A protein which specifically binds to single stranded TTAGGGn repeats.

Nuclei from tissues of many vertebrates contain a soluble 37 kd protein which binds with a high degree of specificity to oligonucleotides which contain the G rich strand of the telomeric terminal repeats, TTAGGG. In some tissues this is an abundant nuclear protein.     

Interaction of hnRNP A2/B1 isoforms with telomeric ssDNA and the in vitro function

Overexpression of heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1, especially of B1 has been reported as a useful marker to detect cancers in early stage, although the biological reason is not clear. A2/B1 proteins were previously reported to bind telomeric DNA repeats. Alternative splicing of A2/B1 gene produces abundant A2, less abundant B1, and testis-specific minor isoforms B0a and B0b. In this study, B1 and B0b that have the N-terminal 12 amino acid insertion were suggested to have higher affinities to telomeric single-stranded DNA (ssDNA) than A2 and B0a. Kinetic analyses using purified B1 and B0b indicated that they interact dynamically with a single array of telomeric repeats. Furthermore, functional assays demonstrated that B1 and B0b bind with telomeric repeats in a tandem fashion and protect them from a nuclease and promote telomerase activity. A2/B1 proteins, especially B1 and B0b, may function as telomeric ssDNA-binding proteins in cancer and reproductive cells.     

The p53 target protein Wig-1 binds hnRNP A2/B1 and RNA Helicase A via RNA

The p53-induced Wig-1 gene encodes a double stranded RNA-binding zinc finger protein. We generated Saos-2 osteosarcoma cells expressing tetracycline-inducible Flag-tagged human Wig-1. Induction of Wig-1 expression by doxycycline inhibited cell growth in a long-term assay but did not cause any changes in cell cycle distribution nor increased fraction of apoptotic cells. Using co-immunoprecipitation and mass spectrometry, we identified two Wig-1-binding proteins, hnRNP A2/B1 and RNA Helicase A, both of which are involved in RNA processing. The binding was dependent on the presence of RNA. Our results establish a link between the p53 tumor suppressor and RNA processing via hnRNPA2/B1 and RNA Helicase A.     

The yeast protein encoded by PUB1 binds T-rich single stranded DNA.

We have characterized binding activities in yeast which recognise the T-rich strand of the yeast ARS consensus element and have purified two of these to homogeneity. One (ACBP-60) is detectable in both nuclear and whole cell extracts, while the other (ACBP-67) is apparent only after fractionation of extracts by heparin-sepharose chromatography. The major binding activity detected in nuclear extracts was purified on a sequence-specific DNA affinity column as a single polypeptide with apparent mobility of 60kDa (ACBP-60). This protein co-fractionates with nuclei, is present at several thousand copies per cell and has a Kd for the T-rich single strand of the ARS consensus between 10(-9) and 10(-10) M. Competition studies with simple nucleic acid polymers show that ACBP-60 has marginally higher affinity for poly dT30 than for a 30 nt oligomer containing the T-rich strand of ARS 307, and approximately 10 fold higher affinity for poly rU. Internal sequence information of purified p60 reveals identity with the open reading frames of genes PUB1 and RNP1 which encode polyuridylate binding protein(s). The second binding activity, ACBP-67, also binds specifically to the T-rich single strand of the ARS consensus, but with considerably lower affinity than ACBP-60. Peptide sequence reveals that the 67kDa protein is identical to the major polyA binding protein in yeast, PAB1.     

Function of conserved domains of hnRNP A1 and other hnRNP A/B proteins.

hnRNP A1 is a pre-mRNA binding protein that antagonizes the alternative splicing activity of splicing factors SF2/ASF or SC35, causing activation of distal 5' splice sites. The structural requirements for hnRNP A1 function were determined by mutagenesis of recombinant human hnRNP A1. Two conserved Phe residues in the RNP-1 submotif of each of two RNA recognition motifs appear to be involved in specific RNA-protein interactions and are essential for modulating alternative splicing. These residues are not required for general pre-mRNA binding or RNA annealing activity. The C-terminal Gly-rich domain is necessary for alternative splicing activity, for stable RNA binding and for optimal RNA annealing activity. hnRNP A1B, which is an alternatively spliced isoform of hnRNP A1 with a longer Gly-rich domain, binds more strongly to pre-mRNA but has only limited alternative splicing activity. In contrast, hnRNP A2 and B1, which have 68% amino acid identity with hnRNP A1, bind more weakly to pre-mRNA and have stronger splice site switching activities than hnRNP A1. We propose that specific combinations of antagonistic hnRNP A/B and SR proteins are involved in regulating alternative splicing of distinct subsets of cellular premRNAs.     

