Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations

Accurate predictions of DNA stability in physiological and enzyme buffers are important for the design of many biological and biochemical assays. We therefore investigated the effects of magnesium, potassium, sodium, Tris ions, and deoxynucleoside triphosphates on melting profiles of duplex DNA oligomers and collected large melting data sets. An empirical correction function was developed that predicts melting temperatures, transition enthalpies, entropies, and free energies in buffers containing magnesium and monovalent cations. The new correction function significantly improves the accuracy of predictions and accounts for ion concentration, G-C base pair content, and length of the oligonucleotides. The competitive effects of potassium and magnesium ions were characterized. If the concentration ratio of [Mg (2+)] (0.5)/[Mon (+)] is less than 0.22 M (-1/2), monovalent ions (K (+), Na (+)) are dominant. Effects of magnesium ions dominate and determine duplex stability at higher ratios. Typical reaction conditions for PCR and DNA sequencing (1.5-5 mM magnesium and 20-100 mM monovalent cations) fall within this range. Conditions were identified where monovalent and divalent cations compete and their stability effects are more complex. When duplexes denature, some of the Mg (2+) ions associated with the DNA are released. The number of released magnesium ions per phosphate charge is sequence dependent and decreases surprisingly with increasing oligonucleotide length.     

1 A crystal structures of B-DNA reveal sequence-specific binding and groove-specific bending of DNA by magnesium and calcium

The 1 A resolution X-ray crystal structures of Mg(2+) and Ca(2+) salts of the B-DNA decamers CCAACGTTGG and CCAGCGCTGG reveal sequence-specific binding of Mg(2+) and Ca(2+) to the major and minor grooves of DNA, as well as non-specific binding to backbone phosphate oxygen atoms. Minor groove binding involves H-bond interactions between cross-strand DNA base atoms of adjacent base-pairs and the cations' water ligands. In the major groove the cations' water ligands can interact through H-bonds with O and N atoms from either one base or adjacent bases, and in addition the softer Ca(2+) can form polar covalent bonds bridging adjacent N7 and O6 atoms at GG bases. For reasons outlined earlier, localized monovalent cations are neither expected nor found.Ultra-high atomic resolution gives an unprecedented view of hydration in both grooves of DNA, permits an analysis of individual anisotropic displacement parameters, and reveals up to 22 divalent cations per DNA duplex. Each DNA helix is quite anisotropic, and alternate conformations, with motion in the direction of opening and closing the minor groove, are observed for the sugar-phosphate backbone. Taking into consideration the variability of experimental parameters and crystal packing environments among these four helices, and 24 other Mg(2+) and Ca(2+) bound B-DNA structures, we conclude that sequence-specific and strand-specific binding of Mg(2+) and Ca(2+) to the major groove causes DNA bending by base-roll compression towards the major groove, while sequence-specific binding of Mg(2+) and Ca(2+) in the minor groove has a negligible effect on helix curvature. The minor groove opens and closes to accommodate Mg(2+) and Ca(2+) without the necessity for significant bending of the overall helix.The program Shelxdna was written to facilitate refinement and analysis of X-ray crystal structures by Shelxl-97 and to plot and analyze one or more Curves and Freehelix output files.     

Atomic-resolution crystal structures of B-DNA reveal specific influences of divalent metal ions on conformation and packing.

