Inhibition of Mycobacterium smegmatis topoisomerase I by specific oligonucleotides

DNA topoisomerase I from Mycobacterium smegmatis unlike many other type I topoisomerases is a site specific DNA binding protein. We have investigated the sequence specific DNA binding characteristics of the enzyme using specific oligonucleotides of varied length. DNA binding, oligonucleotide competition and covalent complex assays show that the substrate length requirement for interaction is much longer ( approximately 20 nucleotides) in contrast to short length substrates (eight nucleotides) reported for Escherichia coli topoisomerase I and III. P1 nuclease and KMnO(4) footprinting experiments indicate a large protected region spanning about 20 nucleotides upstream and 2-3 nucleotides downstream of the cleavage site. Binding characteristics indicate that the enzyme interacts efficiently with both single-stranded and double-stranded substrates containing strong topoisomerase I sites (STS), a unique property not shared by any other type I topoisomerase. The oligonucleotides containing STS effectively inhibit the M. smegmatis topoisomerase I DNA relaxation activity.     

Site-specific interaction of vaccinia virus topoisomerase I with duplex DNA. Minimal DNA substrate for strand cleavage in vitro.

Purified vaccinia virus DNA topoisomerase I forms a cleavable complex with duplex DNA at a conserved sequence element 5'(C/T)CCTTdecreases in the incised DNA strand. DNase I footprint studies show that vaccinia topoisomerase protects the region around the site of covalent adduct formation from nuclease digestion. On the cleaved DNA strand, the protected region extends from +13 to -13 (+1 being the site of cleavage). On the noncleaved strand, the protected region extends from +13 to -9. Similar nuclease protection is observed for a mutant topoisomerase (containing a Tyr ---- Phe substitution at the active site amino acid 274) that is catalytically inert and does not form the covalent intermediate. Thus, vaccinia topoisomerase is a specific DNA binding protein independent of its competence in transesterification. By studying the cleavage of a series of 12-mer DNA duplexes in which the position of the CCCTTdecreases motif within the substrate is systematically phased, the "minimal" substrate for cleavage has been defined; cleavage requires six nucleotides upstream of the cleavage site and two nucleotides downstream of the site. An analysis of the cleavage of oligomer substrates mutated singly in the CCCTT sequence reveals a hierarchy of mutational effects based on position within the pentamer motif and the nature of the sequence alteration.     

Transfection of Mycobacterium smegmatis SN2 with mycobacteriophage I3 DNA

Mycobacterium smegmatis SN2 does not exhibit natural competence for the uptake of phage I3 DNA. Competence can artificially be induced by treatment with glycine or CaCl₂, and the combination of both is even more effective. The efficiency of transfection can be improved by inclusion of protamine sulphate and heterologous RNA in the system. From ³²P DNA uptake studies the major barrier for the entry of DNA has been found to be the complex cell wall. The efficiency of transfection calculated on the basis of fraction of DNA which has entered the cell is comparable to that of other bacterial systems. The phage development takes a longer time (7 h for one cycle) after transfection, as compared to infection (4 h).     

Requirements for noncovalent binding of vaccinia topoisomerase I to duplex DNA.

Vaccinia DNA topoisomerase binds duplex DNA and forms a covalent adduct at sites containing a conserved sequence element 5'(C/T)CCTT decreases in the scissile strand. Distinctive aspects of noncovalent versus covalent interaction emerge from analysis of the binding properties of Topo(Phe-274), a mutated protein which is unable to cleave DNA, but which binds DNA noncovalently. Whereas DNA cleavage by wild type enzyme is most efficient with 'suicide' substrates containing fewer than 10 base pairs distal to the scissile bond, optimal noncovalent binding by Topo(Phe-274) requires at least 10-bp of DNA 3' of the cleavage site. Thus, the region of DNA flanking the pentamer motif serves to stabilize the noncovalent topoisomerase-DNA complex. This result is consistent with the downstream dimensions of the DNA binding site deduced from nuclease footprinting. Topo(Phe-274) binds to duplex DNA lacking the consensus pentamer with 7-10-fold lower affinity than to CCCTT-containing DNA.     

