Synthesis and growth inhibition activity of alpha-bromoacrylic heterocyclic and benzoheterocyclic derivatives of distamycin A modified on the amidino moiety

The design, synthesis and in vitro activities of novel alpha-bromoacryloyl pyrazole, imidazole and benzoheterocyclic derivatives of distamycin A, in which the amidino moiety has been replaced by moieties of different physico-chemical features are described, and the structure-activity relationships are discussed. In spite of the relevance of these modifications on the distamycin frame, these derivatives showed significant growth inhibitory activity against mouse leukemia L1210 cells. Therefore, the presence of the amidino moiety, and in general of a basic moiety, is not an absolute requirement for biological activity of alpha-bromoacrylic derivatives of distamycin.     

Cinnamoyl nitrogen mustard derivatives of pyrazole analogues of tallimustine modified at the amidino moiety: design, synthesis, molecular modeling and antitumor activity studies

The design, synthesis and in vitro activities of a series of cinnamoyl nitrogen mustard pyrazole analogues of tallimustine 8-13, in which the amidino moiety has been replaced by moieties of different physico-chemical features are described, and the structure-activity relationships are discussed. In spite of the relevance of these modifications on the amidino moiety, these derivatives showed significant growth inhibitory activity against mouse leukemia L1210 cells. A selected series of compounds have been evaluated for their sequence selective alkylating properties and cytotoxicity against human K562 leukemia cells. Therefore, the presence of the amidino moiety, and in general of a basic moiety, is not an absolute requirement for biological activity. Our preliminary results indicated that the compounds of this series have a pattern of alkylation similar to that of tallimustine, but they seem to be less reactive overall in alkylating naked DNA.     

Cytotoxic alpha-bromoacrylic derivatives of low molecular weight

In vitro and in vivo activities of a small series of alpha-bromoacrylic derivatives of low molecular weight (MW) are described and compared with those of alpha-bromoacrylic derivatives of distamycin-like frames. Low MW compounds, when lacking of a strong basic moiety, are potent cytotoxics, while analogues bearing a strong basic moiety are not. This suggests the existence of an active transport mechanism for distamycin-derived cytotoxics characterized by strong basic amidino or guanidino moieties. Low MW compounds are inactive in vivo, possibly because of the metabolic lability of alpha-bromoacrylic moiety. The same moiety is however present in a series of potent anticancer distamycin-like minor groove binders, for example, PNU-166196 (brostallicin), a fact that underlines the features of the latter.     

Cytotoxicity, cellular uptake and DNA damage by daunorubicin and its new analogues with modified daunosamine moiety

Daunorubicin (DRB) and its two analogues containing a trisubstituted amidino group at the C-3′ position of the daunosamine moiety have been compared regarding their cytotoxic activity, cellular uptake, subcellular localization and DNA damaging properties. An analogue containing in the amidino group a morpholine moiety (DRBM) as well as an analogue with a hexamethyleneimine moiety (DRBH), tested against cultured L1210 cells, exhibited lower cytotoxicity then DRB. The decrease of cytotoxic activity was not related to cellular uptake and subcellular localization of drugs. Although all tested drugs were active in the induction of DNA breaks and DNA–protein crosslinks, they differed in the mechanism of induction of DNA lesions. DRB produced DNA breaks mediated solely by topoisomerase II, whereas DRBM and DRBH induced two types of DNA breaks by two separate processes. The first is related to the inhibition of topoisomerase II and the second presumably reflects a covalent binding of drug metabolites to DNA. It is hypothesized that the replacement of the primary amino group (–NH₂) at the C-3′ position of the daunosamine moiety by a trisubstituted amidino group (–N=CH–NRR) may be a route to the synthesis of anthracycline derivatives with enhanced ability to form covalent adducts to DNA.     

Novel benzoyl nitrogen mustard derivatives of pyrazole analogues of distamycin A: synthesis and antileukemic activity

The design and synthesis of novel benzoic acid mustard (BAM) derivatives of distamycin A bearing one or more pyrazole rings replacing the pyrrole rings of the latter are described. In vitro and in vivo activities against L1210 leukemia are reported and discussed. Some of these compounds show an activity profile comparable to tallimustine 1. All the compounds bearing the pyrazole ring close to the BAM moiety show reduced cytotoxicity in comparison to derivatives characterized by the BAM linked to a pyrrole: the same effect has not been observed when occurring at the amidine terminus of the oligopeptidic frame.     

Cytotoxic halogenoacrylic derivatives of distamycin A

The design, synthesis, in vitro and in vivo activities of a series of halogenoacrylic derivatives of distamycin A are described. The structure-activity relationships indicate a key role of the reactivity of alpha-halogenoacrylic moiety. The reactivity and the putative alkylating mechanism of these compounds are different from those of the nitrogen mustards and possibly based on a Michael type reaction. This supports the hypothesis that these compounds represent a class of minor groove binders mechanistically different from tallimustine.     

