On the kinetics of helix formation between complementary ribohomopolymes and deoxyribohomopolymers

The rate of double helix formation by single-stranded poly A plus poly dT, poly dA plus poly U, poly dA plus dT, poly G plus poly dC, poly dG plus poly C, and poly dG plus poly dC have been investigated and compared to rates of ribohomopolymer helix formation rates. After correction for molecular weight, comparisons of rate data at 30°C below the melting temperature of the double helix show that:

• 1 Rates of helix formation by all combinations of guanine plus cytosine homopolymers are the same.
• 1 The rate of helix formation for poly dA plus poly dT is three times faster than the rate for poly A plus poly U. Rates of formation of DNA-RNA hybrid molecules are intermediate between these two rates, but closer to the poly dA plus poly dT rate.

The effect of temperature on the rate of helix formation is interpreted in terms of a steady-state model for helix propagation. The results are consistent with a mechanism in which the formation of the second base pair is the rate-determining step.     

Local effects of partial adenine-N1-oxidation on poly A-poly U and poly A-2 poly U helix conformations

We prepared helices with noncomplementary bases by N1-oxidation of poly A, followed by reaction with poly U. Mixing curves indicate that doubly and triply helical structures form, with only the unmodified adenines involved in base pair formation. Circular dichroism spectra were examined particularly at the absorbance maximum of the adenine N1-oxide (A*). In the single strand poly (A,A*), there is a relatively strong pair of positive and negative CD bands from the A*. These are greatly reduced in the double helix, and abolished in the triple helix. We conclude that A* stacks in a conventional manner with A in the single strand, but is rotated out of the double and triple helix. In the double helix the A* probably maintains a preferred orientation with respect to the helix, but rotates randomly in the triple helix.     

Extension of the range of DNA sequences available for triple helix formation: stabilization of mismatched triplexes by acridine-containing oligonucleotides.

Triple helix formation usually requires an oligopyrimidine*oligopurine sequence in the target DNA. A triple helix is destabilized when the oligopyrimidine*oligopurine target contains one (or two) purine*pyrimidine base pair inversion(s). Such an imperfect target sequence can be recognized by a third strand oligonucleotide containing an internally incorporated acridine intercalator facing the inverted purine*pyrimidine base pair(s). The loss of triplex stability due to the mismatch is partially overcome. The stability of triplexes formed at perfect and imperfect target sequences was investigated by UV thermal denaturation experiments. The stabilization provided by an internally incorporated acridine third strand oligonucleotide depends on the sequences flanking the inverted base pair. For triplexes containing a single mismatch the highest stabilization is observed for an acridine or a propanediol tethered to an acridine on its 3'-side facing an inverted A*T base pair and for a cytosine with an acridine incorporated to its 3'-side or a guanine with an acridine at its 5'-side facing an inverted G*C base pair. Fluorescence studies provided evidence that the acridine was intercalated into the triplex. The target sequences containing a double base pair inversion which form very unstable triplexes can still be recognized by oligonucleotides provided they contain an appropriately incorporated acridine facing the double mismatch sites. Selectivity for an A*T base pair inversion was observed with an oligonucleotide containing an acridine incorporated at the mismatched site when this site is flanked by two T*A*T base triplets. These results show that the range of DNA base sequences available for triplex formation can be extended by using oligonucleotide intercalator conjugates.     

The structure of triple helical poly(U).poly(A).poly(U) studied by Raman spectroscopy

Using Raman spectroscopy, we examined the ribose-phosphate backbone conformation, the hydrogen bonding interactions, and the stacking of the bases of the poly(U).poly(A).poly(U) triple helix. We compared the Raman spectra of poly(U).poly(A).poly(U) in H2O and D2O with those obtained for single-stranded poly(A) and poly(U) and for double-stranded poly(A).poly(U). The presence of a Raman band at 863 cm-1 indicated that the backbone conformations of the two poly(U) chains are different in the triple helix. The sugar conformation of the poly(U) chain held to the poly(A) by Watson-Crick base pairing is C3' endo; that of the second poly(U) chain may be C2' endo. Raman hypochromism of the bands associated with base vibrations demonstrated that uracil residues stack to the same extent in double helical poly(A).poly(U) and in the triple-stranded structure. An increase in the Raman hypochromism of the bands associated with adenine bases indicated that the stacking of adenine residues is greater in the triple helix than in the double helical form. Our data further suggest that the environment of the carbonyls of the uracil residues is different for the different strands.     

