The B chromosomes in Brachycome

This review presents a historical account of studies of B chromosomes in the genus Brachycome Cass. (synonym: Brachyscome) from the earliest cytological investigations carried out in the late 1960s though to the most recent molecular analyses. Molecular analyses provide insights into the origin and evolution of the B chromosomes (Bs) of Brachycome dichromosomatica, a species which has Bs of two different sizes. The larger Bs are somatically stable whereas the smaller, or micro, Bs are somatically unstable. Both B types contain clusters of ribosomal RNA genes that have been shown unequivocally to be inactive in the case of the larger Bs. The large Bs carry a family of tandem repeat sequences (Bd49) that are located mainly at the centromere. Multiple copies of sequences related to this repeat are present on the A chromosomes (As) of related species, whereas only a few copies exist in the A chromosomes of B. dichromosomatica. The micro Bs share DNA sequences with the As and the larger Bs, and they also have B-specific repeats (Bdm29 and Bdm54). In some cases repeat sequences on the micro Bs have been shown to occur as clusters on the A chromosomes in a proportion of individuals within a population. It is clear that none of these B types originated by simple excision of segments from the A chromosomes.     

Evolution and function of B chromosome 45S rDNA sequences in Brachycome dichromosomatica.

The origin and activity of 45S rDNA located on micro B chromosomes of the daisy Brachycome dichromosomatica were analysed. The internal transcribed spacer 2 (ITS2) of the 45S rRNA gene was sequenced for micro B, large B, and A chromosomes of B. dichromosomatica cytodeme A2, and conserved differences were identified between sequences originating from A and both types of B chromosomes. Phylogenetic analysis did not identify a species containing an ITS2 sequence more similar to either of the B chromosome sequences than the B. dichromosomatica A chromosome sequences. Thus, an origin of the B chromosomes from A chromosomes at a time prior to the divergence of the 4 cytodemes of B. dichromosomatica is suggested. The frequent (70%) nucleolar non-association of micro B chromosomes suggests inactivity of micro B 45S rDNA.     

A monophyletic origin of the B chromosomes ofBrachycome dichromosomatica (Asteraceae)

The A and B chromosomes of different karyotype variants (cytodemes A1, A2, A3 and A4) ofBrachycome dichromosomatica were analysed by computer-aided chromosome image analysis and fluorescencein situ hybridisation (FISH). Ribosomal DNA and the B chromosome-specific sequence Bd49 were detected on all B chromosomes. In addition to minor size variation of the Bs, polymorphism of the rDNA and Bd49 position and copy number revealed two major types of B chromosomes. The B chromosomes of all the cytodemes were indistinguishable from each other in length, but that of A3 showed evidence of rearrangements consistent with its long-term geographic isolation. The results presented suggest a monophyletic origin of the B chromosomes ofB. dichromosomatica.     

The genomic complexity of micro B chromosomes of Brachycome dichromosomatica

A major sequence component of the micro B chromosome of Brachycome dichromosomatica (2 n=4) is the tandem repeat Bdm29, which was found by in situ hybridisation to be distributed along the entire length of the chromosome. A high copy number of this sequence does not occur as a regular feature of the A chromosomes in this species but it was found in infrequent individuals in two wild populations that were analysed. In these instances Bdm29 is localised within heterochromatic, polymorphic segments on the long arm of chromosome 1. The origin of the micro B chromosomes was investigated by determining whether they are related to this A chromosome polymorphism by simple excision and/or integration. Results obtained by using Bdm29, together with a newly isolated repeat sequence, Bdm54, and a number of other sequences known to occur on the micro B chromosome, as probes in in situ hybridisation and Southern analysis demonstrated that the formation of micro B chromosomes is a complex multistep process. The observation that the genomic organisation of the micro B chromosome is unlike anything found on the A chromosomes precludes their origin by simple excision and also indicates that micro Bs do not integrate directly into the A complement to form polymorphic heterochomatic segments.     

