Nuclear precursors for ceruloplasmin-coding messenger RNA from rat liver

The distribution of the sequences coding for ceruloplasmin (CP) in rat liver heterogeneous nuclear RNA (hnRNA) was studied using highly specific CP cDNA as a hybridization probe. The content of CP-coding sequences in poly(A)-containing and poly(A)-free subfractions of hnRNA was shown to be respectively 1 and 27 equivalents of CP mRNA molecule per one hepatocyte. The gel electrophoresis of hnRNA under strongly denaturing conditions with the subsequent transfer of RNA to diazobenzyloxymethyl paper and hybridization with [32P]-cDNA probe showed that CP mRNA sequences were of multiple molecular weight distribution. In particular, 9.0, 6.6, 2.4 and 1.6 megadalton fractions of non-polyadenylate hnRNA carried CP-coding sequences while the only hand that hybridized to CP cDNA was detected in polyadenylated hnRNA. This band was of a molecular weight 1.1-1.2 megadaltons corresponding to that of cytoplasmic CP mRNA. The hybridization of high molecular weight hnRNA with full-length CP cDNA followed by the determination of the size of cDNA fragments protected against SI nuclease demonstrated that coding sequences of CP pre-mRNA are interrupted by intervening sequences.     

The repetitive structure of the profilaggrin gene as demonstrated using epidermal profilaggrin cDNA

Filaggrin is the histidine-rich basic protein that aggregates keratin filaments in fully differentiated cells of the epidermis. Filaggrin is synthesized in the granular cell layer as a high molecular weight precursor protein (profilaggrin) that consists of multiple repeated copies of filaggrin. cDNA clones for rat and mouse epidermal profilaggrin have been constructed from sucrose gradient-enriched RNA in order to study the repetitive structure of profilaggrin. These clones hybridize to high molecular weight epidermal mRNA (23 kilobase pairs, rat and 19 kilobase pairs, mouse) and exhibit limited cross-hybridization between species. Several rat clones direct the synthesis of a portion of rat profilaggrin in bacteria. One of these, rat profilaggrin cDNA clone R4D6, is 2400 base pairs in length. The R4D6 cDNA is shown to contain repetitive sequence by restriction mapping and southern hybridization analysis of restriction digests of this plasmid, using subfragments of the plasmid as hybridization probes. Southern hybridization analysis of rat genomic DNA, digested to completion with several restriction enzymes, reveals a simple hybridization pattern of fragments equal in size to those of the cDNA. Partial digestion of rat genomic DNA results in a ladder of bands based on a 1200-base pair repeat, equal to the size of the repeating unit of the cDNA clone, and consistent with the expected repeating size of profilaggrin. Together, these results show that the profilaggrin mRNA and gene have repetitive structure and that the gene apparently lacks introns in the coding region.     

Structure of the human cytochrome c oxidase subunit Vb gene and chromosomal mapping of the coding gene and of seven pseudogenes.

Subunit Vb of mammalian cytochrome c oxidase (COX; EC 1.9.3.1) is encoded by a nuclear gene and assembled with the other 12 COX subunits encoded in both mitochondrial and nuclear DNA. We have cloned the gene for human COX subunit Vb (COX5B) and determined the exon-intron structure by both hybridization analysis and DNA sequencing. The gene contains five exons and four introns; the four coding exons span a region of approximately 2.4 kb. The 5' end of the COX5B gene is GC-rich and contains many HpaII sites. Genomic Southern blot analysis of human DNA probed with the human COX Vb cDNA identified eight restriction fragments containing COX Vb-related sequences that were mapped to different chromosomes with panels of human x Chinese hamster somatic cell hybrids. Because only one of these fragments hybridized with a 210-bp probe from intron 4, we conclude that there is a single expressed gene for COX subunit Vb in the human genome. We have mapped this gene to chromosome 2, region cen-q13.     