Heterogeneous nuclear ribonucleoprotein (hnRNP) E1 binds to hnRNP A2 and inhibits translation of A2 response element mRNAs

Heterogeneous nuclear ribonucleoprotein (hnRNP) A2 is a trans-acting RNA-binding protein that mediates trafficking of RNAs containing the cis-acting A2 response element (A2RE). Previous work has shown that A2RE RNAs are transported to myelin in oligodendrocytes and to dendrites in neurons. hnRNP E1 is an RNA-binding protein that regulates translation of specific mRNAs. Here, we show by yeast two-hybrid analysis, in vivo and in vitro coimmunoprecipitation, in vitro cross-linking, and fluorescence correlation spectroscopy that hnRNP E1 binds to hnRNP A2 and is recruited to A2RE RNA in an hnRNP A2-dependent manner. hnRNP E1 is colocalized with hnRNP A2 and A2RE mRNA in granules in dendrites of oligodendrocytes. Overexpression of hnRNP E1 or microinjection of exogenous hnRNP E1 in neural cells inhibits translation of A2RE mRNA, but not of non-A2RE RNA. Excess hnRNP E1 added to an in vitro translation system reduces translation efficiency of A2RE mRNA, but not of nonA2RE RNA, in an hnRNP A2-dependent manner. These results are consistent with a model where hnRNP E1 recruited to A2RE RNA granules by binding to hnRNP A2 inhibits translation of A2RE RNA during granule transport.     

A novel hnRNP specifically interacts with HIV-1 RRE RNA

We have identified and obtained the full-length clone of RREBP49, a human nuclear factor which specifically interacts with the Rev-responsive element (RRE) sequence of human immunodeficiency virus type 1. Sequence analysis revealed that RREBP49 is highly homologous to hnRNP F protein and contains three repeated RNA-binding domains. Binding assays demonstrated that Rev and RREBP49 bind to different subregions on the RRE sequence and that binding is mutually nonexclusive. Blocking of endogenous RREBP49 expression by an antisense construct increases Rev activity in CV-1 cells, indicating that RREBP49 and Rev may play antagonistic roles in HIV-1 replication. RREBP49 may function as a splicing factor or a nuclear retention factor for unspliced mRNAs. However, only a slight decrease of Rev activity was observed when exogenous RREBP49 was introduced into CV-1 cells by pSVL-RREBP49 expression vector. This may be explained by a high endogenous level of RREBP49 which is above optimal. Alternatively, additional cellular factors may be required for RREBP49-mediated inhibition of Rev.     

Drosophila snRNP associated protein P11 which specifically binds to heat shock puff 93D reveals strong homology with hnRNP core protein A1.

We have isolated cDNAs coding for a ribonucleoprotein of Drosophila melanogaster that is distinguished by its nearly exclusive presence at only one of the several heat shock puffs in polytene chromosomes of third instar larvae. We determined the nucleotide sequence and deduced the corresponding amino acid sequence. Its coding capacity for a 39 kDa protein is consistent with the size of the protein detected by the monoclonal antibody P11 used for expression cloning. Our results show that the P11 protein belongs to the category of hnRNP proteins of bipartite structure: the amino-terminal half contains two RNA binding domains and the carboxyterminal half is rich in glycine residues. Analysis of the genomic structure revealed two introns located within the coding portion of the gene and a third one in the 3'untranslated region. We detect two different polyadenylation sites as a result of alternative termination-polyadenylation. Its strong sequence homology with hnRNP A1 protein and its previously shown association with snRNP particles indicates that a typical hnRNP protein may also exist in a complex with snRNP particles. The P11 sequence corresponds to the Hrb87F sequence that was recently described by Haynes et al. (1) as hnRNP A related gene.     