Conformational analysis of site-specific DNA cross-links of cisplatin-distamycin conjugates

The requirement for novel platinum antitumor drugs led to the concept of synthesis of novel platinum drugs based on targeting cisplatin to various carrier molecules. We have shown [Loskotova, H., and Brabec, V. (1999) Eur. J. Biochem. 266, 392-402] that attachment of DNA minor-groove-binder distamycin to cisplatin changes several features of DNA-binding mode of the parent platinum drug. Major differences comprise different conformational changes in DNA and a considerably higher interstrand cross-linking efficiency. The studies of the present work have been directed to the analysis of oligodeoxyribonucleotide duplexes containing single, site-specific adducts of platinum-distamycin conjugates. These uniquely modified duplexes were analyzed by Maxam-Gilbert footprinting, phase-sensitive gel electrophoresis bending assay and chemical probes of DNA conformation. The results have indicated that the attachment of distamycin to cisplatin mainly affects the sites involved in the interstrand cross-links so that these adducts are preferentially formed between complementary guanine and cytosine residues. This interstrand cross-link bends the helix axis by approximately 35 degrees toward minor groove, unwinds DNA by approximately 95 degrees and distorts DNA symmetrically around the adduct. In addition, CD spectra of restriction fragments modified by the cisplatin-distamycin conjugates have demonstrated that distamycin moiety in the interstrand cross-links of these compounds interacts with DNA. This interaction facilitates the formation of these adducts. Hence, the structural impact of the specific interstrand cross-link detected in this study deserves attention when biological behavior of cisplatin derivatives targeted by oligopeptide DNA minor-groove-binders is evaluated.     

DNA interaction with low molecular weight ligands of different structure. III. DNA complexes with distactins

The DNA complexes with distactins have been investigated by means of spectrophotometry, viscosimetry and flow birefringence methods. The distactins are actinocin's derivatives containing in the 1,9 positions of the phenoxazone moiety oligopyrrolcarboxamide groups (like those of distamycin A), which have from one to three fragments of 1-methyl-4-amino-2-pyrrolic acid. The mode of DNA-distactins binding in water solution depends on the quantity of the methylpyrrole rings in the oligopeptide groups. The ligand with oligopeptide groups containing three methylpyrrole rings joins the DNA double helix only from outside by means of oligopeptide groups. The compounds with one and two methylpyrrole rings form two kinds of complexes with DNA: external binding and intercalation. In the latter case both chromophore and methylpyrrole fragments, interact with DNA.     

Distamycin A and derivatives as synergic drugs in cisplatin-sensitive and -resistant ovarian cancer cells

Acquired resistance to cisplatin (cDDP) is a multifactorial process that represents one of the main problems in ovarian cancer therapy. Distamycin A is a minor groove DNA binder whose toxicity has limited its use and prompted the synthesis of derivatives such as NAX001 and NAX002, which have a carbamoyl moiety and different numbers of pyrrolamidine groups. Their interaction with a B-DNA model and with an extended-TATA box model, [Polyd(AT)], was investigated using isothermal titration calorimetry (ITC) to better understand their mechanism of interaction with DNA and therefore better explain their cellular effects. Distamycin A interactions with Dickerson and Poly[d(AT)(6)] oligonucleotides show a different thermodynamic with respect to NAX002. The bulkier distamycin A analogue shows a non optimal binding to DNA due to its additional pyrrolamidine group. Cellular assays performed on cDDP-sensitive and -resistant cells showed that these compounds, distamycin A in particular, affect the expression of folate cycle enzymes even at cellular level. The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound. These effects seem differently modulated by the cDDP-resistance phenotype. NAX002 which presents a lower affinity to DNA and slightly affected these enzymes, showed a synergic inhibition profile in combination with cDDP. In addition, their combination with cDDP or polyamine analogues increased cell sensitivity to the drugs suggesting that these interactions may have potential for development in the treatment of ovarian carcinoma.     

An unexpected major groove binding of netropsin and distamycin A to tRNA(phe)

Crystalline complexes of yeast tRNA(phe) and the oligopeptide antibiotics netropsin and distamycin A were prepared by diffusing drugs into crystals of tRNA. X-ray structure analyses of these complexes reveal a single common binding site for both drugs which is located in the major or deep groove of the tRNA T-stem. The netropsin-tRNA complex is stabilized by specific hydrogen bonds between the amide groups of the drug and the tRNA bases G51 O(6), U52 O(4) and G53 N(7) on one strand, and is further stabilized by electrostatic interactions between the positively charges guanidino side chain of the drug and the tRNA phosphate P53 on the same strand and the positively charged amidino propyl side chain and the phosphates P61, P62 and P63 on the opposite strand of the double helix. These results are in contrast to the implicated minor groove binding of these drugs to non-guanine sequences in DNA. The binding to the GUG sequence in tRNA implies that major groove binding to certain DNA sequences is possible.     