The Structure of Triple Helical Poly(U)·Poly(A)·Poly(U) Studied by Raman Spectroscopy

Abstract

Using Raman spectroscopy, we examined the ribose-phosphate backbone conformation, the hydrogen bonding interactions, and the stacking of the bases of the poly(U)·poly(A) ·poly(U) triple helix. We compared the Raman spectra of poly(U)·poly(A)·poly(U) in H₂O and D₂O with those obtained for single-stranded poly(A) and poly(U) and for double-stranded poly(A)·poly(U). The presence of a Raman band at 863 cm^?1 indicated that the backbone conformations of the two poly(U) chains are different in the triple helix. The sugar conformation of the poly(U) chain held to the poly(A) by Watson-Crick base pairing is C3′ endo; that of the second poly(U) chain may be C2′ endo. Raman hypochromism of the bands associated with base vibrations demonstrated that uracil residues stack to the same extent in double helical poly(A)·poly(U) and in the triple-stranded structure. An increase in the Raman hypochromism of the bands associated with adenine bases indicated that the stacking of adenine residues is greater in the triple helix than in the double helical form. Our data further suggest that the environment of the carbonyls of the uracil residues is different for the different strands.     

Effects of internal nonbonded bases and a G.U base pair on the stability of a short ribonucleic acid helix.

Proton nuclear magnetic resonance has been used to examine the effect of both noncomplementary and G.U oppositions in the duplexes formed by the synthetic pentaribonucleotides CpApApUpG, CpApUpUpG, CpApGpUpG, and CpApCpUpG. The lack of any sigmoidal behavior in the chemical shift vs. temperature plots of the base protons in the individual pentaribonucleotides indicates that duplexes with noncomplementary base oppositions of the type: formula: (see text), (where X = A, U, G, or C) do not form. Variable temperature spectra of the mixture of CpApGpUpG and CpApUpUpG were recorded over the range of 70--10 degrees C. The chemical shift vs. temperature plot of the purine aromatic protons displayed sigmoidal curves. This demonstrated both duplex formation and the presence of a G.U. base pair. The average Tm of the duplex was found to be 23.4 +/- 2.0 degrees C. This is similar to that of the duplex formed by CpApUpG (24.0 +/- 1.0 degrees C) but less than the Tm of the following duplexes: CpApApUpG:CpApUpUpG (Tm = 28.5 +/- 2.1 degrees C), CpApGpUpG:CpApCpUpG (Tm = 38.4 +/- 0.6 degrees C) and CpApUpApUpG (Tm = 41.5 +/- 1.1 degrees C). The G.U base pair has a Tm (20.0 degrees C) significantly lower than the rest of the duplex (24 +/- 1 degree C) and is a region of local instability within the double helix. This 1H NMR study is the first to investigate both the formation and relative stability of an internal G.U. base pair neighboring regular Watson--Crick base pairs.     

Structural studies of DNA fragments: the G.T wobble base pair in A, B and Z DNA; the G.A base pair in B-DNA

The crystal structures of five double helical DNA fragments containing non-Watson-Crick complementary base pairs are reviewed. They comprise four fragments containing G.T base pairs: two deoxyoctamers d(GGGGCTCC) and d(GGGGTCCC) which crystallise as A type helices; a deoxydodecamer d(CGCGAATTTGCG) which crystallises in the B-DNA conformation; and the deoxyhexamer d(TGCGCG), which crystallises as a Z-DNA helix. In all four duplexes the G and T bases form wobble base pairs, with bases in the major tautomer forms and hydrogen bonds linking N1 of G with O2 of T and O6 of G with N3 of T. The X-ray analyses establish that the G.T wobble base pair can be accommodated in the A, B or Z double helix with minimal distortion of the global conformation. There are, however, changes in base stacking in the neighbourhood of the mismatched bases. The fifth structure, d(CGCGAATTAGCG), contains the purine purine mismatch G.A where G is in the anti and A in the syn conformation. The results represent the first direct structure determinations of base pair mismatches in DNA fragments and are discussed in relation to the fidelity of replication and mismatch recognition.     