Physical and functional interaction between D-ribokinase and topoisomerase I has opposite effects on their respective activity in Mycobacterium smegmatis and Mycobacterium tuberculosis

d-ribose is an essential component of multiple important biological molecules and must first be phosphorylated by ribokinase before entering metabolic pathways. However, the function and regulation of ribokinases in Mycobacterium tuberculosis, the causative agent of tuberculosis, and its related species are largely unknown. In this study, we have characterized the activities of two putative ribokinases, Rv2436 and Ms4585, from M. tuberculosis and Mycobacterium smegmatis, respectively. The mycobacterial topoisomerase I (TopA) was found to physically interact with its ribokinase both in vitro and in vivo. By creating two ribokinase mutants that showed defective interactions with TopA, we further showed that the interaction between ribokinase and TopA had opposite effects on their respective function. While the interaction between the two proteins inhibited the ability of TopA to relax supercoiled DNA, it stimulated ribokinase activity. A cross-regulation assay revealed that the interaction between the two proteins was conserved in the two mycobacterial species. Thus, we uncovered an interplay between ribokinase and topoisomerase I in mycobacteria, which implies the existence of a novel regulatory strategy for efficient utilization of d-ribose in M. tuberculosis that may be useful in stressful environments with restricted access to nutrients.     

Determination of the recognition sequence of Mycobacterium smegmatis topoisomerase I on mycobacterial genomic sequences

Mycobacterium smegmatis topoisomerase I has several distinctive features. The absence of the zinc finger motif found in other prokaryotic type I topoisomerases and the ability of the enzyme to recognise single-stranded and duplex DNA are unique characteristics of the enzyme. We have mapped the strong topoisomerase sites of the enzyme on genomic DNA sequences from Mycobacterium tuberculosis and M.smegmatis. The enzyme does not nick DNA in random fashion and DNA cleavage occurred at a few specific sites. Mapping of these sites revealed conservation of a pentanucleotide motif CG/TCT↓T at the cleavage site (↓ represents the cleavage site). The enzyme binds and cleaves consensus oligonucleotides having this sequence motif. The protein exhibits a very high preference for C or a G residue at the +2 position with respect to the cleavage site. Based on earlier and the present studies we propose that the enzyme functions in vivo mainly at these specific sites to carry out topological reactions.     

Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage

Bacterial and archaeal topoisomerase I display selectivity for a cytosine base 4 nt upstream from the DNA cleavage site. Recently, the solved crystal structure of Escherichia coli topoisomerase I covalently linked to a single-stranded oligonucleotide revealed that R169 and R173 interact with the cytosine base at the −4 position via hydrogen bonds while the phenol ring of Y177 wedges between the bases at the −4 and the −5 position. Substituting R169 to alanine changed the selectivity of the enzyme for the base at the −4 position from a cytosine to an adenine. The R173A mutant displayed similar sequence selectivity as the wild-type enzyme, but weaker cleavage and relaxation activity. Mutation of Y177 to serine or alanine rendered the enzyme inactive. Although mutation of each of these residues led to different outcomes, R169, R173 and Y177 work together to interact with a cytosine base at the −4 position to facilitate DNA cleavage. These strictly conserved residues might act after initial substrate binding as a Molecular Ruler to form a protein–DNA complex with the scissile phosphate positioned at the active site for optimal DNA cleavage by the tyrosine hydroxyl nucleophile to facilitate DNA cleavage in the reaction pathway.     

Intramolecular synapsis of duplex DNA by vaccinia topoisomerase.

Complexes formed by vaccinia topoisomerase I on plasmid DNA were visualized by electron microscopy. The enzyme formed intramolecular loop structures in which non-contiguous DNA segments were synapsed within filamentous protein stems. At high enzyme concentrations the DNA appeared to be zipped up within the protein filaments such that the duplex was folded back on itself. Formation of loops and filaments was also observed with an active site mutant, Topo-Phe274. Binding of Topo-Phe274 to relaxed DNA circles in solution introduced torsional strain, which, after relaxation by catalytic amounts of wild-type topo-isomerase, resulted in acquisition of negative supercoils. We surmise that the topoisomerase-DNA complex is a plectonemic supercoil in which the two duplexes encompassed by the protein filaments are interwound in a right handed helix. We suggest that topoisomerase-mediated DNA synapsis plays a role in viral recombination and in packaging of the 200 kbp vaccinia genome during virus assembly.     