Nucleotide sequence of the gene for human prothrombin

A human genomic DNA library was screened for the gene coding for human prothrombin with a cDNA coding for the human protein. Eighty-one positive lambda phage were identified, and three were chosen for further characterization. These three phage hybridized with 5' and/or 3' probes prepared from the prothrombin cDNA. The complete DNA sequence of 21 kilobases of the human prothrombin gene was determined and included a 4.9-kilobase region that was previously sequenced. The gene for human prothrombin contains 14 exons separated by 13 intervening sequences. The exons range in size from 25 to 315 base pairs, while the introns range from 84 to 9447 base pairs. Ninety percent of the gene is composed of intervening sequence. All the intron splice junctions are consistent with sequences found in other eukaryotic genes, except for the presence of GC rather than GT on the 5' end of intervening sequence L. Thirty copies of Alu repetitive DNA and two copies of partial KpnI repeats were identified in clusters within several of the intervening sequences, and these repeats represent 40% of the DNA sequence of the gene. The size, distribution, and sequence homology of the introns within the gene were then compared to those of the genes for the other vitamin K dependent proteins and several other serine proteases.     

Nine introns with conserved boundary sequences in the Euglena gracilis chloroplast ribulose-1,5-bisphosphate carboxylase gene

The single, chloroplast encoded gene for the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) from Euglena gracilis is found to contain nine intervening sequences. The intervening sequences were identified by heteroduplex analysis between Euglena rbcL and the non-intron-containing rbcL from Spinacea oleracea, by electron microscopy of Euglena rbcL DNA-mRNA hybrids, and by cloning, restriction endonuclease analysis, and partial DNA sequencing. The identification, locus, and coding properties for six of ten exons was confirmed by partial DNA sequence analysis. Each of the nine introns in the approximately 6.5 kb rbcL locus is approximately 0.5 kb in length. The DNA sequence of five 3'-intron/5'-exon and four 3'-exon/5'-intron boundaries are highly conserved. A proposed consensus sequence is (formula; see text) These conserved sequences could play a role in an mRNA splicing mechanism in chloroplasts analogous to that in eucaryotic nuclei.     

Characterization of rat liver mannan-binding protein gene.

We previously found that rat liver mannan-binding protein (L-MBP) is encoded by two species of mRNA of 1.4 and 3.5 kb long. In this study, the structure of the gene encoding rat L-MBP was determined from the sequences of isolated genomic DNA clones and PCR amplified DNA fragments. Rat L-MBP is encoded by at least three species of mRNA, the differences among which are generated by an alternative splicing at the 5'-nontranslated region and an alternative utilization of polyadenylation sites. The rat L-MBP gene consists of six exons separated by five introns. The coding region of rat L-MBP mRNA is encoded by four exons (Exons III-VI), the 5'-noncoding region by Exons I and II, and the 3'-noncoding region by Exon VI. The exon-intron boundaries of L-MBP are completely identical to those of rat serum and human MBP, suggesting that all three MBPs are derived from a common ancestral gene.     

Partial structure of the gene for chicken cartilage proteoglycan core protein

A genomic DNA fragment (gCORE-1), encoding a portion of the cartilage proteoglycan core protein, has been isolated from a phage library using cDNA as a probe. The genomic insert is about 17 kilobase pairs; two BamHI fragments of the insert (1.3 and 4.8 kilobase pairs) contain most of the hybridizable sequences found in the cDNA. Sequence analysis of these fragments shows that they contain a total of five exons that encompass 216 amino acid residues, all of which are identical to those of the corresponding cDNA sequence. Three of the exons, which are adjacent to one another, are very similar to the corresponding exons in the gene of a rat hepatic lectin as well as to an exon in the gene of human pulmonary surfactant-associated protein. There is a strong degree of conservation of amino acid sequences encoded in the three genes, although there is no similarity between their introns. The sizes of the five exons in gCORE-1, except for one (which is indeterminate because only a partial cDNA sequence is available), are less than 184 base pairs, whereas the sizes of the introns range from 218 to greater than 2629 base pairs. Four of the introns interrupt an exon codon at either their donor or acceptor sites, between the first and second nucleotides. Only one intron does not split a codon. Intron and exon boundary sites are in agreement with known consensus sequences for introns. The dispersed distribution and relatively small size of the exons, if representative of the entire gene, suggest that the complete gene which codes for the core protein may be quite sizable.     