Crystal structures of B-form DNA have provided insights into the global and local conformational properties of the double helix, the solvent environment, drug binding and DNA packing. For example, structures of the duplex with sequence CGCGAATTCGCG, the Dickerson-Drew dodecamer (DDD), established a unique geometry of the central A-tract and a hydration spine in the minor groove. However, our knowledge of the various interaction modes between metal ions and DNA is very limited and almost no information exists concerning the origins of the different effects on DNA conformation and packing exerted by individual metal ions.Crystallization of the DDD duplex in the presence of Mg(2+)and Ca(2+)yields different crystal forms. The structures of the new Ca(2+)-form and isomorphous structures of oligonucleotides with sequences GGCGAATTCGCG and GCGAATTCGCG were determined at a maximum resolution of 1.3 A. These and the 1.1 A structure of the DDD Mg(2+)-form have revealed the most detailed picture yet of the ionic environment of B-DNA. In the Mg(2+)and Ca(2+)-forms, duplexes in the crystal lattice are surrounded by 13 magnesium and 11 calcium ions, respectively.Mg(2+)and Ca(2+)generate different DNA crystal lattices and stabilize different end-to-end overlaps and lateral contacts between duplexes, thus using different strategies for reducing the effective repeat length of the helix to ten base-pairs. Mg(2+)crystals allow the two outermost base-pairs at either end to interact laterally via minor groove H-bonds, turning the 12-mer into an effective 10-mer. Ca(2+)crystals, in contrast, unpair the outermost base-pair at each end, converting the helix into a 10-mer that can stack along its axis. This reduction of a 12-mer into a functional 10-mer is followed no matter what the detailed nature of the 5'-end of the chain: C-G-C-G-A-ellipsis, G-G-C-G-A-ellipsis, or a truncated G-C-G-A-ellipsis Rather than merely mediating close contacts between phosphate groups, ions are at the origin of many well-known features of the DDD duplex structure. A Mg(2+)coordinates in the major groove, contributing to kinking of the duplex at one end. While Ca(2+)resides in the minor groove, coordinating to bases via its hydration shell, two magnesium ions are located at the periphery of the minor groove, bridging phosphate groups from opposite strands and contracting the groove at one border of the A-tract.     

Pyrimidine morpholino oligonucleotides form a stable triple helix in the absence of magnesium ions

Oligonucleotides can be used as sequence-specific DNA ligands by forming a local triple helix. In order to form more stable triple-helical structures or prevent their degradation in cells, oligonucleotide analogues that are modified at either the backbone or base level are routinely used. Morpholino oligonucleotides appeared recently as a promising modification for antisense applications. We report here a study that indicates the possibility of a triple helix formation with a morpholino pyrimidine TFO and its comparison with a phosphodiester and a phosphoramidate oligonucleotide. At a neutral pH and in the presence of a high magnesium ion concentration (10 mM), the phosphoramidate oligomer forms the most stable triple helix, whereas in the absence of magnesium ion but at a physiological monovalent cation concentration (0.14 M) only morpholino oligonucleotides form a stable triplex. To our knowledge, this is the first report of a stable triple helix in the pyrimidine motif formed by a noncharged oligonucleotide third strand (the morpholino oligonucleotide) and a DNA duplex. We show here that the structure formed with the morpholino oligomer is a bona fide triple helix and it is destabilized by high concentrations of potassium ions or divalent cations (Mg(2+)).     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Structural insights into the effect of hydration and ions on A-tract DNA: a molecular dynamics study

DNA structure is known to be sensitive to hydration and ionic environment. To explore the dynamics, hydration, and ion binding features of A-tract sequences, a 7-ns Molecular dynamics (MD) study has been performed on the dodecamer d(CGCAAATTTGCG)(2). The results suggest that the intrusion of Na(+) ion into the minor groove is a rare event and the structure of this dodecamer is not very sensitive to the location of the sodium ions. The prolonged MD simulation successfully leads to the formation of sequence dependent hydration patterns in the minor groove, often called spine of hydration near the A-rich region and ribbon of hydration near the GC regions. Such sequence dependent differences in the hydration patterns have been seen earlier in the high resolution crystal structure of the Drew-Dickerson sequence, but not reported for the medium resolution structures (2.0 approximately 3.0 A). Several water molecules are also seen in the major groove of the MD simulated structure, though they are not highly ordered over the extended MD. The characteristic narrowing of the minor groove in the A-tract region is seen to precede the formation of the spine of hydration. Finally, the occurrence of cross-strand C2-H2.O2 hydrogen bonds in the minor groove of A-tract sequences is confirmed. These are found to occur even before the narrowing of the minor groove, indicating that such interactions are an intrinsic feature of A-tract sequences.     

