A selective medium and a specific probe for detection of Vibrio vulnificus

A selective medium (VVM) and a specific 16S rRNA gene (rDNA) probe (V3VV) for the detection of Vibrio vulnificus were developed. The medium contains D-(+)-cellobiose as the main carbon source and electrolytes (MgCl(2)-6H(2)O and KCl), which stimulate bacterial growth. Polymyxin B, colistin, and moderate alkalinity and salinity provide selectivity properties. V. vulnificus grows on VVM as flat, bright yellow colonies. Other Vibrio species tested either did not grow or showed green-bluish colonies, with the exception of V. campbelli, V. carchariae, and V. navarrensis. There is a higher colony count on VVM agar than on cellobiose-colistin agar or on modified cellobiose-polymyxin B-colistin agar. The specific probe was evaluated by colony hybridization and dot blot hybridization with PCR-amplified 16S rDNA using collection strains and environmental isolates. No strain studied other than V. vulnificus showed positive hybridization with this oligonucleotide. The combined use of VVM agar and the V3VV probe provided the recovery of V. vulnificus from mixed bacterial suspensions and spiked mussels.     

A DNA Microarray Platform Based on Direct Detection of rRNA for Characterization of Freshwater Sediment-Related Prokaryotic Communities

A DNA microarray platform for the characterization of bacterial communities in freshwater sediments based on a heterogeneous set of 70 16S rRNA-targeted oligonucleotide probes and directly labeled environmental RNA was developed and evaluated. Application of a simple protocol for the efficient background blocking of aminosilane-coated slides resulted in an improved signal-to-noise ratio and a detection limit of 10 ng for particular 16S rRNA targets. An initial specificity test of the system using RNA from pure cultures of different phylogenetic lineages showed a fraction of false-positive signals of ~5% after protocol optimization and a marginal loss of correct positive signals. Subsequent microarray analysis of sediment-related community RNA from four different German river sites suggested low diversity for the groups targeted but indicated distinct differences in community composition. The results were supported by parallel fluorescence in situ hybridization in combination with sensitive catalyzed reporter deposition (CARD-FISH). In comparisons of the data of different sampling sites, specific detection of populations with relative cellular abundances down to 2% as well as a correlation of microarray signal intensities and population size is suggested. Our results demonstrate that DNA microarray technology allows for the fast and efficient precharacterization of complex bacterial communities by the use of standard single-cell hybridization probes and the direct detection of environmental rRNA, also in methodological challenging habitats such as heterogeneous lotic freshwater sediments.     

Identification of Vibrio anguillarum in fish by using partial 16S rRNA sequences and a specific 16S rRNA oligonucleotide probe

16S rRNA from seven different Vibrio anguillarum strains was partially sequenced and compared. From this sequence information we could design a 25-base-long oligonucleotide and use it as a specific probe for identification of V. anguillarum. This was determined by RNA-DNA colony hybridization and slot-blot hybridization. Strong, specific hybridization to the probe was observed for all V. anguillarum strains tested. Furthermore, no cross-hybridization could be seen against five other bacterial species. The detection limit was 5 x 10(3) bacteria per ml. It was even possible to detect V. anguillarum, by slot-blot hybridization, directly in a homogenized kidney from a fish that had died of vibriosis. The partial sequence information revealed small but significant differences between strains of the same species. These sequence differences are sufficiently significant to allow serotyping on the RNA level. Comparing strains of different serotypes revealed a 10-base and an 11-base difference in V. anguillarum serotypes O8 and O9, respectively, in a 122-base partial sequence.     

Identification of Vibrio anguillarum in fish by using partial 16S rRNA sequences and a specific 16S rRNA oligonucleotide probe.

