensitive and rapid HPLC method with fluorescence detection for the determination of dimethyl‐4,4′‐dimethoxy‐5,6,5′,6′‐dimethylene dioxybiphenyl‐2,2′‐dicarboxylate (DDB) in the raw material and pill form was developed. Liquid chromatography was performed on a C₁₈ column (250 × 4.6 mm i.d., 5 µm particle size), the mobile phase consisted of methanol and 0.05 M sodium dihydrogen phosphate buffer (80 : 20, v/v), and the apparent pH of the mobile phase was adjusted to 3. The fluorescence detector was operated at excitation/emission wavelengths of 275/400 nm. The proposed method allows the determination of DDB within concentration range 0.1–1.5 µg/mL with a limit of detection of 0.032 µg/mL, a limit of quantification of 0.097 µg/mL and a correlation coefficient of 0.9997. The proposed method has been successfully applied for the analysis of DDB in its pills with a percentage recovery of 98.45 ± 0.32. The method was fully validated according to ICH guidelines. Moreover, the high sensitivity of the method permits its use in an in vitro dissolution test for DDB under simulated intestinal conditions. In addition, the proposed method was extended to a content uniformity test according to USP guidelines. Copyright © 2014 John Wiley & Sons, Ltd.     

An aptamer beacon responsive to botulinum toxins

Sixty candidate DNA aptamers were developed against botulinum neurotoxin (BoNT) type A light chain (LC) from ten rounds of selection, resulting in several identical sequences. Secondary structures of the identical aptamers were compared to structures of previously reported BoNT A DNA aptamers. A series of ten candidate loop structures were selected from this comparison as potential binding pockets and aptamer beacons. These candidate beacons were synthesized with 5'-TYE 665 and 3'-Iowa Black quencher labels for comparison of fluorescence levels as a function of BoNT A LC concentration. Only three of the ten candidates exhibited any fluorescence response to increasing levels of BoNT A LC. However, of the two most responsive candidates, one represented a subset loop of the larger more intensely fluorescent double-looped structure, designated Beacon 10. This beacon yielded a lower limit of detection of 1 ng/mL in buffer using a spectrofluorometer and a portable handheld fluorometer, but also responded substantially to BoNT A, B, E holotoxins and heavy or light chain components even in a dilute soil suspension, but not in 50% human serum. Beacon 10 did not respond strongly to a variety of other divergent peptides, suggesting that it is relatively specific to the level of botulinum toxins and is only useful for environmental testing. Beacon 10 also shared short sequence segments with other published BoNT aptamer DNA sequences, suggesting that these may be points of physical contact between the aptamers and BoNTs.     

A quantum dot-aptamer beacon using a DNA intercalating dye as the FRET reporter: application to label-free thrombin detection

A new quantum dot (QD)-aptamer (apt) beacon that acts by folding-induced dissociation of a DNA intercalating dye, BOBO-3(B), is demonstrated with label-free thrombin detection. The beacon, denoted as QD-apt:B, is constructed by (1) coupling of a single-stranded thrombin aptamer to Qdot 565 via EDC/Sulfo-NHS chemistry and (2) staining the duplex regions of the aptamer on QD with excess BOBO-3 before thrombin binding. When mixing a thrombin sample with QD-apt:B, BOBO-3 is competed away from the beacon due to target-induced aptamer folding, which then causes a decrease in QD fluorescence resonance energy transfer (FRET)-mediated BOBO-3 emission and achieves thrombin quantitation. In this work, the effects of Mg(2+), coupling time, and aptamer type on the beacon's performances are investigated and discussed thoroughly with various methods, including transmission electron microscopy (TEM), dynamic light scattering (DLS), and two-color differential gel electrophoresis. Using the best aptamer beacon (HTQ37), we attain highly specific and wide-range detection (from nM to μM) of thrombin in buffer, and the beacon can sense nM-range thrombin in 15% diluted serum. Compared to the reported QD aptamer assays, our method is advantageous from the aspect of using a simple sensory unit design without losing the detection sensitivity. Therefore, we consider the QD-apt:B beacon a potential alternative to immuno-reagents and an effective tool to study nucleic acid folding on QD as well.     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Fluorescence quenching investigation on the interaction of glutathione‐CdTe/CdS quantum dots with sanguinarine and its analytical application

Water‐soluble glutathione (GSH)‐capped core/shell CdTe/CdS quantum dots (QDs) were synthesized. In pH 5.4 sodium phosphate buffer medium, the interaction between GSH‐CdTe/CdS QDs and sanguinarine (SA) was investigated by spectroscopic methods, including fluorescence spectroscopy and ultraviolet‐visible absorption spectroscopy. Addition of SA to GSH‐CdTe/CdS QDs results in fluorescence quenching of GSH‐CdTe/CdS QDs. Quenching intensity was in proportion to the concentration of SA in a certain range. Investigation of the quenching mechanism, proved that the fluorescence quenching of GSH‐CdTe/CdS QDs by SA is a result of electron transfer. Based on the quenching of the fluorescence of GSH‐CdTe/CdS QDs by SA, a novel, simple, rapid and specific method for SA determination was proposed. The detection limit for SA was 3.4 ng/mL and the quantitative determination range was 0.2–40.0 µg/mL with a correlation coefficient of 0.9988. The method has been applied to the determination of SA in synthetic samples and fresh urine samples of healthy human with satisfactory results. Copyright © 2013 John Wiley & Sons, Ltd.     