Structure of the B-DNA decamer C-C-A-A-C-G-T-T-G-G and comparison with isomorphous decamers C-C-A-A-G-A-T-T-G-G and C-C-A-G-G-C-C-T-G-G

The crystal structure of the DNA decamer C-C-A-A-C-G-T-T-G-G has been solved to a resolution of 1.4 A, and is compared with the 1.3 A structure of C-C-A-A-G-A-T-T-G-G and the 1.6 A structure of C-C-A-G-G-C-C-T-G-G. All three decamers crystallize isomorphously in space group C2 with five base-pairs per asymmetric unit, and with decamer double helices stacked atop one another along the c axis in a manner that closely approximates a continuous B helix. This efficient stacking probably accounts for the high resolution of the crystal data. Comparison of the three decamers reveals the following. (1) Minor groove width is more variable than heretofore realized. Regions of A.T base-pairs tend to be narrower than average, although two successive A.T base-pairs alone may not be sufficient to produce narrowing. The minor groove is wider in regions where BII phosphate conformations are opposed diagonally across the groove. (2) Narrow regions of minor groove exhibit a zig-zag spine of hydration, as was first seen in C-G-C-G-A-A-T-T-C-G-C-G, whereas wide regions show two ribbons of water molecules down the walls, connecting base edge N or O with sugar O-4' atoms. Regions of intermediate groove width may accommodate neither pattern of hydration well, and may exhibit a less regular pattern of hydration. (3) Base-pair stacking is virtually identical at equivalent positions in the three decamers. The unconnected step from the top of one decamer helix to the bottom of the next helix is a normal helix step in all respects, except for the absence of connecting phosphate groups. (4) BII phosphate conformation require the unstacking of the two bases linked by the phosphate, but do not necessarily follow as an inevitable consequence of unstacking. They have an influence on minor groove width as noted in point (1) above. (5) Sugar ring pseudorotation P and main-chain torsion angle delta show an excellent correlation as given by the equation: delta = 40 degrees cos (P + 144 degrees) + 120 degrees. Although centered around C-2'-endo, the conformations in these B-DNA helices are distributed broadly from C-3'-exo to O-4'-endo, unlike the tighter clustering around C-3'-endo observed in A-DNA oligomer structures.     

Surprising roles of electrostatic interactions in DNA-ligand complexes

The positions of cations in x-ray structures are modulated by sequence, conformation, and ligand interactions. The goal here is to use x-ray diffraction to help resolve structural and thermodynamic roles of specifically localized cations in DNA-anthracycline complexes. We describe a 1.34 A resolution structure of a CGATCG(2)-adriamycin(2) complex obtained from crystals grown in the presence of thallium (I) ions. Tl(+) can substitute for biological monovalent cations, but is readily detected by distinctive x-ray scattering, obviating analysis of subtle differences in coordination geometry and x-ray scattering of water, sodium, potassium, and ammonium. Six localized Tl(+) sites are observable adjacent to each CGATCG(2)-adriamycin(2) complex. Each of these localized monovalent cations are found within the G-tract major groove of the intercalated DNA-drug complex. Adriamycin appears to be designed by nature to interact favorably with the electrostatic landscape of DNA, and to conserve the distribution of localized cationic charge. Localized inorganic cations in the major groove are conserved upon binding of adriamycin. In the minor groove, inorganic cations are substituted by a cationic functional group of adriamycin. This partitioning of cationic charge by adriamycin into the major groove of CG base pairs and the minor groove of AT base pairs may be a general feature of sequence-specific DNA-small molecule interactions and a potentially useful important factor in ligand design.     