16S rRNA from seven different Vibrio anguillarum strains was partially sequenced and compared. From this sequence information we could design a 25-base-long oligonucleotide and use it as a specific probe for identification of V. anguillarum. This was determined by RNA-DNA colony hybridization and slot-blot hybridization. Strong, specific hybridization to the probe was observed for all V. anguillarum strains tested. Furthermore, no cross-hybridization could be seen against five other bacterial species. The detection limit was 5 x 10(3) bacteria per ml. It was even possible to detect V. anguillarum, by slot-blot hybridization, directly in a homogenized kidney from a fish that had died of vibriosis. The partial sequence information revealed small but significant differences between strains of the same species. These sequence differences are sufficiently significant to allow serotyping on the RNA level. Comparing strains of different serotypes revealed a 10-base and an 11-base difference in V. anguillarum serotypes O8 and O9, respectively, in a 122-base partial sequence.     

A DNA microarray platform based on direct detection of rRNA for characterization of freshwater sediment-related prokaryotic communities

A DNA microarray platform for the characterization of bacterial communities in freshwater sediments based on a heterogeneous set of 70 16S rRNA-targeted oligonucleotide probes and directly labeled environmental RNA was developed and evaluated. Application of a simple protocol for the efficient background blocking of aminosilane-coated slides resulted in an improved signal-to-noise ratio and a detection limit of 10 ng for particular 16S rRNA targets. An initial specificity test of the system using RNA from pure cultures of different phylogenetic lineages showed a fraction of false-positive signals of approximately 5% after protocol optimization and a marginal loss of correct positive signals. Subsequent microarray analysis of sediment-related community RNA from four different German river sites suggested low diversity for the groups targeted but indicated distinct differences in community composition. The results were supported by parallel fluorescence in situ hybridization in combination with sensitive catalyzed reporter deposition (CARD-FISH). In comparisons of the data of different sampling sites, specific detection of populations with relative cellular abundances down to 2% as well as a correlation of microarray signal intensities and population size is suggested. Our results demonstrate that DNA microarray technology allows for the fast and efficient precharacterization of complex bacterial communities by the use of standard single-cell hybridization probes and the direct detection of environmental rRNA, also in methodological challenging habitats such as heterogeneous lotic freshwater sediments.     

Rapid detection and identification of Vibrio anguillarum by using a specific oligonucleotide probe complementary to 16S rRNA.

Partial 16S rDNA from Vibrio collection type strains and recent isolates of Vibrio-related strains were sequenced and compared with previously published sequences. A 24-base DNA oligonucleotide (VaV3) was designed and used as a specific probe for detection and identification of Vibrio anguillarum. Its specificity was tested against collection type strains and environmental isolates and no cross-reaction was found. The probe detected 8 of the 10 V. anguillarum serovars. It was applied to screen different Vibrio-related strains isolated from marine hatcheries and fish farms. The detection limit in DNA-DNA slot blot hybridization was 150 pg.     

Identification of differentially expressed genes in parasitic phase Miamiensis avidus (Ciliophora: Scuticociliatia) using suppression subtractive hybridization

A multiplex (m-)PCR-based protocol was designed for the simultaneous detection of the main marine bacterial pathogens in Chilean salmon farms: Streptococcus phocae, Aeromonas salmonicida, Vibrio anguillarum and Piscirickettsia salmonis. Each of the 4 oligonucleotide primer pairs exclusively amplified the target gene of the specific bacterial pathogen. The detection limit of the m-PCR using purified total bacterial DNA was 50 pg microl(-1) for V anguillarum, 500 fg microl(-1) for P. salmonis, and 5 pg microl(-1) for S. phocae and A. salmonicida. This corresponded to average limits in the m-PCR sensitivity of 3.69 x 10(5) CFU ml(-1) of V anguillarum, 1.26 x 10(4) CFU m(-1) of S. phocae, and 5.33 x 10(4) CFU ml(-1) of A. salmonicida, while the detection limits for the spiked fish tissues, regardless of the sample (spleen, kidney, liver or muscle) were 2.64 +/- 0.54 x 10(7) CFU g(-1) for V. anguillarum, 9.03 +/- 1.84 x 10(5) CFU g(-1) for S. phocae, 3.8 +/- 0.78 x 10(3) CFU mg(-1) for A. salmonicida and 100 P. salmonis cells. However, high amounts of DNA from 3 bacterial species had a reduction of -1 log-unit on the amplification sensitivity of S. phocae or A. salmonicida when these were present in lower concentration in the multiplex reaction. The assay described in this study is a rapid, sensitive and efficient tool to detect the presence of S. phocae, A. salmonicida, V. anguillarum and P. salmonis simultaneously from pure cultures and tissues from clinically diseased fish. Therefore, it may be a useful alternative to culture-based methods for the diagnosis of infections in fish obtained from Chilean salmon farms.     