Organisation and origin of a B chromosome centromeric sequence from Brachycome dichromosomatica

Brachycome dichromosomatica is an Australian native daisy that has two pairs of A chromosomes and up to three B chromosomes in some populations. A putative B-specific tandem repeat DNA sequence (Bd49) was isolated previously. Here we describe further characterisation of this sequence and investigate its possible origin. Southern analysis showed that all individual B chromosomes examined have highly methylated tandem repeats of Bd49 but differences in banding pattern for distinct B isolates suggested that the sequence is in a state of flux. Using in situ hybridisation, the sequence was shown to be located at the centromeric region of the B chromosome. Southern analysis of genomic DNA with Bd49 demonstrated that multiple copies of the sequence exist in the genomes of B. eriogona, B. ciliaris, B. segmentosa and B. multifida (none of which have B chromosomes) whereas other species tested (including 0B plants of B. dichromosomatica and 0B B. curvicarpa and B. dentata) have few or no copies. Genomic clones and Bd49-like sequences derived by the polymerase chain reaction (PCR) were obtained from five species but determination of phylogenetic relationships within the genus and inference as to the possible origin of the B chromosome were problematic because of extensive intragenomic heterogeneity of the sequences.     

A repetitive DNA sequence common to the different B chromosomes of the genus Brachycome

Dot-like micro B chromosomes of Brachycome dichromosomatica were analysed for their sequence composition. Southern hybridization patterns of a total micro B probe to genomic DNA from plants with and without micro Bs demonstrated that the micro Bs shared sequences with the A chromosomes. In addition to telomere, rDNA and common A and B chromosome sequences, a new B-specific, highly methylated tandem repeat (Bdm29) was detected. After in situ hybridization with Bdm29 the entire micro B chromosome was labelled and clustering of the condensed micro Bs could be observed at interphase. A high number of Bdm29-like sequences were also found in the larger B chromosomes of B. dichromosomatica and in other Bs within the genus Brachycome. Received: 30 May 1997; in revised form: 20 August 1997 / Accepted: 20 August 1997     

The molecular organisation of a B chromosome tandem repeat sequence fromBrachycome dichromosomatica

A high copy, tandemly repeated, sequence (Bd49) specific to the B chromosome and located near the centromere in Brachycome dichromosomatica was used to identify lambda genomic clones from DNA of a 3B plant. Only one clone of those analysed was composed entirely of a tandem array of the B-specific repeat unit. In other clones, the Bd49 repeats were linked to, or interspersed with, sequences that are repetitious and distributed elsewhere on the A and B chromosomes. One such repetitious flanking sequence has similarity to retrotransposon sequences and a second is similar to chloroplast DNA sequences. Of the four separate junctions analysed of Bd49-like sequence with flanking sequence, three were associated with the same A/T-rich region in Bd49 and the fourth was close to a 25 bp imperfect dyadic sequence. No novel B-specific sequences were detected within the genomic clones. Received: 31 December 1995; in revised form: 1 May 1996 / Accepted: 10 May 1996     

Extrachromosomal circular DNA derived from tandemly repeated genomic sequences in plants

Extrachromosomal circular DNA (eccDNA) is one characteristic of the plasticity of the eukaryotic genome. It was found in various non-plant organisms from yeast to humans. EccDNA is heterogeneous in size and contains sequences derived primarily from repetitive chromosomal DNA. Here, we report the occurrence of eccDNA in small and large genome plant species, as identified using two-dimensional gel electrophoresis. We show that eccDNA is readily detected in both Arabidopsis thaliana and Brachycome dichromosomatica , reflecting a normal phenomenon that occurs in wild-type plants. The size of plant eccDNA ranges from > 2 kb to < 20 kb, which is similar to the sizes found in other organisms. These DNA molecules correspond to 5S ribosomal DNA (rDNA), non-coding chromosomal high-copy tandem repeats and telomeric DNA of both species. Circular multimers of the repeating unit of 5S rDNA were identified in both species. In addition, similar multimers were also demonstrated with the B. dichromosomatica repetitive element Bdm29. Such circular multimers of tandem repeats were found in animal models, suggesting a common mechanism for eccDNA formation among eukaryotes. This mechanism may involve looping-out via intrachromosomal homologous recombination. The implications of these results on genome plasticity and evolutionary processes are discussed.     

Identification of Brassica oleracea monosomic alien chromosome addition lines with molecular markers reveals extensive gene duplication

Summary Chromosomes of Brassica oleracea (2n=18) were dissected from the resynthesized amphidiploid B. napus Hakuran by repeated backcrosses to B. campestris (2n=20), creating a series of monosomic alien chromosome addition line plants (2n=21). Using morphological, isozyme and restriction fragment length polymorphism markers (RFLPs), 81 putative loci were identified. Of nine possible synteny groups, seven were represented in the 25 monosomic addition plants tested. Sequences homologous to 26% of the 61 DNA clones utilized (80% were cDNA clones) were found on more than one synteny group, indicating a high level of gene duplication. Anomalous synteny associations were detected in four 2n=21 plants. One of these plants showed two markers from one B. oleracea chromosome associated with a second complete B. oleracea synteny group, suggesting translocation or recombination between non-homologous chromosomes in Hakuran or the backcross derivatives. The other three 2n=21 plants each contained two or more B. oleracea synteny groups, suggesting chromosome substitution.     