Camptothecin (CPT) directly binds to human heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) and inhibits the hnRNP A1/topoisomerase I interaction

Camptothecin (CPT) is an anti-tumor natural product that forms a ternary complex with topoisomerase I (top I) and DNA (CPT-top I-DNA). In this study, we identified the direct interaction between CPT and human heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) using the T7 phage display technology. On an avidin-agarose bead pull down assay, hnRNP A1 protein was selectively pulled down in the presence of C20-biotinylated CPT derivative (CPT-20-B) both in vitro and in vivo. The interaction was also confirmed by an analysis on a quartz-crystal microbalance (QCM) device, yielding a K_D value of 82.7 nM. A surface plasmon resonance (SPR) analysis revealed that CPT inhibits the binding of hnRNP A1 to top I (K_D: 260 nM) in a non-competitive manner. Moreover, an in vivo drug evaluation assay using Drosophila melanogaster showed that the knockout of the hnRNP A1 homolog Hrb87F gene showed high susceptibility against 5–50 μM of CPT as compared to a wild-type strain. Such susceptibility was specific for CPT and not observed after treatment with other cytotoxic drugs. Collectively, our data suggests that CPT directly binds to hnRNP A1 and non-competitively inhibits the hnRNP A1/top I interaction in vivo. The knockout strain loses the hnRNP A1 homolog as a both CPT-binding partner and naïve brakes of top I, which enhances the formation of the CPT-top I-DNA ternary complexes and subsequently sensitizes the growth inhibitory effect of CPT in D. melanogaster.     

Structural Insight Into hnRNP A2/B1 Homodimerization and DNA Recognition

Heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1) has been identified as a nuclear DNA sensor. Upon viral infection, hnRNP A2/B1 recognizes pathogen-derived DNA as a homodimer, which is a prerequisite for its translocation to the cytoplasm to activate the interferon response. However, the DNA binding mechanism inducing hnRNP A2/B1 homodimerization is unknown. Here, we show the crystal structure of the RNA recognition motif (RRM) of hnRNP A2/B1 in complex with a U-shaped ssDNA, which mediates the formation of a newly observed protein dimer. Our biochemical assays and mutagenesis studies confirm that the hnRNP A2/B1 homodimer forms in solution by binding to pre-generated ssDNA or dsDNA with a U-shaped bulge. These results depict a potential functional state of hnRNP A2/B1 in antiviral immunity and other cellular processes.     

A bovine papillomavirus E1-related protein binds specifically to bovine papillomavirus DNA.

The E1 open reading frame of bovine papillomavirus (BPV) was expressed as a RecA-E1 fusion protein in Escherichia coli. The bacterially expressed RecA-E1 protein exhibited sequence-specific DNA binding activity; strong binding to the region from nucleotides 7819 to 93 on the BPV genome (designated region A) and weak binding to the adjacent region from nucleotides 7457 to 7818 (region B) were observed. The interaction between the BPV-derived RecA-E1 protein and region A appeared to be highly specific for BPV DNA, as no comparable binding was detected with heterologous papillomavirus DNAs. Binding to region A was eliminated by digestion of region A at the unique HpaI site, which suggests that the RecA-E1 binding site(s) was at or near the HpaI recognition sequence. Binding to region B but not region A was observed when nuclear extracts from ID13 cells were used as a source of E1 proteins. The absence of region A binding by ID13 extracts may reflect a negative regulation of E1 DNA binding activity.     

Identification and characterization of a bovine sperm protein that binds specifically to single-stranded telomeric deoxyribonucleic acid