Fluorescence quenching method for the determination of carbazochrome sodium sulfonate with aromatic amino acids

In Britton‐Robinson (BR) buffer medium (pH 3.3), carbazochrome sodium sulfonate (CSS) can react with some aromatic amino acids such as tryptophan (Trp), tyrosine (Tyr) and phenylalanine (Phe) to form a 1:1 complex by electrostatic attraction, aromatic stacking interaction and Van der Waals' force, resulting in fluorescence quenching of these amino acids. Maximum quenching wavelengths were located at 352 nm (CSS‐Trp system), 303 nm (CSS‐Tyr system) and 284 nm (CSS‐Phe system), respectively. The fluorescence quenching value (ΔF) was proportional to the concentration of CSS in a certain range. The fluorescence quenching method for the determination of CSS showed high sensitivity, with detection limits of 31.3 ng/mL (CSS‐Trp system), 44.6 ng/mL (CSS‐Tyr system) and 315.0 ng/mL (CSS‐Phe system), respectively. The optimum conditions of the reaction conditions and the effect of coexisting substances were investigated and results showed that the method had good selectivity. The method was successfully applied for the rapid determination of CSS in blood and urine samples. Based on the bimolecular quenching constant K_q, the effect of temperature and Stern‐Volmer plots, this study showed that quenching of fluorescence of amino acids by CSS was a static quenching process. Copyright © 2012 John Wiley & Sons, Ltd.     

Determination of the anti‐viral drug Ribavirin in dosage forms via micelle‐enhanced spectrofluorimetric method

A simple and sensitive spectrofluorimetric method was developed for the determination of Ribavirin in pharmaceutical formulations. The proposed method was based on the fluorescence spectral behaviour of Ribavirin in a sodium dodecyl sulfate (SDS) micellar system. In an aqueous acetate buffer solution of pH 4.0, the fluorescence intensity of Ribavirin was significantly enhanced by about 217% in the presence of SDS. Fluorescence intensity was measured at 396 nm after excitation at 270 nm for Ribavirin. The fluorescence‐concentration plot was rectilinear over the range of 0.01‐3.0 µg/mL for Ribavirin with a lower detection limit of 5.02 x 10^‐3 µg/mL. The method was successfully applied to the analysis of the drug in its commercial capsules. Results were in good agreement with those obtained with the official method. The application of the proposed method was extended to stability studies of Ribavirin after exposure to different forced degradation conditions such as acidic, alkaline, photo and oxidative conditions according to ICH guidelines. Copyright © 2012 John Wiley & Sons, Ltd.     

Spectrofluorimetric determination of oseltamivir phosphate through derivatization with o‐phthalaldehyde. Application to pharmaceutical preparations with a preliminary study on spiked plasma samples

A simple and sensitive spectrofluorimetric method has been developed and validated for the determination of oseltamivir phosphate (OST) in pharmaceutical preparations. The method is based on the reaction between oseltamivir phosphate and o‐phthalaldehyde in presence of 2‐mercapto‐ethanol in borate buffer, pH 10.8, to give a highly fluorescent product measured at 450 nm after excitation at 336 nm. The different experimental parameters affecting the development and stability of the reaction product were studied and optimized. The fluorescence intensity–concentration plot is rectilinear over the range 0.05–1.0 µg/mL, with a lower detection limit of 5 ng/mL and limit of quantitation of 16 ng/mL. The developed method was successfully applied to the analysis of the drug in its commercial capsules and suspension, mean recoveries of OST were 99.97 ± 1.67% and 100.17 ± 1.18%, respectively (n = 3). Statistical comparison of the results obtained by the proposed and comparison method revealed no significant difference in the performance of the two methods regarding accuracy and precision. The proposed method was further extended to in vitro determination of the studied drug in spiked human plasma as a preliminary investigation; the mean recovery (n = 3) was 98.68 ± 5.8%. A reaction pathway was postulated. Copyright © 2012 John Wiley & Sons, Ltd.     

