The fission yeast Map4 protein is a novel adhesin required for mating

Cell adhesion is required for many cellular processes. In fungi, cell-cell contact during mating, flocculation or virulence is mediated by adhesins, which typically are glycosyl phosphatidyl inositol (GPI)-modified cell wall glycoproteins. Proteins with internal repeats (PIR) are surface proteins involved in the response to stress. In Schizosaccharomyces pombe no adhesins or PIR proteins have been described. Here we study the S. pombe Map4p, which defines a new class of surface protein that is not GPI-modified and has a serine/threonine rich domain and internal repeats that differ from those present in PIR proteins. Map4p is a mating type-specific adhesin required for mating in h(+) cells and enhances cell adhesion when overexpressed.     

Identification and characterization of a novel Chlamydia trachomatis reticulate body protein

The genome of the obligate intracellular bacterium Chlamydia trachomatis comprises 894 genes predicted by computer-based analysis. As part of a large-scale proteome analysis of C. trachomatis, a small abundant protein encoded by a previously unrecognized novel 204-bp open reading frame was identified by tandem mass spectrometry. No homology of this protein was observed to proteins from other organisms. The protein was conserved in C. trachomatis but not found in Chlamydia pneumoniae. Using proteomics, we show that the expression of the protein is initiated at the middle of the developmental cycle. The protein is rapidly degraded and is only present in reticulate or intermediate bodies, suggesting a possible function in the intracellular stage of C. trachomatis development. We have termed the protein '7-kDa reticulate body protein'.     

Hypervariable 3′ UTR region of plant LTR-retrotransposons as a source of novel satellite repeats

The repetitive sequence PisTR-A has an unusual organization in the pea (Pisum sativum) genome, being present both as short dispersed repeats as well as long arrays of tandemly arranged satellite DNA. Cloning, sequencing and FISH analysis of both PisTR-A variants revealed that the former occurs in the genome embedded within the sequence of Ty3/gypsy-like Ogre elements, whereas the latter forms homogenized arrays of satellite repeats at several genomic loci. The Ogre elements carry the PisTR-A sequences in their 3′ untranslated region (UTR) separating the gag-pol region from the 3′ LTR. This region was found to be highly variable among pea Ogre elements, and includes a number of other tandem repeats along with or instead of PisTR-A. Bioinformatic analysis of LTR-retrotransposons mined from available plant genomic sequence data revealed that the frequent occurrence of variable tandem repeats within 3′ UTRs is a typical feature of the Tat lineage of plant retrotransposons. Comparison of these repeats to known plant satellite sequences uncovered two other instances of satellites with sequence similarity to a Tat-like retrotransposon 3′ UTR regions. These observations suggest that some retrotransposons may significantly contribute to satellite DNA evolution by generating a library of short repeat arrays that can subsequently be dispersed through the genome and eventually further amplified and homogenized into novel satellite repeats.     

Cofacial heme binding is linked to dimerization by a bacterial heme transport protein

Campylobacter jejuni is a leading bacterial cause of food-borne illness in the developed world. Like most pathogens, C. jejuni requires iron that must be acquired from the host environment. Although the iron preference of the food-borne pathogen C. jejuni is not established, this organism possesses heme transport systems to acquire iron. ChaN is an iron-regulated lipoprotein from C. jejuni proposed to be associated with ChaR, an outer-membrane receptor. Mutation of PhuW, a ChaN orthologue in Pseudomonas aeruginosa, compromises growth on heme as a sole iron source. The crystal structure of ChaN, determined to 1.9 A resolution reveals that ChaN is comprised of a large parallel beta-sheet with flanking alpha-helices and a smaller domain consisting of alpha-helices. Unexpectedly, two cofacial heme groups ( approximately 3.5 A apart with an inter-iron distance of 4.4 A) bind in a pocket formed by a dimer of ChaN monomers. Each heme iron is coordinated by a single tyrosine from one monomer, and the propionate groups are hydrogen bonded by a histidine and a lysine from the other monomer. Sequence analyses reveal that these residues are conserved among ChaN homologues from diverse bacterial origins. Electronic absorption and electron paramagnetic resonance (EPR) spectroscopy are consistent with heme binding through tyrosine coordination by ChaN in solution yielding a high-spin heme iron structure in a pH-dependent equilibrium with a low-spin species. Analytical ultracentrifugation demonstrates that apo-ChaN is predominantly monomeric and that dimerization occurs with heme binding such that the stability constant for dimer formation increases by 60-fold.     