Molecular aspects on the specific interaction of cytotoxic plant alkaloid palmatine to poly(A)

The interaction of the protoberberine alkaloid palmatine with single and double stranded structures of poly(A) was studied by various biophysical techniques. Comparative binding studies were also performed with double stranded DNA, t-RNA, poly(C)·poly(G), poly(U) and poly(C). The results of competition dialysis, fluorescence, and absorption spectral studies converge to reveal the molecular aspects of the strong and specific binding of palmatine to single stranded poly(A). The binding affinity of palmatine to natural DNA, t-RNA and double stranded poly(A) was weaker while no binding was apparent with single stranded poly(U), poly(C) and double stranded poly(C)·poly(G). The strong affinity of the alkaloid to single stranded poly(A) in comparison to the double stranded structure was also revealed from circular dichroic and viscometric studies. The effect of [Na⁺] ion concentration on the binding process revealed the significant role of electrostatic forces in the complexation. The presence of bound alkaloid also remarkably affected denaturation–renaturation of stacked helical poly(A). The energetics of the strong binding to poly(A) was studied from thermodynamic estimation from van Hoff’ analysis of the temperature dependent binding constants and ultra sensitive isothermal titration calorimertry, both suggesting the binding to be exothermic and enthalpy driven. This study provides detailed insight into the binding specificity of the natural alkaloid to single stranded poly(A) over several other single and double stranded nucleic acid structures suggesting its potential as a lead compound for RNA based drug targeting.     

Conformational features of the four successive non-Watson-Crick base pairs in RNA duplex.

A tridecaribonucleotide, r(UGAGCUUCGGCUC) doesn't form hairpin or interior loop and forms a double helix of 12 base pairs including the four successive nonstandard base pairs, U.G-U.C-C.U-G.U, in the crystal. Non-Watson-Crick base pairs, G.U and U.C are nicely incorporated in RNA duplex maintaining the regular A-form backbone. There exist the good overlapping between base pairings, U.G and U.C, so as to stabilize the nonstandard base pair track. Hydrogen bond networks involving water molecules in the major and minor grooves to stabilize this mismatch base pairing array, are observed and its conformational features are described.     

The structure of guanosine-thymidine mismatches in B-DNA at 2.5-A resolution

The structure of the deoxyoligomer d(C-G-C-G-A-A-T-T-T-G-C-G) was determined at 2.5-A resolution by single crystal x-ray diffraction techniques. The final R factor is 18% with the location of 71 water molecules. The oligomer crystallizes in a B-DNA-type conformation, with two strands interacting to form a dodecamer duplex. The double helix consists of four A X T and six G X C Watson-Crick base pairs and two G X T mismatches. The G X T pairs adopt a "wobble" structure with the thymine projecting into the major groove and the guanine into the minor groove. The mispairs are accommodated in the normal double helix by small adjustments in the conformation of the sugar phosphate backbone. A comparison with the isomorphous parent compound containing only Watson-Crick base pairs shows that any changes in the structure induced by the presence of G X T mispairs are highly localized. The global conformation of the duplex is conserved. The G X T mismatch has already been studied by x-ray techniques in A and Z helices where similar results were found. The geometry of the mispair is essentially identical in all structures so far examined, irrespective of the DNA conformation. The hydration is also similar with solvent molecules bridging the functional groups of the bases via hydrogen bonds. Hydration may be an important factor in stabilizing G X T mismatches. A characteristic of Watson-Crick paired A X T and G X C bases is the pseudo 2-fold symmetry axis in the plane of the base pairs. The G X T wobble base pair is pronouncedly asymmetric. This asymmetry, coupled with the disposition of functional groups in the major and minor grooves, provides a number of features which may contribute to the recognition of the mismatch by repair enzymes.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Interactions between an anthracycline antibiotic and DNA: molecular structure of daunomycin complexed to d(CpGpTpApCpG) at 1.2-A resolution