X-ray fibre diffraction study of conformational changes in hyaluronate induced in the presence of sodium,potassium and calcium cations

Hyaluronate purified from all cations by ion exchange chromatography was introduced to the cations sodium, potassium and calcium in a controlled way. The conformations formed in the presence of these ions were studied as a function of ionic strength, hydrogen ion activity, humidity and temperature using X-ray fibre diffraction. In sodium hyaluronate above pH 4.0 a contracted helix is found which approximates to a four-fold helix with an axial rise per disaccharide of 0.84 nm. There is no requirement for water molecules in the unit cell as the Na⁺ can be coordinate by the hyaluronate chains alone. On crystallizing hyaluronate below pH 4.0 an extended 2-fold helix with an axial rise per disaccharide of 0.98 nm is formed. In the presence of potassium above pH 4.0 a conformation similar, but not identical, to that of sodium was found where the helix backbone is again four-fold with an axial rise per disaccharide h=0.90 nm. To maintain the coordination of the potassium ion, four water molecule/disaccharide are required and on removal of these the conformation is destabilized going to a new helix where n = 4 and h = 0.97 nm. Below pH 4.0 the conformation is a contracted 4-fold helix with h = 0.82 nm. In this structure two antiparallel chains intertwine to form a double helix. The packing of the double helical units is stabilized by water molecules, the unit cell requiring 8 water molecules/disaccharide. Formation of the calcium hyaluronate complex above pH 3.5 yields a three-fold helix with h = 0.95 nm. The requirement for water in the unit cell to maintain full crystallinity is high, at 9 water molecules/disaccharide; however, on removal of this water, though the crystallinity is disrupted, the conformation remains constant. The acid form of calcium-hyaluronate yields an equivalent conformation to that of sodium under the same condition, i.e. a helix with n = 2, h = 0.98 nm. The presence of small quantities of calcium in what are otherwise potassium or sodium solutions of hyaluronate yield the 3-fold conformation for hyaluronate. Thus calcium has an important role to play in deciding the dominating conformation present in hyaluronate. The variety of conformations yielded by the different cations indicates a subtle interaction between hyaluronate and its environment, in which the balance between the cations will control to some degree the interactions between hyaluronate chains and thus affect the mechanical properties of the matrix which they form. The conformations of individual chains are all stabilized in varying degrees by intra-chain hydrogen bonds.     

Binding of Hoechst 33258 to the minor groove of B-DNA

An X-ray crystallographic structure analysis has been carried out on the complex between the antibiotic and DNA fluorochrome Hoechst 33258 and a synthetic B-DNA dodecamer of sequence C-G-C-G-A-A-T-T-C-G-C-G. The drug molecule, which can be schematized as: phenol-benzimidazole-benzimidazole-piperazine, sits within the minor groove in the A-T-T-C region of the DNA double helix, displacing the spine of hydration that is found in drug-free DNA. The NH groups of the benzimidazoles make bridging three-center hydrogen bonds between adenine N-3 and thymine O-2 atoms on the edges of base-pairs, in a manner both mimicking the spine of hydration and calling to mind the binding of the auti-tumor drug netropsin. Two conformers of Hoechst are seen in roughly equal populations, related by 180 degrees rotation about the central benzimidazole-benzimidazole bond: one form in which the piperazine ring extends out from the surface of the double helix, and another in which it is buried deep within the minor groove. Steric clash between the drug and DNA dictates that the phenol-benzimidazole-benzimidazole portion of Hoechst 33258 binds only to A.T regions of DNA, whereas the piperazine ring demands the wider groove characteristic of G.C regions. Hence, the piperazine ring suggests a possible G.C-reading element for synthetic DNA sequence-reading drug analogs.     

Structure of a B-DNA dodecamer. II. Influence of base sequence on helix structure