Telomere DNA at the physical termini of chromosomes forms a single-stranded 3' overhang. In lower eukaryotes, e.g., ciliated protozoa, this DNA extension is capped by specific proteins that have been structurally and functionally characterized. Much less is known about single-stranded telomere DNA-binding proteins in vertebrates. Here we describe a new protein from bovine sperm designated bsSSTBP that specifically interacts with single-stranded (TTAGGG)(N) DNA. The bsSSTBP was extracted from nuclei by 0.6 M KCl. The native size of this protein, estimated by gel filtration, was 20-40 kDa. SDS-PAGE of the UV cross-linked complex between bsSSTBP and telomere DNA indicated that several polypeptides are involved in complex formation. Bovine sSSTB had high specificity toward nucleotide sequence, since single nucleotide substitutions in the (TTAGGG)(4) substrate suppressed binding. The minimal number of (TTAGGG) repeats required for binding of bsSSTBP was 3, and the protein recognized linear but not folded DNA structures. We propose that the bsSSTBP participates in telomere-telomere interactions and the telomere membrane localization observed in mature sperm. In mammals, somatic telomere-binding proteins are apparently substituted by sperm-specific ones that may lead to a structural reorganization of telomere domains to fulfill functions important during meiosis and fertilization.     

Differential Subcellular Distributions and Trafficking Functions of hnRNP A2/B1 Spliceoforms

Trafficking of mRNA molecules from the nucleus to distal processes in neural cells is mediated by heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1 trans‐acting factors. Although hnRNP A2/B1 is alternatively spliced to generate four isoforms, most functional studies have not distinguished between these isoforms. Here, we show, using isoform‐specific antibodies and isoform‐specific green fluorescent protein (GFP)‐fusion expression constructs, that A2b is the predominant cytoplasmic isoform in neural cells, suggesting that it may play a key role in mRNA trafficking. The differential subcellular distribution patterns of the individual isoforms are determined by the presence or absence of alternative exons that also affect their dynamic behavior in different cellular compartments, as measured by fluorescence correlation spectroscopy. Expression of A2b is also differentially regulated with age, species and cellular development. Furthermore, coinjection of isoform‐specific antibodies and labeled RNA into live oligodendrocytes shows that the assembly of RNA granules is impaired by blockade of A2b function. These findings suggest that neural cells modulate mRNA trafficking by regulating alternative splicing of hnRNP A2/B1 and controlling expression levels of A2b, which may be the predominant mediator of cytoplasmic‐trafficking functions. These findings highlight the importance of considering isoform‐specific functions for alternatively spliced proteins.     

Characterization of the mouse hnRNP A2/B1/B0 gene and identification of processed pseudogenes

The mouse hnRNP A2/B1/B0 gene has been cloned using a PCR-based strategy and sequenced. Analysis of this sequence showed that the gene organization closely follows that of the human orthologue with 12 exons and 11 introns. The hnRNP A2/B1/B0 gene gives rise to four splice variants through alternative splicing of exons 2 and 9. RT-PCR assays indicated that all splice variants were expressed in mouse brain, skin, and stomach tissues of varying ages, although their ratios to one another varied with age and tissue type. We also identified a small subset of all polyadenylated splice variants that included intron 11, which shows 94% sequence identity between human and mouse. Several processed pseudogenes were identified in the mouse genome. A search of the mouse genome databases located five pseudogenes, four of which are presumed to be non-functional because of the presence of premature stop codons, large deletions or rearrangements within the coding region. The fifth, which possesses putative promoter elements and has a coding sequence identical to that of the hnRNP A2 mRNA variant, may be functional.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Saccharomyces cerevisiae RAP1 binds to telomeric sequences with spatial flexibility

A wide divergence has been detected in the telomeric sequences among budding yeast species. Despite their length and homogeneity differences, all these yeast telomeric sequences show a conserved core which closely matches the consensus RAP1-binding sequence. We demonstrate that the RAP1 protein binds this sequence core, without involving the diverged sequences outside the core. In Saccharomyces castellii and Saccharomyces dairensis specific classes of interspersed variant repeats are present. We show here that a RAP1-binding site is formed in these species by connecting two consecutive 8 bp telomeric repeats. DNase I footprint analyses specify the binding site as the 13 bp sequence CTGGGTGTCTGGG. The RAP1 protein also binds the variant repeats, although with a lowered affinity. However, a split footprint is produced when RAP1 binds a variant repeat where the two half-sites of the binding site are separated by an additional 6 nt. This is probably caused by the intervening sequence looping out of the RAP1-DNA complex. We suggest that the bipartite subdomain structure of the RAP1 protein allows it to remodel telomeric chromatin, a feature which may be of great relevance for telomeric chromatin assembly and structure in vivo.