Structural organization of a 17 KB segment of the alpha 2 collagen gene: evaluation by R loop mapping.

A recombinant phage, SpC3, containing a 17 kb genomic DNA insert representing approximately 60% of the 3' portion of the sheep collagen alpha 2 gene, was evaluated by electron microscopic R loop analysis. A minimum of 17 intervening sequences (introns) and 18 alpha 2 coding sequences (exons) were mapped. With the exception of the 850 base pair exon located at the extreme 3' end of the insert, all exons contained 250 base pairs or less. The total length of all the exons in SpC3 was 3,014 base pairs. The length distribution of the 17 introns ranged from 300 to 1600 base pairs; together, all of the introns comprised 14,070 base pairs of SpC3 DNA. Thus, the DNA region required for coding the interspersed 3 kb of alpha 2 collagen genetic information was 5.6 fold longer than the corresponding alpha 2 mRNA coding sequences.     

Nucleotide sequence of cDNA clones coding for a brain-type fatty acid binding protein and its tissue-specific expression in adult zebrafish (Danio rerio)

We have determined the nucleotide sequence for two cDNA clones coding for a fatty acid binding protein (FABP) from zebrafish (Danio rerio). Comparison of the sequence with GenBank entries revealed extensive amino acid identity between this zebrafish FABP and brain FABPs (B-FABP) from other species. The zebrafish B-FABP cDNA hybridized to single restriction fragments of total zebrafish genomic DNA digested with the restriction endonucleases BglII or EcoRI suggesting that a single copy of the B-FABP gene is present in the zebrafish genome. Northern blot analysis demonstrated that the zebrafish B-FABP mRNA is approximately 850 nucleotides in length. In situ hybridization revealed that the B-FABP mRNA was expressed in the periventricular gray zone of the optic tectum of the adult zebrafish brain.     

The Euglena gracilis chloroplast ribulose-1,5-bisphosphate carboxylase gene. I. Complete DNA sequence and analysis of the nine intervening sequences

The nucleotide sequence of 6225 base pairs (bp) of Euglena gracilis chloroplast DNA including the complete DNA sequence of the chloroplast-encoded ribulose-1,5-bisphosphate carboxylase large subunit gene along with the flanking DNA sequences is presented. The gene is greater than 5.5 kilobase pairs in length and is organized as 10 exons coding for 475 amino acids, separated by 9 introns. The exons range in size from 45 to 438 bp, while the introns range in size from 382 to 568 bp. The introns have highly conserved boundary sequences with the consensus, 5'-N GTGTGGATTT...(intron)...TTAATTTTAT N-3'. The introns are 82-85 mol% AT, with a pronounced T greater than A greater than G greater than C base bias in the RNA-like strand. They do not appear to encode any polypeptides. In addition, the introns have a conserved sequence 30-50 bp from their 3'-ends with the consensus, 5'-TACAGTTTGAAAATGA-3'. The 5'-TACA sequence bears some homology to the 5'-end of the TACTAACA sequence found in a similar location in yeast nuclear mRNA introns. The conserved sequences of the Euglena rbcL introns may be indicative of a splicing mechanism similar to that of eucaryotic nuclear mRNA introns and group II mitochondrial introns.     

Structure and restriction fragment length polymorphism of genes for human liver arylamine N-acetyltransferases.

Genomic DNA clones coding for polymorphic and monomorphic arylamine N-acetyltransferases (NAT) of human liver were isolated from a genomic DNA library, and their restriction maps and partial nucleotide sequences were determined. Messenger RNA for monomorphic NAT was coded in one exon, while mRNA for polymorphic NAT was coded in two exons; the 5'-noncoding region was located in one exon 8 kb upstream from another exon containing the coding and 3'-noncoding regions. Recently, we have shown that there are three types of polymorphic NAT gene; one of the genes corresponds to a high NAT activity, while the other two genes give rise to a low NAT activity. The restriction fragment length polymorphism (RFLP) was analyzed by Southern blot hybridization of genomic DNAs from homozygotes of the three polymorphic NAT genes using various fragments of the cloned NAT gene. RFLPs of polymorphic NAT gene were observed in coding and 3'-flanking region upon digestion with BamHI and KpnI.     