An atypical type II topoisomerase from Mycobacterium smegmatis with positive supercoiling activity

Topoisomerases are essential ubiquitous enzymes, falling into two distinct classes. A number of eubacteria including Escherichia coli, typically contain four topoisomerases, two type I topoisomerases and two type II topoisomerases viz. DNA gyrase and topoisomerase IV. In contrast several other bacterial genomes including mycobacteria, encode for one type I topoisomerase and a DNA gyrase. Here we describe a new type II topoisomerase from Mycobacterium smegmatis which is different from DNA gyrase or topoisomerase IV in its characteristics and origin. The topoisomerase is distinct with respect to domain organization, properties and drug sensitivity. The enzyme catalyses relaxation of negatively supercoiled DNA in an ATP-dependent manner and also introduces positive supercoils to both relaxed and negatively supercoiled substrates. The genes for this additional topoisomerase are not found in other sequenced mycobacterial genomes and may represent a distant lineage.     

ATP-dependent DNA topoisomerase from D. melanogaster reversibly catenates duplex DNA rings

Extracts of Drosophila embryos contain an enzymatic activity that converts circular DNAs into huge networks of catenated rings in an ATP-dependent fashion. The catenation activity is resolved into two protein components during purification. One component is a novel DNA topoisomerase that requires the presence of ATP in order to relax supercoiled DNA. We have shown that the ATP-dependent DNA topoisomerase relaxes DNA by a mechanism distinct from that of nicking-closing enzymes. The Drosophila ATP-dependent topoisomerase allows one segment of a circular DNA to pass through transient breaks in both strands at another site on the DNA circle without any relative rotation between the ends at the transient break. This mechanism can convert negative supertwists to positive twists and vice versa until a relaxed equilibrium state is reached. The formation of catenated rings is mediated by an analogous bimolecular reaction which can occur between two nonhomologous DNA circles. The catenation reaction is fully reversible: in the presence of the second protein component, circular DNA is converted quantitatively into catenated forms; in its absence, the ATP-dependent topoisomerase resolves catenated networks back into monomer circles. The Drosophila ATP-dependent topoisomerase appears to be closely related to E. coli DNA gyrase in that both use a similar mechanism to change the topology of DNA, both require ATP and both are inhibited by the antibiotic novobiocin. The presence of an enzyme that allows one DNA helix to pass freely through another could not only be useful in relaxation of topological constraints, but also may be involved in the folding and unfolding of eucaryotic chromosomes.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Characterization of a conserved interaction between DNA glycosylase and ParA in Mycobacterium smegmatis and M. tuberculosis

The chromosome partitioning proteins, ParAB, ensure accurate segregation of genetic materials into daughter cells and most bacterial species contain their homologs. However, little is known about the regulation of ParAB proteins. In this study, we found that 3-methyladenine DNA glycosylase I MsTAG(Ms5082) regulates bacterial growth and cell morphology by directly interacting with MsParA (Ms6939) and inhibiting its ATPase activity in Mycobacterium smegmatis. Using bacterial two-hybrid and pull-down techniques in combination with co-immunoprecipitation assays, we show that MsTAG physically interacts with MsParA both in vitro and in vivo. Expression of MsTAG under conditions of DNA damage induction exhibited similar inhibition of growth as the deletion of the parA gene in M. smegmatis. Further, the effect of MsTAG on mycobacterial growth was found to be independent of its DNA glycosylase activity, and to result instead from direct inhibition of the ATPase activity of MsParA. Co-expression of these two proteins could counteract the growth defect phenotypes observed in strains overexpressing MsTAG alone in response to DNA damage induction. Based on protein co-expression and fluorescent co-localization assays, MsParA and MsTAG were further found to co-localize in mycobacterial cells. In addition, the interaction between the DNA glycosylase and ParA, and the regulation of ParA by the glycosylase were conserved in M. tuberculosis and M. smegmatis. Our findings provide important new insights into the regulatory mechanism of cell growth and division in mycobacteria.     