Simultaneous estimation of levodopa and carbidopa by RP‐HPLC using a fluorescence detector: its application to a pharmaceutical dosage form

A reverse‐phase high‐performance liquid chromatographic (RP‐HPLC) method was developed and validated for the simultaneous estimation of levodopa and carbidopa in bulk and pharmaceutical formulations. Chromatographic separation was achieved by using a C₁₈ reverse‐phase column and a mixture of an aqueous phase (10 mM potassium dihydrogen phosphate buffer, pH 4.0) and methanol (90:10 v/v) as the mobile phase. Quantitative analysis of levodopa and carbidopa was performed using a fluorescence detector at an excitation wavelength of 280 nm and an emission wavelength of 310 nm. The method was linear between 5 and 500 ng/mL for both levodopa and carbidopa. The detection limits for levodopa and carbidopa were 0.30 and 0.60 ng/mL, respectively, whereas the quantitation limit was 0.80 ng/mL for levodopa and 1.2 ng/mL for carbidopa. The method demonstrated good and consistent recoveries (99.63–100.80% for levodopa and 98.97–100.94% for carbidopa) with low interday and intraday relative standard deviation. The validated method was successfully applied to quantify levodopa and carbidopa simultaneously in a pharmaceutical formulation. The method was found to be precise, sensitive and accurate for the simultaneous determination levodopa and carbidopa in bulk and pharmaceutical formulations. Copyright © 2014 John Wiley & Sons, Ltd.     

A novel electrochemical detection method for aptamer biosensors

A beacon aptamer-based biosensor for the detection of thrombin was developed using electrochemical transduction method. Gold surface was modified with a beacon aptamer covalently linked at 5'-terminus with a linker containing a primary aliphatic amine. Methylene blue (MB) was intercalated into the beacon sequence, and used as an electrochemical marker. When the beacon aptamer immobilized on gold surface encounters thrombin, the hairpin forming beacon aptamer is conformationally changed to release the intercalated MB, resulting a decrease in electrical current intensity in voltamogram. The peak signal of the MB is clearly decreased by the binding of thrombin onto the beacon aptamer. The linear range of the signal was observed between 0 and 50.8 nM of thrombin with 0.999 correlation factor. This method was able to linearly and selectively detect thrombin with a detection limit of 11 nM.     

Determination of metformin hydrochloride using precolumn derivatization with acetaldehyde and capillary electrophoresis coupled with electrochemiluminescence

A novel method was developed using capillary electrophoresis (CE) coupled with tris(2,2′‐bipyridyl)ruthenium(II) electrogenerated chemiluminescence (ECL) for highly sensitive detection of metformin hydrochloride (MH) derivatizatized with acetaldehyde. The precolumn derivatization of MH with acetaldehyde was performed in phosphate buffer solution (0.3 mol/L, pH 7.5) at room temperature for 120 min. The effects of acetaldehyde concentration, buffer pH, electrokinetic voltage and injection time were investigated. Under optimized detection conditions, the MH ECL detection sensitivity was more than 120 times that without derivatization. The linear concentration range for MH was 0.001–15.00 μg/mL (with a correlation coefficient of 0.9992). The detection limit was 0.31 ng/mL with a signal:noise ratio of 3. The recoveries of MH in human urine were in the range 98.50–99.72%. Copyright © 2011 John Wiley & Sons, Ltd.     

Aptasensor for amplified IgE sensing based on fluorescence quenching by graphene oxide

Water‐soluble graphene oxide (GO) with a two‐dimensional layered nanostructure was synthesized and used as a quencher to construct a highly sensitive and selective fluorescence resonance energy transfer (FRET) aptasensor for sensing Immunoglobulin E (IgE). The fluorescein isothiocyanate (FITC)‐labeled aptamer could be adsorbed stably onto the surface of GO via π → π stacking interaction, which led to the occurrence of FRET from FITC to GO, and the fluorescence of FITC‐labeled aptamer was quenched by GO via energy transfer. In the presence of IgE, the fluorescence was recovered due to a higher affinity between the aptamer and IgE compared with interactions between GO and the aptamer, leading to a high signal‐to‐background ratio. The fluorescence intensity of the aptamer increased in proportion to the amount of IgE in the sample,so that IgE could be detected with a linear range of 60–225 pM and a detection limit of 22 pM. The assay was highly selective because the aptamer was unaffected by the presence of immunoglobulin G (IgG), human serum albumin (HSA) and bovine serum albumin (BSA). The practical application of the proposed aptasensor was successfully carried out for the determination of IgE in human serum samples. Copyright © 2012 John Wiley & Sons, Ltd.     