Sequences hybridizing to mRNA, oligo(dT) and dsRNA from pre-mRNA are contiguous in the cloned mouse DNA fragments.

Fragments from the DNA of mouse embryos produced by restriction endonucleases HindIII were cloned in pBR322 plasmid and examined for the ability to hybridize in situ with [32P] labeled cDNA synthesized from the polysomal poly(A)+mRNA template. Several of the selected clones were examined for the presence of specific sequences inside the cloned mouse DNA fragments by the blotting procedure of southern [1]. The data obtained indicate that the majority of the cloned mouse DNA fragments contained sequences hybridizing with cDNA, oligo(dT) and double-stranded regions from pre-mRNA. The results of hybridization experiments and double digestion with HindIII+HaeIII endonucleases provide evidence that these sequences could be contiguous in the given restriction DNA fragments.     

Gene structure and nucleotide sequence for rat cytochrome P-450c

Two clones from rat genomic libraries that contain the entire gene for rat cytochrome P-450c have been isolated. lambda MC4, the first clone isolated from an EcoR1 library, contained a 14-kb insert. A single 5.5-kb EcoR1 fragment from lambda MC4, the EcoR1 A fragment, hybridized to a partial cDNA clone for the 3' end of the cytochrome P-450c mRNA. This fragment was sequenced using the dideoxynucleotide chain termination methodology with recombinant M13 bacteriophage templates. Comparison of this sequence with the complete cDNA sequence of cytochrome P-450MC [Yabusaki et al. (1984) Nucleic. Acids Res. 12, 2929-2938] revealed that the EcoR1 A fragment contained the entire cytochrome P-450c gene with the exception of a 90-bp leader sequence. The gene sequence is in perfect agreement with the cDNA sequence except for two bases in exon 2. A second genomic clone, lambda MC10, which was isolated from a HaeIII library, contains the missing leading sequence as well as 5' regulatory sequences. The entire gene is about 6.1 kb in length with seven exons separated by six introns, all of the intron/exon junctions being defined by GT/AG. Amino- and carboxy-terminal information are contained in exons 2 and 7, respectively. These exons contain the highly conserved DNA sequences that have been observed in other cytochrome P-450 species. Potential regulatory sequences have been located both 5' to the gene as well as within intron I. A comparison of the coding information for cytochrome P-450c with the sequence of murine cytochrome P3-450 and rat cytochrome P-450d revealed a 70% homology in both the DNA and amino acid sequence, suggesting a common ancestral gene. Genomic blot analyses of rat DNA indicated that the 3-methylcholanthrene-inducible family of cytochrome P-450 isozymes is more limited in number compared to the phenobarbital-inducible isozymes. Cross-hybridization studies with human DNA suggest a high degree of conservation between rat cytochrome P-450c and its human homolog although gross structural differences do exist between the two genes.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Isolation and complete nucleotide sequence of the gene for bovine parathyroid hormone

The structure of the bovine parathyroid hormone (PTH) gene has been analyzed by Southern blot hybridization of genomic DNA and by nucleotide sequence analysis of a cloned PTH gene. In the Southern analysis, several restriction enzymes produced single fragments that hybridized to PTH cDNA suggesting that there is a single bovine PTH gene. The restriction map of the cloned gene is the same as that determined by Southern blot analysis of bovine DNA. The sequence of 3154 bp of the cloned gene has been determined including 510 bp and 139 bp in the 5' and 3' flanking regions, respectively. The gene contains two introns which separate three exons that code primarily for: (i) the 5' untranslated region, (ii) the pre-sequence of preProPTH, and (iii) PTH and the 3' untranslated region. The gene contains 68% A + T and unusually long stretches of 100- to 150-bp sequences containing alternating A and T nucleotides in the 5' flanking region and intron A. The 5' flanking region contains two TATA sequences, both of which appear to be functional as determined by S1 nuclease mapping. Compared to the rat and human genes, the locations of the introns are identical but the sizes differ. Comparable human and bovine sequences in the flanking regions and introns are about 80% homologous.