The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.     

Analysis of the calcium-dependent interaction of calmodulin with bovine serum albumin

An air-driven ultracentrifuge has been used to investigate the calcium-dependent association between calmodulin and bovine serum albumin. Procedures were described which allowed the interaction to be analyzed to yield the equilibrium constant. At low ionic strength (25 mm Tris-HCl, pH 7.5, pCa 6.68, 9°C) the equilibrium constant for the interaction was estimated to be 2.1 × 10⁴m⁻¹, while at high ionic strength (25 mm Tris-HCl, pH 7.5, 150 mm KCl, pCa 6.68, 9°C) the value was 4.5 × 10³m⁻¹. Under similar conditions, calmodulin was also found to interact with β-lactoglobulin A and gelatin, but no detectable association was observed with ovalbumin.     

Spectroscopic study of the interaction of gossypol with bovine serum albumin

The interaction of gossypol with bovine serum albumin (BSA) at pH 7.6 in 0.02 M borax-borate buffer has been followed by circular dichroism (CD) and difference spectroscopy. From the extrinsic CD band at 390 nm, a binding constant of 2.7 X 10(3) M-1 was calculated. At 54 degrees the induced CD spectrum was abolished, suggesting that the interaction is not favoured at that temperature. The effect of various solvents and salts on the interaction has been followed by difference spectroscopy. The modification of epsilon-amino groups of lysine did not affect the interaction. Binding of gossypol to BSA does not cause a change in its secondary structure or sedimentation coefficient.     

Spectroscopic studies on the interaction of riboflavin with bovine serum albumin

The mechanism of interaction of riboflavin (RF) with bovine serum albumin (BSA) using fluorometric and circular dichroism (CD) methods has been reported. The association constant (K) for RF-BSA binding shows that the interaction is non-covalent in nature. Stern-Volmer analysis of fluorescence quenching data shows that the fraction of fluorophore (BSA) accessible to the quencher (RF) is close to unity, indicating that both tryptophan residues of BSA are involved in the interaction. The high magnitude of rate constant for quenching kq (10(13) M(-1) s(-1) indicates that RF binding site is in close proximity to tryptophan residue of BSA. Thermodynamic parameters obtained from data at different temperatures showed that the binding of RF to BSA predominantly involves the formation of hydrophobic bonds. Binding studies in the presence of a hydrophobic probe 8-anilino-1-naphthalene sulphonic acid, sodium salt (ANS) showed that RF and ANS do not share common sites in BSA. The small decrease in critical micellar concentration of anionic surfactant, sodium dodecyl sulphate in the presence of RF shows that ionic character of RF also contributes to binding and is not solubilized inside the micelle. Significant decrease in concentration of free RF has been observed in the presence of paracetamol. The CD spectrum shows the binding of RF leads to a change in the alpha helical structure of BSA.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

The interaction of tylophorinidine,a potential leukemic drug,with bovine serum albumin

Association of tylophorinidine with bovine serum albumin was indioated by the quenching of the protein fluorescence above pH 7.0. The association constant, Ka, at pH 9.2 was calculated to be 5 × 10⁴ litres/mole. The Ka increased with increasing temperature, and the change in enthalpy, ΔH, was calculated to be 4.5 Kcals. The stoichionetry of binding obtained from Job's plot was 1:1. The data suggest involvement of tryptophan and hydrophobic forces in the albumintylophorinidine complex.     

Fluorescence spectrometric study on the interaction of tamibarotene with bovine serum albumin

The interaction between tamibarotene and bovine serum albumin (BSA) was studied using fluorescence quenching technique and ultraviolet–visible spectrophotometry. The results of experiments showed that tamibarotene could strongly quench the intrinsic fluorescence of BSA by a dynamic quenching mechanism. The apparent binding constant, number of binding site and corresponding thermodynamic parameters at different temperatures were calculated respectively, and the main interaction force between tamibarotene and BSA was proved to be hydrophobic force. Synchronous fluorescence spectra showed that tamibarotene changed the molecular conformation of BSA. When BSA concentration was 1.00 × 10^?6 mol L^?1, the quenched fluorescence ΔF had a good linear relationship with the concentration of tamibarotene in the range 1.00 × 10^?6 to 12.00 × 10^?6 mol L^?1 with the detection limit of 6.52 × 10^?7 mol L^?1. Copyright © 2010 John Wiley & Sons, Ltd.     

The subsequent effect of interaction between Co(2+) and human serum albumin or bovine serum albumin.

A notable hysteretic effect has been observed in the interaction of Co(II) with human serum albumin (HSA) or bovine serum albumin (BSA) using UV-Visible spectrometry at physiological pH (7.43), which shows that the binding between Co(II) and HSA or BSA may induce a slow transition of HSA or BSA from the conformation of weaker affinity for Co(II) to one of stronger affinity (A-B transition). The rate constants and activation parameters of this transition were measured and are discussed. It is inferred that such a conformation transition may occur due to the binding of the first Co(II) ion with the peptide segment of N-terminal residues 1-3, which results in a 'hinged movement' of the relatively hydrophobic 'valley' in the IA subdomain. This process leads to a slow conformational transition in the albumins, makes the other binding sites of Co(II) exposed, and shows a positive cooperativity effect. The LMCT (ligand-to-metal charge transition) bands of the Co(II)-HSA and Co(II)-BSA systems also show a kind of hypochromic effect featuring a dipole-dipole interaction mechanism. This phenomenon is rarely reported.     

Study on the interaction of chromate with bovine serum albumin by spectroscopic method

The interaction between two chromates [sodium chromate (Na₂CrO₄) and potassium chromate K₂CrO₄)] and bovine serum albumin (BSA) in physiological buffer (pH 7.4) was investigated by the fluorescence quenching technique. The results of fluorescence titration revealed that two chromates could strongly quench the intrinsic fluorescence of BSA through a static quenching procedure. The apparent binding constants K and number of binding sites n of chromate with BSA were obtained by the fluorescence quenching method. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) were negative, indicating that the interaction of two chromates with BSA was driven mainly by van der Waals forces and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. The distance r between donor (BSA) and acceptor (chromate) was calculated based on Forster’s non-radiative energy transfer theory. The results of UV–Vis absorption, synchronous fluorescence, three-dimensional fluorescence and circular dichroism (CD) spectra showed that two chromates induced conformational changes of BSA.     

The acylation of bovine serum albumin with diacetylcycloserine.

The reaction of the amino groups of bovine serum albumin (BSA) with diacetylcycloserine (I) at pH 7.2-9.0 proceeded with both acylation by the diacetyl-beta-aminooxy-D-alanyl (DAA) group and acetylation. The number of DAA groups was determined by their conversion to cycloserine (III) which can be accurately measured in micromolar amounts. The method was developed using the model compound diacetyl-beta-aminooxy-D-alanine butyl amide (II) which was converted to beta-aminooxy-D-alanine butyl amide (IV) by methanolysis and then to cycloserine by basic ring-closure of IV. Calculations using results obtained by this method combined with the experimentally determined number of free amino groups in the modified BSA indicated that the reaction of excess I with BSA effected the acetylation of about 35 and the acylation with DAA groups of about 22 of the 59 amino groups. These findings were supported by experiments demonstrating that the amount of acetic acid formed by hydrolysis of the modified BSA was approximately that predicted from the results of the cycloserine analyses.