16S rRNA targeted sandwich hybridization method for direct quantification of mycobacteria in soils

Boreal soils have been suspected reservoirs of infectious environmental mycobacteria. Detection of these bacteria in the environment is hampered by their slow growth. We applied a quantitative sandwich hybridization approach for direct detection of mycobacterial 16S rRNA in soil without a nucleic acid amplification step. The numbers of mycobacterial 16S rRNA molecules found in the soil indicated the presence of up to 10(7) to 10(8) mycobacterial cells per gram of soil. These numbers exceed by factor of 10 to 100 x the previous estimates of mycobacteria in soil based on culture methods. When real-time PCR with mycobacteria targeting primers was used to estimate the number of 16S rDNA copies in soil, one copy of 16S rDNA was detected per 10(4) copies of 16S rRNA. This is close to the number of 16S rRNA molecules detected per cell by the same method in laboratory pure cultures of M. chlorophenolicum. Therefore a major part of the mycobacterial DNA in the studied soils may thus have represented metabolically active cells. The 16S rRNA sandwich hybridization method described in this paper offers a culture independent solution for tracking environmental reservoirs of viable and potentially infectious mycobacteria.     

16S rRNA gene sequence analysis of Photobacterium damselae and nested PCR method for rapid detection of the causative agent of fish pasteurellosis.

The causative agent of fish pasteurellosis, the organism formerly known as Pasteurella piscicida, has been reclassified as Photobacterium damselae subsp. piscicida on the basis of 16S rRNA gene sequence comparisons and chromosomal DNA-DNA hybridization data; thus, this organism belongs to the same species as Photobacterium damselae subsp. damselae (formerly Vibrio damselae). Since reassignment of P. damselae subsp. piscicida was based on only two strains, one objective of the present work was to confirm the taxonomic position of this fish pathogen by sequencing the 16S rRNA genes of 26 strains having different geographic and host origins. In addition, a nested PCR protocol for detection of P. damselae based on 16S rRNA was developed. This PCR protocol was validated by testing 35 target and 24 nontarget pure cultures, and the detection limits obtained ranged from 1 pg to 10 fg of DNA (200 to 20 cells). A similar level of sensitivity was observed when the PCR protocol was applied to fish tissues spiked with bacteria. The PCR approach described in this paper allows detection of the pathogen in mixed plate cultures obtained from asymptomatic fish suspected to be carriers of P. damselae subsp. piscicida, in which growth of this bacterium cannot be visualized. Our results indicate that the selective primers which we designed represent a powerful tool for sensitive and specific detection of fish pasteurellosis.     

Multiplex PCR for simultaneous detection of five virulence hemolysin genes in Vibrio anguillarum

A multiplex PCR was developed for detection of hemolysin-producing Vibrio anguillarum using primers targeting five hemolysin genes (vah1, vah2, vah3, vah4 and vah5). This method was successful in amplifying reactions containing as little as 100 fg of genomic template DNA. The direct detection of V. anguillarum in clinical specimens by this multiplex PCR was also successful in reactions containing as few as 10 bacterial cells. This multiplex PCR method can be a rapid and sensitive method for detecting pathogenic V. anguillarum.     