Recognition of the DNA minor groove by pyrrole-imidazole polyamides: comparison of desmethyl- and N-methylpyrrole

Polyamides consisting of N-methylpyrrole (Py), N-methylimidazole (Im), and N-methyl-3-hydroxypyrrole (Hp) are synthetic ligands that recognize predetermined DNA sequences with affinities and specificities comparable to many DNA-binding proteins. As derivatives of the natural products distamycin and netropsin, Py/Im/Hp polyamides have retained the N-methyl substituent, although structural studies of polyamide:DNA complexes have not revealed an obvious function for the N-methyl. In order to assess the role of the N-methyl moiety in polyamide:DNA recognition, a new monomer, desmethylpyrrole (Ds), where the N-methyl moiety has been replaced with hydrogen, was incorporated into an eight-ring hairpin polyamide by solid-phase synthesis. MPE footprinting, affinity cleavage, and quantitative DNase I footprinting revealed that replacement of each Py residue with Ds resulted in identical binding site size and orientation and similar binding affinity for the six-base-pair (bp) target DNA sequence. Remarkably, the Ds-containing polyamide exhibited an 8-fold loss in specificity for the match site versus a mismatched DNA site, relative to the all-Py parent. Polyamides with Ds exhibit increased water solubility, which may alter the cell membrane permeability properties of the polyamide. The addition of Ds to the repertoire of available monomers may prove useful as polyamides are applied to gene regulation in vivo. However, the benefits of Ds incorporation must be balanced with a potential loss in specificity.     

Minor groove to major groove, an unusual DNA sequence-dependent change in bend directionality by a distamycin dimer

DNA sequence-dependent conformational changes induced by the minor groove binder, distamycin, have been evaluated by polyacrylamide gel electrophoresis. The distamycin binding affinity, cooperativity, and stoichiometry with three target DNA sequences that have different sizes of alternating AT sites, ATAT, ATATA, and ATATAT, have been determined by mass spectrometry and surface plasmon resonance to help explain the conformational changes. The results show that distamycin binds strongly to and bends five or six AT base pair minor groove sites as a dimer with positive cooperativity, while it binds to ATAT as a weak, slightly anticooperative dimer. The bending direction was evaluated with an in phase A-tract reference sequence. Unlike other similar monomer minor groove binding compounds, such as netropsin, the distamycin dimer changes the directionality of the overall curvature away from the minor groove to the major groove. This distinct structural effect may allow designed distamycin derivatives to have selective therapeutic effects.     

Distamycin-induced inhibition of homeodomain-DNA complexes.

The mobility shift assay was used to study the competition of the minor groove binder distamycin A with either an Antennapedia homeodomain (Antp HD) peptide or derivatives of a fushi tarazu homeodomain (ftz HD) peptide for their AT-rich DNA binding site. The results show that distamycin and the homeodomain peptides compete under the conditions: (i) preincubation of DNA with distamycin and subsequent addition of HD peptide; (ii) simultaneous incubation of DNA with distamycin and HD peptide; and (iii) preincubation of DNA with HD peptide and subsequent addition of distamycin. There is also competition when using a peptide which lacks the N-terminal arm of ftz HD that is involved in contacts in the minor groove. It is proposed that the protein's binding affinity is diminished by distamycin-induced conformational changes of the DNA. The feasibility of the propagation of conformational changes upon binding in the minor groove is also shown for the inhibition of restriction endonucleases differing in the AT content of their recognition site and of their flanking DNA sequences. Thus, it is demonstrated that minor groove binders can compete with the binding of proteins in the major groove, providing an experimental indication for the influence of biological activities exerted by DNA ligands binding in the minor groove.     

Liposomes- and ethosomes-associated distamycins: a comparative study

The present article describes a comparative study of the performances of liposomes and ethosomes as specialized delivery systems for distamycin A (DA) and two of its derivatives. Liposomes and ethosomes were prepared by classical methods, extruded through polycarbonate filters, and characterized in terms of dimensions, morphology, and encapsulation efficiency. It was found that DA was associated with vesicles (either liposomes or ethosomes) by around 16.0%, while both derivatives of DA showed a percentage of association around 80% in the case of liposomes and around 50% in the case of ethosomes. In vitro antiproliferative activity experiments performed on cultured human and mouse leukemic cells demonstrated that vesicles were able to increase the activity of both derivatives of DA. In addition, it was demonstrated that the aging of both liposomes- and ethosomes-associated distamycin suspensions did not heavily influence the vesicle size, while all samples showed a relevant drug leakage with time. Moreover, according to the different physicochemical characteristics of DA and its derivatives (i.e., log P), vesicle-associated DA showed the highest loss of drug with respect to both its derivatives. In conclusion, the enhancement of drug activity expressed by these specialized delivery systems-associated DD could be interesting to obtain an efficient therapeutic effect aimed at reducing or minimizing toxic effects occurring with distamycins administration.     