Detailed examination of the structure of the B-DNA dodecamer C-G-C-G-A-A-T-T-C-G-C-G, obtained by single-crystal X-ray analysis (Drew et al., 1981), reveals that the local helix parameters, twist, tilt and roll, are much more strongly influenced by base sequence than by crystal packing or any other external forces. The central EcoRI restriction endonuclease recognition site, G-A-A-T-T-C, is a B helix with an average of 9.8 base-pairs per turn. It is flanked on either side by single-base-pair steps having aspects of an A-like helix character. The dodecamer structure suggests several general principles, whose validity must be tested by other B-DNA analyses. (1) When an external bending moment is applied to a B-DNA double helix, it bends smoothly, without kinks or breaks, and with relatively little effect on local helix parameters. (2) Purine-3′,5′-pyrimidine steps open their base planes towards the major groove, pyrimidine-purine steps open toward the minor groove, and homopolymer (Pur-Pur, Pyr-Pyr) steps resist rolling in either direction. This behavior is related to the preference of pyrimidines for more negative glycosyl torsion angles. (3) CpG steps have smaller helical twist angles than do GpC, as though in compensation for their smaller intrinsic base overlap. Data on A-T steps are insufficient for generalization. (4) G.C base-pairs have smaller propellor twist than A · T, and this arises mainly from interstrand base overlap rather than the presence of the third hydrogen bond. (5) DNAase I cuts preferentially at positions of high helical twist, perhaps because of increased exposure of the backbone to attack. The correlation of the digestion patterns in solution and helical twist in the crystal argues for the essential identity of the helix structure in the two environments. (6) In the two places where the sequence TpCpG occurs, the C slips from under T in order to stack more efficiently over G. At the paired bases of this CpG step, the G and C are tilted so the angle between base planes is splayed out to the outside of the helix. This TpC is the most favored cutting site for DNAase I by a factor of 4.5 (Lomonossoff et al., 1981). (7) The EcoRI restriction endonuclease and methylase both appear to prefer a cutting site of the type purine-purine-A-T-T-pyrimidine, involving two adjacent homopolymer triplets, and this may be a consequence of the relative stiffness of homopolymer base-stacking observed in the dodecamer.     

The 1.3 A resolution structure of the RNA tridecamer r(GCGUUUGAAACGC): metal ion binding correlates with base unstacking and groove contraction

Metal ions play a key role in RNA folding and activity. Elucidating the rules that govern the binding of metal ions is therefore an essential step for better understanding the RNA functions. High-resolution data are a prerequisite for a detailed structural analysis of ion binding on RNA and, in particular, the observation of monovalent cations. Here, the high-resolution crystal structures of the tridecamer duplex r(GCGUUUGAAACGC) crystallized under different conditions provides new structural insights on ion binding on GAAA/UUU sequences that exhibit both unusual structural and functional properties in RNA. The present study extends the repertory of RNA ion binding sites in showing that the two first bases of UUU triplets constitute a specific site for sodium ions. A striking asymmetric pattern of metal ion binding in the two equivalent halves of the palindromic sequence demonstrates that sequence and its environment act together to bind metal ions. A highly ionophilic half that binds six metal ions allows, for the first time, the observation of a disodium cluster in RNA. The comparison of the equivalent halves of the duplex provides experimental evidences that ion binding correlates with structural alterations and groove contraction.     

Molecular dynamics simulations of A. T-rich oligomers: sequence-specific binding of Na+ in the minor groove of B-DNA

Molecular dynamics simulations have been employed to probe the sequence-specific binding of sodium ions to the minor groove of B-DNA of three A. T-rich oligomers having identical compositions but different orders of the base pairs: C(AT)(4)G, CA(4)T(4)G, and CT(4)A(4)G. Recent experimental investigations, either in crystals or in solution, have shown that monovalent cations bind to DNA in a sequence-specific mode, preferentially in the narrow minor groove regions of uninterrupted sequences of four or more adenines (A-tracts), replacing a water molecule of the ordered hydration structure, the hydration spine. Following this evidence, it has been hypothesized that in A-tracts these events may be responsible for structural peculiarities such as a narrow minor groove and a curvature of the helix axis. The present simulations confirm a sequence specificity of the binding of sodium ions: Na(+) intrusions in the first layer of hydration of the minor groove, with long residence times, up to approximately 3 ns, are observed only in the minor groove of A-tracts but not in the alternating sequence. The effects of these intrusions on the structure of DNA depend on the ion coordination: when the ion replaces a water molecule of the spine, the minor groove becomes narrower. Ion intrusions may also disrupt the hydration spine modifying the oligomer structure to a large extent. However, in no case intrusions were observed to locally bend the axis toward the minor groove. The simulations also show that ions may reside for long time periods in the second layer of hydration, particularly in the wider regions of the groove, often leading to an opening of the groove.     