The cytology of Brachycome lineariloba

The frequencies and behaviour of two types of accessory chromosome in Brachycome lineariloba species A (n=2) are reported. These include a larger (ca. 4.0 macro-B chromosome, and a minute (<1.0 ) micro-B. Twelve per-cent of the 452 plants studied were carriers of one, two or more rarely three macro-B chromosomes. These were usually mitotically stable, but showed some meiotic irregularity when present in odd number. An equilibrium situation is inferred, and loss must be balanced against mechanisms tending to increase B frequency. A surplus of plants with two B chromosomes also suggests that mechanisms of doubling may operate. A possible source of the macro-B's is considered to be hybridisation between the several species of the B. lineariloba complex. — The micro-B chromosomes were found in 3.8% of two only of the three known cytological races of the species. They showed extreme irregularity in both mitotic and meiotic behaviour. Their relationship to the normal (A) chromosomes and to the macro-B's is obscure.     

Characterization of a maize chromosome 4 centromeric sequence: evidence for an evolutionary relationship with the B chromosome centromere

Previous work has identified sequences specific to the B chromosome that are a major component of the B centromere. To address the issue of the origin of the B and the evolution of centromere-localized sequences, DNA prepared from plants without B chromosomes was probed to seek evidence for related sequences. Clones were isolated from maize line B73 without B chromosomes by screening DNA at reduced stringency with a B centromeric probe. These clones were localized to maize centromere 4 using fluorescence in situ hybridization. They showed homology to a maize centromere-mapped sequence, to maize B chromosome centromere sequences, and to a portion of the unit repeat of knobs, which act as neocentromeres in maize. A representative copy was used to screen a BAC library to obtain these sequences in a larger context. Each of the six positive BACs obtained was analyzed to determine the nature of centromere 4-specific sequences present. Fifteen subclones of one BAC were sequenced and the organization of this chromosome 4-specific repeat was examined.     

Multiple Sequence Versions of the Oxytricha fallax 81-MAC Alternate Processing Family1

The 81-MAC family consists of three sizes of macronuclear chromosomes in Oxytricha fallax. Clones of these and of micronuclcar homologs have been classified according to DNA sequence into three highly homologous (95.9–97.9%), but distinct versions. Version A is represented by a micronuclear clone and by clones of two different-sized macronuclear chromosomes, showing that alternate processing of micronuclear DNA is responsible for the variety of sizes of macronuclcar chromosomes. Three Internal Eliminated Sequences (IES's) are demonstrated in Version A micronuclcar DNA. Two have been sequenced and show short, flanking direct repeats but no inverted terminal repeats. Version C micronuclear DNA has interruptions in the macronuclear homology which correspond closely to the Version A IES's. Whether they are true IES's is unknown because no Version C macronuclear DNA has been demonstrated. Version C micronuclear DNA may be “macronuclear-homologous” but “micronucleus-limited” and not “macronucleusdestined.” Version B is represented by macronuclear DNA clones, but no micronuclear clones. Vegetative micronuclear aneuploidy is suggested. The possible role of micronuclear defects in somatic karyonidai senescence is discussed in light of the precise macronuclear chromosome copy controls demonstrated within the 81-MAC family. These controls apparently operate throughout karyonidai life to mairitain 1) a constant absolute amount of 81-MAC sequences in the macronuclcus and 2) a constant sioichiometry within the family, both according to version and chromosome size.     