An Unexpected Major Groove Binding of Netropsin and Distamycin A to tRNAphe

Abstract

Crystalline complexes of yeast tRNA^phe and the oligopeptide antibiotics netropsin and distamycin A were prepared by diffusing drugs into crystals of tRNA. X-ray structure analyses of these complexes reveal a single common binding site for both drugs which is located in the major or deep groove of the tRNA T-stem. The netropsin-tRNA complex is stabilized by specific hydrogen bonds between the amide groups of the drug and the tRNA bases G51 0(6), U52 0(4) and G53 N(7) on one strand, and is further stabilized by electrostatic interactions between the positively charges guanidino side chain of the drug and the tRNA phosphate P53 on the same strand and the positively charged amidino propyl side chain and the phosphates P61, P62 and P63 on the opposite strand of the double helix. These results are in contrast to the implicated minor groove binding of these drugs to non-guanine sequences in DNA. The binding to the GUG sequence in tRNA implies that major groove binding to certain DNA sequences is possible.     

Synthesis of morpholine derivatives using the Castagnoli-Cushman reaction as BACE1 inhibitors: Unexpected binding activity of cyclic thioamides

The Castagnoli-Cushman reaction between diglycolic anhydride and imines was applied for the synthesis of morpholine derivatives containing a thioamide or an amidino group. Enzyme inhibition assays towards BACE1 revealed an unexpected role of the cyclic thioamide group in providing inhibition in the micromolar range. Molecular docking calculations showed the thioamido group interacting with catalytic aspartic acid, and calculated BBB permeability indicated this molecular scaffold as a promising hit for further optimization.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

GRIND2-based 3D-QSAR and prediction of activity spectra for symmetrical bis-pyridinium salts with promastigote antileishmanial activity

Leishmaniasis is a major group of neglected tropical diseases caused by the protozoan parasite Leishmania. About 12 million people are affected in 98 countries and 350 million people worldwide are at risk of infection. Current leishmaniasis treatments rely on a relatively small arsenal of drugs, including amphotericin B, pentamidine and others, which in general have some type of inconvenience. Recently, we have synthesized antileishmanial bis-pyridinium derivatives and symmetrical bis-pyridinium cyclophanes. These compounds are considered structural analogues of pentamidine, where the amidino moiety, protonated at physiological pH, is replaced by a positively charged nitrogen atom as a pyridinium ring. In this work, a statistically significant GRIND2-based 3D-QSAR model was built and biological activity predictions were in silico carried out allowing rationalization of the different activities recently obtained against Leishmania donovani (in L. donovani promastigotes) for a data set of 19 bis-pyridinium compounds. We will emphasize the most important structural requirements to improve the biological activity and probable interactions with the biological receptor as a guide for lead and prototype optimization. In addition, since no information about the actual biological target for this series of active compounds is provided, we have used Prediction of Activity Spectra for Biologically Active Substances to propose our compounds as potential nicotinic α6β3β4α5 receptor antagonists. This proposal is reinforced by the high structural similarity observed between our compounds and several anthelmintic drugs in current clinical use, which have the same drug action mechanism here predicted. Such new findings would be confirmed with further and additional experimental assays.     

CP5484, a novel quaternary carbapenem with potent anti-MRSA activity and reduced toxicity

A new series of 1beta-methyl carbapenems possessing a 6,7-disubstituted imidazo[5,1-b]thiazol-2-yl group directly attached to the C-2 position of the carbapenem nucleus was prepared, and the activities of these compounds against methicillin-resistant Staphylococcus aureus (MRSA) were evaluated. To study the effect of basic moieties on anti-MRSA activity, we introduced an amino, or imino, or amidino group at the 6-position of imidazo[5,1-b]thiazole in place of the carbamoylmethyl moiety of CP5068. Anti-MRSA activities of almost all basic group-substituted carbapenems were improved, though some of the compounds showed stronger acute toxicity in mice than IPM. In order to decrease the toxicity without decreasing the activity, we introduced various additional functionalities around the basic moiety. Finally, we obtained CP5484, which has excellent anti-MRSA activity and low acute toxicity.