Specific expression pattern of a novel Otx2 splicing variant during neural differentiation

We cloned a new splicing variant of Otx2 gene, Otx2c. Otx2c lacks entire exon 4, most of the region encoding the homeodomain. More importantly, Otx2c harbors an early premature stop codon and bioinformatics analysis prefers it to be a non-protein coding RNA. In addition, this splicing variant is not simply a noise during mRNA processing, since it is mainly expressed in undifferentiated human embryonic stem cells but gradually decreased during differentiation. Therefore, we report here that a single pre-mRNA can generate both coding and non-coding RNAs through alternative splicing and this splicing activity is tightly regulated in different cell contexts.     

Cloning,differential tissue expression of a novel hcApo gene,and its correlation with total carotenoid content in purple and white inner-shell color pearl mussel Hyriopsis cumingii

As a molecular carrier and storage protein, apolipoprotein (Apo) mediates the intracellular uptake of lipids, proteins, vitamins and carotenoids. In this study, we identified a novel Apo gene, designated hcApo, from the freshwater pearl mussel Hyriopsis cumingii. The complete hcApo cDNA consists of 4104 nucleotides with an open reading frame encoding 1155 amino acid residues. The hcApo protein contains a conserved lipoprotein N-terminal domain (LPD-N) that is a characteristic of the large lipid transfer protein (LLTP) superfamily. The hcApo mRNA is constitutively expressed in a wide range of tissues with the highest expression level in the liver. Moreover, differential expression analysis revealed that the hcApo gene is more highly expressed in the liver, kidney, mantle and gill of purple line mussels compared to white line mussels. In situ hybridization investigations of the precise expression site of hcApo mRNA in the mantle showed that hcApo mRNA is specifically expressed in the outer epithelial cells of the middle fold and the inner epithelial cells of the outer fold of the mantle, as well as throughout the outer epithelium of the outer fold and ventral mantle. Another very important finding is that significantly positive correlation existed between the hcApo gene expression level and the total carotenoid content in purple line mussels. These findings may provide a better understanding of the roles of hcApo in the molecular mechanisms of shell formation and coloring of H. cumingii.     

Identification and characterization of yak (Bos grunniens) b-Boule gene and its alternative splice variants

Boule is responsible for meiotic arrest of sperms and male sterility during mammalian spermatogenesis. In the present study, we first identified yak b-Boule gene and its two alternative splice variants. The full length coding region of yak b-Boule is 888 bp and encodes a 295-amino acid protein with a typical RNA-recognition motif (RRM) and a Deleted in Azoospermia (DAZ) repetitive sequence motif. Two alternative splice variants of yak b-Boule were generated following the consensus “GT-AG” rule and named b-Boule1 (36 bp deletion in exon 3) and b-Boule2 (deletion of integral exon 7), respectively. In male yak, b-Boule, b-Boule1 and b-Boule2 were found to be exclusively expressed in the testes at a ratio of 81:0.1:1. Intriguingly, the mRNA expression levels of b-Boule and b-Boule1 in yak testis were significantly higher than those in cattle–yak, although no significant difference was observed for b-Boule2 expression between the yak and cattle–yak. These results suggest that b-Boule gene, which is partially regulated by alternative splicing, may be involved in the process of yak spermatogenesis.     

Screening of recombinant Escherichia coli using activation of green fluorescent protein as an indicator

A novel cloning vector that can be used to identify recombinant Escherichia coli colonies by activation of the green fluorescent protein gene (GFP) was constructed. Screening using the vector does not require special reagents. The recombinant plasmid activates GFP, and the rate of false-positive results is low.     