DNase I-induced DNA conformation. 2 A structure of a DNase I-octamer complex.

The structure of a complex between DNase I and d(GCGATCGC)2 has been solved by molecular replacement and refined to an R-factor of 0.174 for all data between 6 and 2 A resolution. The nicked octamer duplexes have lost a dinucleotide from the 3' ends of one strand and are hydrogen-bonded across a 2-fold axis to form a quasi-continuous double helix of 14 base-pairs. DNase I is bound in the minor groove of the B-type DNA duplex forming contacts in and along both sides of the minor groove extending over a total of six base-pairs. As a consequence of binding of DNase I to the DNA-substrate the minor groove opens by about 3 A and the duplex bends towards the major groove by about 20 degrees. Apart from these more global distortions the bound duplex also shows significant deviations in local geometry. A major cause for the observed perturbations in the DNA conformation seems to be the stacking type interaction of a tyrosine ring (Y76) with a deoxyribose. In contrast, the enzyme structure is nearly unchanged compared to free DNase I (0.49 A root-mean-square deviations for main-chain atoms) thus providing a rigid framework to which the DNA substrate has to adapt on binding. These results confirm the hypothesis that groove width and stiffness are major factors determining the global sequence dependence of the enzyme's cutting rates. The nicked octamer present in the crystals did not allow us to draw detailed conclusions about the catalytic mechanism but confirmed the location of the active site near H134 on top of the central beta-sheets. A second cut of the DNA induced by diffusion of Mn2+ into the crystals may suggest the presence of a secondary active site in DNase I.     

Effect of ions on antibacterial activity of human beta defensin 2

Human beta defensin 2 (HBD-2), the most recently discovered human defensin, has been considered to work as a host defense substance against microbial infection. Using Escherichia coli ATCC 25922, we investigated how some cations and anions influenced the antimicrobial activity of HBD-2. This activity, measured in 10 mM phosphate buffer at a concentration of 20 microg/ml, reduced significantly in the presence of 100 and 150 mM sodium or potassium chloride. The reduction was not significantly different when the total amounts of sodium and potassium ions were equal. The kind and the valence of anions (chlorine and sulfate ions) did not affect the bactericidal activity as long as the concentrations of sodium ions were equal. Divalent ions (calcium and magnesium ions) added to 10 mM of Tris buffer significantly inactivated HBD-2 at much lower concentrations (more than or equal to 0.01 mM and 0.05 mM, respectively) than the monovalent ions did. These findings suggest that HBD-2 kills the bacteria through at least two phases, which are affected independently by either monovalent or divalent ions and unaffected by anions.     

Locating monovalent cations in the grooves of B-DNA

Here we demonstrate that monovalent cations can localize around B-DNA in geometrically regular, sequence-specific sites in oligonucleotide crystals. Positions of monovalent ions were determined from high-resolution X-ray diffraction of DNA crystals grown in the presence of thallium(I) cations (Tl(+)). Tl(+) has previously been shown to be a useful K(+) mimic. Tl(+) positions determined by refinement of model to data are consistent with positions determined using isomorphous F(Tl) - F(K) difference Fouriers and anomalous difference Fouriers. None of the observed Tl(+) sites surrounding CGCGAATTCGCG are fully occupied by Tl(+) ions. The most highly occupied sites, located within the G-tract major groove, have estimated occupancies ranging from 20% to 35%. The occupancies of the minor groove sites are estimated to be around 10%. The Tl(+) positions in general are not in direct proximity to phosphate groups. The A-tract major groove appears devoid of localized cations. The majority of the observed Tl(+) ions interact with a single duplex and so are not engaged in lattice interactions or crystal packing. The locations of the cation sites are dictated by coordination geometry, electronegative potential, avoidance of electropositive amino groups, and cation-pi interactions. It appears that partially dehydrated monovalent cations, hydrated divalent cations, and polyamines compete for a common binding region on the floor of the G-tract major groove.     