The crystal structure of a daunomycin-d(CGTACG) complex has been solved by X-ray diffraction analysis and refined to a final R factor of 0.175 at 1.2-A resolution. The crystals are in a tetragonal crystal system with space group P4(1)2(1)2 and cell dimensions of a = b = 27.86 A and c = 52.72 A. The self-complementary DNA forms a six base pair right-handed double helix with two daunomycin molecules intercalated in the d(CpG) sequences at either end of the helix. Daunomycin in the complex has a conformation different from that of daunomycin alone. The daunomycin aglycon chromophore is oriented at right angles to the long dimension of the DNA base pairs, and the cyclohexene ring A rests in the minor groove of the double helix. Substituents on this ring have hydrogen-bonding interactions to the base pairs above and below the intercalation site. O9 hydroxyl group of the daunomycin forms two hydrogen bonds with N3 and N2 of an adjacent guanine base. Two bridging water molecules between the drug and DNA stabilize the complex in the minor groove. In the major groove, a hydrated sodium ion is coordinated to N7 of the terminal guanine and the O4 and O5 of daunomycin with a distorted octahedral geometry. The amino sugar lies in the minor groove without bonding to the DNA. The DNA double helix is distorted with an asymmetrical rearrangement of the backbone conformation surrounding the intercalator drug. The sugar puckers are C1,C2'-endo, G2,C1'-endo, C11,C1'-endo, and G12,C3'-exo. Only the C1 residue has a normal anti-glycosyl torsion angle (chi = -154 degrees), while the other three residues are all in the high anti range (average chi = -86 degrees). This structure allows us to identify three principal functional components of anthracycline antibiotics: the intercalator (rings B-D), the anchoring functions associated with ring A, and the amino sugar. The structure-function relationships of daunomycin binding to DNA as well as other related anticancer drugs are discussed.     

Structural Studies of DNA Fragments: The G·T Wobble Base Pair in A,B and Z DNA; The G·A Base Pair in B-DNA

Abstract

The crystal structures of five double helical DNA fragments containing non-Watson-Crick complementary base pairs are reviewed. They comprise four fragments containing G·T base pairs: two deoxyoctamers d(GGGGCTCC) and d(GGGGTCCC) which crystallise as A type helices; a deoxydodecamer d(CGCGAATTTGCG) which crystallises in the B-DNA conformation; and the deoxyhexamer d(TGCGCG), which crystallises as a Z-DNA helix. In all four duplexes the G and T bases form wobble base pairs, with bases in the major tautomer forms and hydrogen bonds linking N1 of G with 02 of T and 06 of G with N3 of T. The X-ray analyses establish that the G·T wobble base pair can be accommodated in the A, B or Z double helix with minimal distortion of the global conformation. There are, however, changes in base stacking in the neighbourhood of the mismatched bases. The fifth structure, d(CGCGAATTAGCG), contains the purine purine mismatch G·A where G is in the anti and A in the syn conformation. The results represent the first direct structure determinations of base pair mismatches in DNA fragments and are discussed in relation to the fidelity of replication and mismatch recognition.     

Role of acceptor stem conformation in tRNAVal recognition by its cognate synthetase.