Development of a PCR-based method for the detection of Listonella anguillarum in fish tissues and blood samples

A PCR assay for detection and identification of the fish pathogen Listonella anguillarum was developed. Primers amplifying a 519 bp internal fragment of the L. anguillarum rpoN gene, which codes for the factor sigma54, were utilized. The detection limit of the PCR using L. anguillarum pure cultures was approximately 1 to 10 bacterial cells per reaction. For tissue or blood samples of infected turbot Scophthalmus maximus, the detection limit was 10 to 100 L. anguillarum cells per reaction, which corresponds to 2 x 10(3) to 2 x 10(4) cells g(-1) fish tissue. Our results suggest that this PCR protocol is a sensitive and specific molecular method for the detection of the fish pathogen L. anguillarum.     

Targeting species-specific low-affinity 16S rRNA binding sites by using peptide nucleic acids for detection of Legionellae in biofilms

Using fluorescence in situ hybridization to detect bacterial groups has several inherent limitations. DNA probes are generally used, targeting sites on the 16S rRNA. However, much of the 16S rRNA is highly conserved, with variable regions often located in inaccessible areas where secondary structures can restrict probe access. Here, we describe the use of peptide nucleic acid (PNA) probes as a superior alternative to DNA probes, especially when used for environmental samples. A complex bacterial genus (Legionella) was studied, and two probes were designed, one to detect all species and one targeted to Legionella pneumophila. These probes were developed from existing sequences and are targeted to low-binding-affinity sites on the 16S rRNA. In total, 47 strains of Legionella were tested. In all cases, the Legionella spp. PNA probe labeled cells strongly but did not bind to any non-Legionella species. Likewise, the specific L. pneumophila PNA probe labeled only strains of L. pneumophila. By contrast, the equivalent DNA probes performed poorly. To assess the applicability of this method for use on environmental samples, drinking-water biofilms were spiked with a known concentration of L. pneumophila bacteria. Quantifications of the L. pneumophila bacteria were compared using PNA hybridization and standard culture methods. The culture method quantified only 10% of the number of L. pneumophila bacteria found by PNA hybridization. This illustrates the value of this method for use on complex environmental samples, especially where cells may be in a viable but noncultivable state.     

Detection of bacterial and mycoplasma contamination in cell cultures by polymerase chain reaction

A fast and simple method to detect bacterial and especially mycoplasma contamination in tissue culture by means of polymerase chain reaction (PCR) amplification is described. In a first step the universal primer pairs P1/P2 (190-bp fragment) and P3/P4 (120-bp fragment) directed to different conserved parts of the prokaryotic 16S rRNA gene are used. A positive signal after amplification on cell culture DNA with these primers provides an indication of bacterial infection. Using the internal primers IP1, IP3 and IP'3 complementary to a part of the V4 and V8 variable regions of the 16S rRNA gene, in combination with a universal primer, cultures contaminated with mycoplasma could be identified. Six mycoplasma species, typical contaminants in tissue cultures, were investigated: Mycoplasma orale, M. fermentans, M. arginini, M. hyorhinis, M. hominis and Aeromonas laidlawii. This mycoplasma test is an easy, specific and sensitive assay which should be extremely useful in any tissue culture setting.     

Molecular evidence of<Emphasis Type="Italic">Bartonella</Emphasis> DNA in ixodid ticks in Czechia

We report the development of a novel method for detection of Bartonella DNA in ixodid ticks. The assay is based on a specific amplification of a part of 16S rRNA gene and 16S-23S rRNA intergenic spacer region of Bartonella sp. by nested PCR and Southern blot hybridization with specific DNA probe; the method is highly sensitive and specific. The screening of 327 unfed ticks collected in different urban and suburban areas of Czechia in 2003-2005 revealed the presence of Bartonella DNA in four Ixodes ricinus individuals (1.2%), two males, one female and one nymph.     

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.     

Use of the polymerase chain reaction and oligonucleotide probes for the rapid detection and identification of Carnobacterium species from meat.