Conjugal transfer of chromosomal DNA in Mycobacterium smegmatis

The genus Mycobacterium includes the major human pathogens Mycobacterium tuberculosis and Mycobacterium leprae . The development of rational drug treatments for the diseases caused by these and other mycobacteria requires the establishment of basic molecular techniques to determine the genetic basis of pathogenesis and drug resistance. To date, the ability to manipulate and move DNA between mycobacterial strains has relied on the processes of transformation and transduction. Here, we describe a naturally occurring conjugation system present in Mycobacterium smegmatis , which we anticipate will further facilitate the ability to manipulate the mycobacterial genome. Our data rule out transduction and transformation as possible mechanisms of gene transfer in this system and are most consistent with conjugal transfer. We show that recombinants are not the result of cell fusion and that transfer occurs from a distinct donor to a recipient. One of the donor strains is mc²155, a highly transformable derivative that is considered the prototype laboratory strain for mycobacterial genetics; the demonstration that it is conjugative should increase its genetic manipulability dramatically. During conjugation, extensive regions of chromosomal DNA are transferred into the recipient and then integrated into the recipient chromosome by multiple recombination events. We propose that DNA transfer is occurring by a mechanism similar to Hfr conjugation in Escherichia coli .     

Interactions between eukaryotic DNA topoisomerase I and a specific binding sequence

The interaction between eukaryotic DNA topoisomerase I and a high affinity binding sequence was investigated. Quantitative footprint analysis demonstrated that the substrate preference results from strong specific binding of topoisomerase I to the sequence. The specificity was conferred by a tight noncovalent association between the enzyme and its target DNA, whereas the transient formation of a covalently bound enzyme.nicked DNA intermediate contributed insignificantly to the overall affinity. Topoisomerase I protected both strands over a 20-base pair region in which the cleavage site was centrally located. DNA modification interference analysis revealed a 16-base pair interference region on the scissile strand. Essential bases were confined to the 5' side of the cleavage site. The 6-base pair interference region observed on the complementary strand did not contain essential bases.     

Amylooligosaccharides from Mycobacterium smegmatis.

In early stationary phase of growth, Mycobacterium smegmatis cultures accumulate amylooligosaccharides (alpha 1 leads to 4-glucooligosaccharides) up to the undecasaccharide. Although M. smegmatis also makes an acylated polymethylpolysaccharide that is predominantly and alpha 1 leads to 4-glucan, we conclude that these oligosaccharides are precursors of glycogen rather than lopopolysaccharide.     

The conformation of constitutive DNA interaction sites for eukaryotic DNA topoisomerase I on intrinsically curved DNAs.

The analysis of the sites which are cleaved constitutively and preferentially by eukaryotic DNA topoisomerase I on two intrinsically curved DNAs reveals the conformational features that provoke the cleavage reaction on the curve-inducing sequence elements in the absence of supercoiling. This analysis is based on the observation (Caserta et al. (1989) Nucleic Acids Res. 17, 8521-8532 and (1990) Biochemistry 29, 8152-8157) that the reaction of eukaryotic DNA topoisomerase I occurs on two types of DNA sites: sites S (Supercoiled induced) and sites C (Constitutive, whose presence is topology-independent). We report that sites C are abundant on the intrinsically curved DNAs analyzed. The DNAs studied were two intrinsically curved segments of different origin: the Crithidia fasciculata kinetoplast DNA and the bent-containing domain B of the Saccharomyces cerevisiae ARS1. On these DNA segments DNA topoisomerase I cleaves at the junctions between the poly(A) tracts and mixed-sequence DNA. Analysis of the conformation of the double helix around the cleavage sites has revealed that the reaction occurs in correspondence of a defined DNA conformational motif. This motif is described by the set of Eulerian angular values that define the axial path of DNA (helical twist, deflection angle, direction) and of the orthogonal components of wedge (roll and tilt).