Activation of the Escherichia coli cell division protein FtsZ by a low-affinity interaction with monovalent cations

We have investigated the activation of FtsZ by monovalent cations. FtsZ polymerization was dependent on the concentrations of protein and monovalent salts, and was accompanied by the uptake of a single ion per monomer added. The affinity and the specificity for the cation were low. Potassium, ammonium, rubidium or sodium activated FtsZ to different extents. Electron microscopy showed that polymers formed with either rubidium, or potassium, were very similar, as were their nucleotide turnover rates. The GTPase activity was lower with rubidium than with potassium, indicating that nucleotide exchange is independent of nucleotide hydrolysis. Control of polymerization by binding of a low affinity cation might govern the dynamic behavior of the FtsZ polymers.     

Analysis of local helix geometry in three B-DNA decamers and eight dodecamers

Local variations in B-DNA helix structure are compared among three decamers and eight dodecamers, which contain examples of all ten base-pair step types. All pairwise combinations of helix parameters are compared by linear regression analysis, in a search for internal relationships as well as correlations with base sequence. The primary conclusions are: (1) Three-center hydrogen bonds between base-pairs occur frequently in the major groove at C-C, C-A, A-A and A-C steps, but are less convincing at C-C and C-T steps in the minor groove. The requirements for large base-pair propeller are (1) that the base-pair should be A.T rather than G.C, and (2) that it be involved in a major groove three-center hydrogen bond with the following base-pair. Either condition alone is insufficient. Hence, a large propeller is expected at the leading base-pair of A-A and A-C steps, but not at A-T, T-A, C-A or C-C steps. (2) A systematic and quantitative linkage exists between helix variables twist, rise, cup and roll, of such strength that the rise between base-pairs can hardly be described as an independent variable at all. Two typical patterns of behavior are observed at steps from one base-pair to the next: high twist profile (HTP), characterized by high twist, low rise, positive cup and negative roll, and low twist profile (LTP), marked by low twist, high rise; negative cup and positive roll. Examples of HTP are steps G-C, G-A and Y-C-A-R, where Y is pyrimidine and R is purine. Examples of LTP steps are C-G, G-G, A-G and C-A steps other than Y-C-A-R. (3) The minor groove is especially narrow across the two base-pairs of the following steps: A-T, T-A, A-A and G-A. (4) In general, base step geometry cannot be correlated solely with the bases that define the step in question; the two flanking steps also must be taken into account. Hence, local helix structure must be studied in the context, not of two base-pairs: A-B, but of four: x-A-B-y. Calladine's rules, although too simple in detail, were correct in defining the length of sequence over which a given perturbation is expressed. Whereas ten different two-base steps are possible, allowing for the identity of complementary sequences, there are 136 different four-base steps. Only 33 of these 136 four-base steps are represented in the decamer and dodecamer structures solved to date, and hence it is premature to try to set up detailed structural algorithms. (5) The sugar-phosphate backbone chains of B-DNA place strong limits on sequence-induced structural variation, damping down most variables within four or five base-pairs, and preventing purine-purine anti-anti mismatches from causing bulges in the double helix. Hence, although short-range sequence-induced deformations (or deformability) are observed, long-range deformations propagated down the helix are not to be expected.     

Regulation by Cations of [3H]Spiroperidol Binding Associated with Dopamine Receptors of Rat Brain

Abstract: The effects of monovalent and divalent cations on binding of [³H]spiroperidol to dopamine receptors in rat corpus striatum were studied. Both monovalent and divalent cations as well as several chelating agents increase the number of [³H] spiroperidol binding sites. Manganese is most potent, enhancing binding at 1 μ m concentration, while magnesium and calcium are at least two orders of magnitude less potent and the monovalent cations sodium, potassium and lithium are still weaker. Divalent cations enhance the potency of dopaminergic agonists in competing for [³H]spiroperidol binding, an effect which appears to be independent of the ionic augmentation of [³H]spiroperidol binding. Divalent cations decrease both the association and dissociation rates of [³H]spiroperidol binding to dopamine receptor sites.