Although the anticodon is the primary element in Escherichia coli tRNAValfor recognition by valyl-tRNA synthetase (ValRS), nucleotides in the acceptor stem and other parts of the tRNA modulate recognition. Study of the steady state aminoacylation kinetics of acceptor stem mutants of E.coli tRNAValdemonstrates that replacing any base pair in the acceptor helix with another Watson-Crick base pair has little effect on aminoacylation efficiency. The absence of essential recognition nucleotides in the acceptor helix was confirmed by converting E.coli tRNAAlaand yeast tRNAPhe, whose acceptor stem sequences differ significantly from that of tRNAVal, to efficient valine acceptors. This transformation requires, in addition to a valine anticodon, replacement of the G:U base pair in the acceptor stem of these tRNAs. Mutational analysis of tRNAValverifies that G:U base pairs in the acceptor helix act as negative determinants of synthetase recognition. Insertion of G:U in place of the conserved U4:A69 in tRNAValreduces the efficiency of aminoacylation, due largely to an increase in K m. A smaller but significant decline in aminoacylation efficiency occurs when G:U is located at position 3:70; lesser effects are observed for G:U at other positions in the acceptor helix. The negative effects of G:U base pairs are strongly correlated with changes in helix structure in the vicinity of position 4:69 as monitored by19F NMR spectroscopy of 5-fluorouracil-substituted tRNAVal. This suggests that maintaining regular A-type RNA helix geometry in the acceptor stem is important for proper recognition of tRNAValby valyl-tRNA synthetase.19F NMR also shows that formation of the tRNAVal-valyl-tRNA synthetase complex does not disrupt the first base pair in the acceptor stem, a result different from that reported for the tRNAGln-glutaminyl-tRNA synthetase complex.     

Poly(8-aminoguanylic acid): formation of ordered self-structures and interaction with poly(cytidylic acid).

Poly(8-aminoguanylic acid) has in neutral solution a novel ordered structure of high stability. The 8-amino group permits formation of three hydrogen bonds between two residues along the "top", or long axis, of the purines. The usual hydrogen bonding protons and Watson-Crick pairing sites are not involved in the association. The bonding scheme has a twofold rotation axis and is hemiprotonated at N(7). Poly(8NH2G) is converted by alkaline titration (pK = 9.7) to a quite different ordered structure, which is the favored form over the range approximately pH 10-11. The bonding scheme appears to be composed of a planar, tetrameric array of guanine residues, in which the 8-amino group does not participate in interbase hydrogen bonding. Poly (8NH2G) does not interact with poly(C) in neutral solution because of the high stability of the hemiprotonated G-G self-structure. Titration to the alkaline plateau, however, permits ready formation of a two-stranded Watson-Crick helix. In contrast to the monomer 8NH2GMP, poly(8NH2G) does not form a triple helix with poly(C) under any conditions. The properties of the ordered structures are interpreted in terms of a strong tendency of the 8-amino group to form a third interbase hydrogen bond, when this possibility is not prevented by high pH.     

Solution Structure of a GAAG Tetraloop in Helix 6 of SRP RNA from Pyrococcus furiosus

The NMR structure of a 12-mer RNA derived from the helix 6 of SRP RNA from Pyrococcus furiosus, whose loop-closing base pair is U:G, was determined, and the structural and thermodynamic properties of the RNA were compared with those of a mutant RNA with the C:G closing base pair. Although the structures of the two RNAs are similar to each other and adopt the GNRR motif, the conformational stabilities are significantly different to each other. It was suggested that weaker stacking interaction of the GAAG loop with the U:G closing base pair in 12-mer RNA causes the lower conformational stability.     

Macrocyclic zinc(II) complexes for selective recognition of nucleobases in single- and double-stranded polynucleotides