The polymerase chain reaction (PCR) was used selectively to amplify specific rDNA sequences of Carnobacterium divergens, C. mobile, C. piscicola and C. gallinarum in purified DNA extracts, crude cell lysates and food samples. The PCR products were visualized by agarose gel electrophoresis and identified, at species level, by hybridization reactions with three specific oligonucleotide probes for C. divergens, C. mobile and C. piscicola/C. gallinarum designed from 16S rRNA sequence data. The PCR was sufficiently sensitive to amplify DNA from a single bacterium to detectable levels after 30 cycles of amplification. Both radioactive (32P) and non-radioactive alkaline phosphatase labelled probes was able to detect the PCR products. Detection was highly specific and the probes did not hybridize with DNA samples from any other of the bacterial species tested. These methods enabled the rapid and specific detection and identification of carnobacteria from pure cultures and samples of meat.     

Sensitive genus-specific detection of Legionella by a 16S rRNA based sandwich hybridization assay

The aim of this study was to develop a sensitive, cultivation-independent analytical method for Legionella in man-made water systems which can be performed within one day in crude sample extracts. The new assay for the genus Legionella is a paramagnetic bead based fluorescence sandwich hybridization assay (SHA) for the 16S rRNA based on two oligonucleotide probes which makes the method highly specific. An advantage over RT-PCR is the exclusive detection of viable cells and, due to the high number of 16S RNA molecules, the possibility to apply the method directly in crude cell extracts without prior purification of the nucleic acids. A high sensitivity was obtained by modifying the probe chemistry and hybridization conditions. The most sensitive assay uses a 3'-end biotin-labelled capture probe and a 3'-end DIG tailed detection probe and has a detection limit of 20 amol target molecules corresponding to 1.2x10(7) molecules of 16S rRNA and approximately 1800 Legionella cells. Using this assay type the number of Legionella cells was determined in Legionella contaminated water samples. The results show that the developed SHA can be applied for estimation of the approximate number of Legionella cells based on the number of 16S rRNA molecules in a water sample.     

Quantitative rRNA-Targeted Solution-Based Hybridization Assay Using Peptide Nucleic Acid Molecular Beacons

The potential of a solution-based hybridization assay using peptide nucleic acid (PNA) molecular beacon (MB) probes to quantify 16S rRNA of specific populations in RNA extracts of environmental samples was evaluated by designing PNA MB probes for the genera Dechloromonas and Dechlorosoma. In a kinetic study with 16S rRNA from pure cultures, the hybridization of PNA MB to target 16S rRNA exhibited a higher final hybridization signal and a lower apparent rate constant than the hybridizations to nontarget 16S rRNAs. A concentration of 10 mM NaCl in the hybridization buffer was found to be optimal for maximizing the difference between final hybridization signals from target and nontarget 16S rRNAs. Hybridization temperatures and formamide concentrations in hybridization buffers were optimized to minimize signals from hybridizations of PNA MB to nontarget 16S rRNAs. The detection limit of the PNA MB hybridization assay was determined to be 1.6 nM of 16S rRNA. To establish proof for the application of PNA MB hybridization assays in complex systems, target 16S rRNA from Dechlorosoma suillum was spiked at different levels to RNA isolated from an environmental (bioreactor) sample, and the PNA MB assay enabled effective quantification of the D. suillum RNA in this complex mixture. For another environmental sample, the quantitative results from the PNA MB hybridization assay were compared with those from clone libraries.     

Universal primer PCR with DGGE for rapid detection of bacterial pathogens

A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens.     

Oligonucleotide probes complementary to variable regions of ribosomal RNA discriminate between Mycoplasma species

On the basis of information from computer-assisted sequence comparison of the Mycoplasma pneumoniae 16S ribosomal RNA (rRNA) sequences with sequences from various other mycoplasmal and bacterial species, we constructed M. pneumoniae-specific oligonucleotide probes complementary to variable regions in the 16S rRNA molecule. Using a DNA/RNA dot blot hybridization procedure, it was possible to detect less than 1 X 10(3) mycoplasmas. This test is a most sensitive assay for species-specific detection of bacteria. It can easily be adapted for detection and identification of other bacterial species and may have wide medical and industrial application.