Graphene oxide based fluorescent aptasensor for adenosine deaminase detection using adenosine as the substrate

We present a novel fluorescent aptasensor for simple and accurate detection of adenosine deaminase (ADA) activity and inhibition on the basis of graphene oxide (GO) using adenosine (AD) as the substrate. This aptasensor consists of a dye-labeled single-stranded AD specific aptamer, GO and AD. The fluorescence intensity of the dye-labeled AD specific aptamer is quenched very efficiently by GO as a result of strong π-π stacking interaction and excellent electronic transference of GO. In the presence of AD, the fluorescence of the GO-based probe is recovered since the competitive binding of AD and GO with the dye-labeled aptamer prevents the adsorption of dye-labeled aptamer on GO. When ADA was introduced to this GO-based probe solution, the fluorescence of the probe was quenched owing to ADA can convert AD into inosine which has no affinity to the dye-labeled aptamer, thus allowing quantitative investigation of ADA activity. The as-proposed sensor is highly selective and sensitive for the assay of ADA activity with a detection limit of 0.0129U/mL in clean buffer, which is more than one order of magnitude lower than the previous reports. Meanwhile, a good linear relationship with the correlation coefficient of R=0.9922 was obtained by testing 5% human serum containing a series of concentrations of ADA. Additionally, the inhibition effect of erythro-9-(2-hydroxy-3-nonyl) adenine on ADA activity was investigated in this design. The GO-based fluorescence aptasensor not only provides a simple, cost-effective and sensitive platform for the detection of ADA and its inhibitor but also shows great potential in the diagnosis of ADA-relevant diseases and drug development.     

An aptamer based resonance light scattering assay of prostate specific antigen

Prostate specific antigen (PSA) is a valuable tumor marker for prostate cancer screening. In this work, a novel and sensitive resonance light scattering (RLS) spectral assay of PSA was proposed based on PSA aptamer modified gold nanoparticles (AuNPs). The sulfhydryl modified single-strand aptamer could interact with AuNPs, which made the AuNPs stable in high concentration of salt. In pH 7.0 BR buffer solution, the highly selective combination of PSA and AuNPs-labeling aptamer resulted in the aggregation of AuNPs which showed high RLS intensity. Under the optimal conditions, the magnitude of enhanced RLS intensity (ΔI(RLS)) was proportional to the concentration of PSA in the range from 0.13 to 110 ng/mL, with a detection limit (LOD, 3σ) of 0.032 ng/mL. This developed RLS assay as well as a commercially available enzyme-linked immunosorbent assay (ELISA) kit was successfully applied to the detection of PSA in 15 serum samples, and an excellent correlation of the levels of PSA measured was obtained. This is the first report of the aptamer based RLS assay for PSA and it is also a significant application of instrumental analysis technique.     

Micelle‐enhanced spectrofluorimetric determination of amlexanox in bioadhesive buccal tablets: application to content uniformity testing

A highly sensitive, simple and rapid spectrofluorimetric method was developed for the determination of Amlexanox (AMX) in its bioadhesive buccal tablets. The proposed method is based on measuring the native fluorescence of the methanolic solution of AMX at 400 nm after excitation at 242 nm in 0.2 M borate buffer (pH 10) and 0.5% w/v sodium dodecyl sulfate (SDS) solution. The interaction of AMX with SDS was studied, and the enhanced fluorescence intensity was exploited to develop an assay method for the determination of AMX. The relative fluorescence intensity–concentration plot was rectilinear over the range 5.0–80.0 ng/mL, with a lower detection limit of 0.57 ng/mL and a lower quantification limit of 1.74 ng/mL. The proposed method was successfully applied to the analysis of AMX in its commercial tablets. Moreover, content uniformity testing was conducted by applying official USP guidelines. Statistical evaluation and comparison of the data obtained using the proposed and comparison methods revealed good accuracy and precision for the proposed method. Copyright © 2015 John Wiley & Sons, Ltd.     

Utility of eosin Y as a complexing reagent for the determination of citalopram hydrobromide in commercial dosage forms by fluorescence spectrophotometry

An accurate, selective and sensitive spectrofluorimetric method was developed for the determination of citalopram hydrobromide in commercial dosage forms. The method was based on the formation of a fluorescent ion‐pair complex between citalopram hydrobromide and eosin Y in the presence of a disodium hydrogen phosphate/citric acid buffer solution of pH 3.4 that was extractable in dichloromethane. The extracted complex showed fluorescence intensity at λ_em = 554 nm after excitation at 259 nm. The calibration curve was linear over at concentrations of 2.0–26.0 µg/mL. Under optimized experimental conditions, the proposed method was validated as per ICH guidelines. The effect of common excipients used as additives was tested and the tolerance limit calculated. The limit of detection for the proposed method was 0.121 μg/mL. The proposed method was successfully applied to the determination of citalopram hydrobromide in commercial dosage forms. The results were compared with the reference RP‐HPLC method. Copyright © 2015 John Wiley & Sons, Ltd.