 As an extension of our earlier discoveries that Zn^II-cyclen complex (1) (cyclen=1,4,7,10-tetraazacyclododecane) and Zn^II-acridine-pendant cyclen complex Zn^II-N-(9-acridin)ylmethyl-cyclen (3) are the first compounds to selectively recognize thymidine and uridine nucleosides in aqueous solution at physiological pH, the interaction of these and a relevant complex, bis(Zn^II-cyclen) (7), has been investigated with a series of polynucleotides, single-stranded poly(U) and poly(G), and double-stranded poly(A)·poly(U), poly(dA)·poly(dT) and poly(dG)·poly(dC). These Zn^II-cyclen complexes interact with the imide-containing nucleobases in the single-stranded poly(U), unperturbed by the presence of the anionic phosphodiester backbone. The affinity constant of 1 for each N(3)-deprotonated uracil base in poly(U) is determined to be log K= 5.1 by a kinetic measurement, which is almost the same as log K=5.2 for the interaction of 1 with uridine. Thus, they disrupt the A-U (or A-T) hydrogen bonds to unzip the duplex of poly(A)·poly(U) or poly(dA)·poly(dT), as demonstrated by lowering of the melting temperatures (T _m) of poly(A)·poly(U) and poly(dA)·poly(dT) in 5 mM Tris-HCl buffer (pH 7.6, 10 mM NaCl) with increase in their concentrations. The order of the denaturing efficiency is well correlated with that of the 1 : 1 affinity constants for each complex with uracil or thymine;7>3>1. The comparison of circular dichroism (CD) spectra for poly(A)·poly(U), poly(A), and poly(U) in the presence of 3 has revealed a structural change from poly(A)·poly(U) to two single strands, poly(A) and poly(U), caused by 3 binding exclusively to uracils in poly(U). On the other hand, the acridine-pendant cyclen complex 3, which earlier was found to associate with guanine by the Zn^II coordinating with guanine N(7), in addition to the π-π stacking, interacts with guanine in the double helix of poly(dG)·poly(dC) from outside and stabilized the double-stranded structure, as indicated by higher T _m. Received: 31 December 1997 / Accepted: 23 February 1998     

Is there a special function for U.G basepairs in ribosomal RNA?

U.G basepairs are well-established elements of RNA structure. The geometry of this pair is different, however, from classical Watson-Crick basepairs. This leads to an unusual stacking of the basepair: overlap with the basepair at the 5' side of the U (and the 3' side of the G) is strong (stacked) while it is weak with the basepair on the other side (destacked). The closure of an RNA helix by a U.G pair will be energetically unfavourable when the U residue occupies the 5' end. In transfer RNA there is a strong selection against a 'destacked' U.G pair at helix ends. In the 16S rRNA model of Escherichia coli there are 72 U.G pairs of which 36 or 22 occupy a helix end, depending on how such an end is defined. There is a slight preference for 'stacked' U.G's in these positions. It is remarkable, however, that of 13 very conserved U.G pairs in the 16S (-like) rRNA, 7 occur at helix ends and that 5 of these have the 'destacked' configuration. It is suggested that these pairs, if they exist at all in a hydrogen-bounded form, are stabilized by co-axial stacking with other helices or by interaction with a protein.     

Divalent metal ion binding to a conserved wobble pair defining the upstream site of cleavage of group I self-splicing introns.

The upstream site of cleavage of all group I self-splicing introns is identified by an absolutely conserved U.G base pair. Although a wobble C.A pair can substitute the U.G pair, all other combinations of nucleotides at this position abolish splicing, suggesting that it is an unusual RNA structure, rather than sequence, that is recognized by the catalytic intron core. RNA enzymes are metalloenzymes, and divalent metal ion binding may be an important requirement for splice site recognition and catalysis. The paramagnetic broadening of NMR resonances upon manganese binding at specific sites was used to probe the interaction between divalent metal ions and an oligonucleotide model of a group I intron ribozyme substrate. Unlike previous studies in which only imino proton resonances were monitored, we have used isotopically labelled RNA and a set of complete spectral assignments to identify the location of the divalent metal binding site with much greater detail than previously possible. Two independent metal binding sites were identified for this oligonucleotide. A first metal binding site is located in the major groove of the three consecutive G.C base pairs at the end of double helical stem. A second site is found in the major groove of the RNA double helix in the vicinity of the U.G base pair. These results suggest that metal ion coordination (or a metal bridge) and tertiary interactions identified biochemically, may be used by group I intron ribozymes for substrate recognition.     

Vibrational fluctuations of hydrogen bonds in a DNA double helix with nonuniform base pairs.

The Green's function technique is applied to a study of breathing modes in a DNA double helix which contains a region of different base pairs from the rest of the double helix. The calculation is performed on a G-C helix in the B conformation with four consecutive base pairs replaced by A-T. The average stretch in hydrogen bonds is found amplified around the A-T base pair region compared with that of poly(dG)-poly(dC). This is likely related to the A-T regions lower stability against hydrogen bond melting. The A-T region may be considered to be the initiation site for melting in such a helix.