Eimeria tenella: cloning of a novel Eimeria tenella cDNA encoding a protein related to rhomboid family from F2 hybrid strain

A novel cDNA sequence with an open reading frame of 774 bp from Eimeria tenella F2 hybrid strain (ETRH01) was isolated from a lambda cDNA library with a monoclonal antibody against sporozoite. Analysis of the genomic sequence suggests that this is an intronless gene. The deduced protein sequence has 257 amino acids with a calculated molecular weight of 28.349 kDa and an isoelectric point of 8.56. Sequence analysis revealed seven transmembrane domains and a rhomboid domain within the protein. RT-PCR result indicates that this gene was expressed in all of the five E. tenella isolates analyzed. To further study the role of this novel gene in the life cycle of E. tenella, ETRH01 was successfully expressed using pET28b(+) expression system.     

pKILLIN: a versatile positive-selection cloning vector based on the toxicity of Killin in Escherichia coli

The invention of DNA cloning over 40 years ago marked the advent of molecular biology. The technique has now become a routine practice in any modern biomedical laboratory. Although positive-selection of recombinants in DNA cloning seems to be superior to blue/white selection based on the disruption of the lacZ gene, it is rarely practiced due to its high background, lack of multiple cloning sites, and inability to express the genes of interest or purify the protein products. Here we report the creation of a new positive-selection cloning vector dubbed pKILLIN, which overcomes all of the above pitfalls. The essence behind its high cloning efficiency is the extreme toxicity and small size of the toxic domain of killin, a recently discovered p53 target gene. Insertion inactivation of killin within the multiple cloning site via either blunt- or sticky-end ligation not only serves as a highly efficient cloning trap, but also may allow any cloned genes to be expressed as His-tagged fusion proteins for subsequent purification. Thus, pKILLIN is a versatile positive-selection vector ideal for cloning PCR products, making DNA libraries, as well as routine cloning and bacterial expression of genes.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

Identification of tubby and tubby-like protein 1 as eat-me signals by phage display

Phagocytosis is an important process for the removal of apoptotic cells or cellular debris. Eat-me signals control the initiation of phagocytosis and hold the key for in-depth understanding of its molecular mechanisms. However, because of difficulties to identify unknown eat-me signals, only a limited number of them have been identified and characterized. Using a newly developed functional cloning strategy of open reading frame (ORF) phage display, we identified nine putative eat-me signals, including tubby-like protein 1 (Tulp1). This further led to the elucidation of tubby as the second eat-me signal in the same protein family. Both proteins stimulated phagocytosis of retinal pigment epithelium (RPE) cells and macrophages. Tubby-conjugated fluorescent microbeads facilitated RPE phagocytosis. Tubby and Tulp1, but not other family members, enhanced the uptake of membrane vesicles by RPE cells in synergy. Retinal membrane vesicles of Tubby mice and Tulp1^−/− mice showed reduced activities for RPE phagocytosis, which were compensated by purified tubby and Tulp1, respectively. These data reveal a novel activity of tubby and Tulp1, and demonstrate that unbiased identification of eat-me signals by the broadly applicable strategy of ORF phage display can provide detailed insights into phagocyte biology.     

Clonorchis sinensis: molecular cloning and functional expression of novel cytosolic malate dehydrogenase

The NAD-dependent cytosolic malate dehydrogenase (cMDH, EC 1.1.1.37) plays a pivotal role in the malate-aspartate shuttle pathway that operates in a metabolic coordination between cytosol and mitochondria, and thus is crucial for the survival and pathogenicity of the parasite. In the high throughput sequencing of the cDNA library constructed from the adult stage of Clonorchis sinensis, a cDNA clone containing 1152bp insert was identified to encode a putative peptide of 329 amino acids possessing more than 50% amino acid sequence identities with the cMDHs from other organisms such as fish, plant, and mammal. But low sequence similarities have been found between this cMDH and mitochondrial malate dehydrogenase as well as glyoxysomal malate dehydrogenase from other organisms. Northern blot analysis showed the size of the C. sinensis cMDH mRNA was 1.2 kb. The cMDH was expressed in Escherichia coli M15 as a His-tag fusion protein and purified by BD TALON metal affinity column. The recombinant cMDH showed high MDH activity of 241 U mg(-1), without lactate dehydrogenase and NADP(H) selectivity. It provides a model for the structure, function analysis, and drug screening on cMDH.