Direct amplification of nodD from community DNA reveals the genetic diversity of Rhizobium leguminosarum in soil

Sequences of nodD , a gene found only in rhizobia, were amplified from total community DNA isolated from a pasture soil. The polymerase chain reaction (PCR) primers used, Y5 and Y6, match nodD from Rhizobium leguminosarum biovar trifolii , R. leguminosarum biovar viciae and Sinorhizobium meliloti . The PCR product was cloned and yielded 68 clones that were identified by restriction pattern as derived from biovar trifolii [11 restriction fragment length polymorphism (RFLP) types] and 15 clones identified as viciae (seven RFLP types). These identifications were confirmed by sequencing. There were no clones related to S. meliloti nodD . For comparison, 122 strains were isolated from nodules of white clover ( Trifolium repens ) growing at the field site, and 134 from nodules on trap plants of T. repens inoculated with the soil. The nodule isolates were of four nodD RFLP types, with 77% being of a single type. All four of these patterns were also found among the clones from soil DNA, and the same type was the most abundant, although it made up only 34% of the trifolii -like clones. We conclude that clover selects specific genotypes from the available soil population, and that R. leguminosarum biovar trifolii was approximately five times more abundant than biovar viciae in this pasture soil, whereas S. meliloti was rare.     

Molecular evidence for the lysogenic state of microorganisms belonging to the genus Bordetella and characterization of Bordetella parapertussis temperate bacteriophage 66(2.2)

A new bacteriophage phiK of microorganisms belonging to the genus Bordetella was isolated from cells of the earlier characterized strains 66(2-2) (1 and 2) obtained upon phage conversion of B. parapertussis 17903 cells by B. pertussis bacteriophage phi134. Bacteriophage phiK is identical to previously described Bordetella bacteriophages phiT, phi134, and phi214 in morphology and some biological properties but has a permuted genome different from all other phages. DNA of bacteriophage phiK is not integrated in the chromosome of B. parapertussis 17903, similar to DNA of bacteriophages phiT, phi134, and phi214 that are not integrated into B. pertussis and B. bronchiseptica chromosomes, but may be present in a small part of the bacterial population as linear plasmids. Sequences homologous to DNA of bacteriophage phiK were detected in the chromosome of strain 66(2-2) (1 and 2) and in chromosomes of all tested strains B. pertussis and B. bronchiseptica. Prophage integration in chromosomes of microorganisms of the genus Bordetella may vary in different bacterial strains and species. An assumption about abortive lysogeny of B. parapertussis bacteria for phiK phage and of B. bronchiseptica for closely related phages phiT, phi134, and phi214 has been advanced. The possibility of involvement of B. pertussis insertion sequences in the formation of the chromosomal structure in 66(2-2) convertants and in phage genomes is considered.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Nature and evolution of B chromosomes in plants: A non-coding but information-rich part of plant genomes

This work reviews recent advances providing insights on the origin and evolution of B chromosomes (Bs) in representative plant species. Brachyome dichromosomatica has large and micro Bs. Both carry an inactive ribosomal gene cluster. The large Bs contain the B-specific Bd49 family, mainly located at the centromere. Multiple copies are present in the A chromosomes (As) of related species, whereas only a few copies exist in B. dichromosomatica As. The micro Bs share sequences with the As, the large Bs and have the B-specific repeats Bdm29 and Bdm54. It seems that the large and micro Bs are related in origin. It is very unlikely that the Bs originated by simple excision from the As. Rye Bs are composed of sequences predominantly shared with the As. B-specific sequences are located at the heterochromatic end of the long arm. Probably, they originated from the As after many rearrangements, with a tendency for duplication. The E3900 family derives from a Ty3 gypsy retrotransposon, but the D1100 family shows no evidence of genic origin. The overall composition of maize As and Bs is similar suggesting a common origin. Several B-specific sequences have been found, the most studied being pZmBs, which is located at the B centromere. It shows partial homology to the centromere of chromosome 4 and to the knobs. It is not known whether the B centromere derives from centromere 4, or whether both have a more distant common origin. The dynamics of Bs in populations depends on their non-Mendelian mechanisms of transmission, their effects on carrier fitness and on A genes modulating their parasitic properties. Three representative examples are reviewed. The Bs of Allium schoenoprassum are transmitted at a mean lower than Mendelian and adversely affect vigour and fertility. However, there is a differential selection operating in favour of B-containing seedlings. Rye Bs undergo strong drive, which is counteracted by harmful effects on fertility and instabilities at meiosis. Both nondisjunction and meiotic behaviour, and consequently the establishment of B polymorphisms, mainly depend on the Bs themselves. B nondisjunction in maize is controlled by the B, but the As control preferential fertilisation. Considering the non-equilibrium model, the Bs of Allium seem to have been neutralised by the A genome, the As of maize provide defence against B attack, whereas the Bs of rye are only slightly neutralized.     

Cloning and characterisation of polymorphic heterochromatic segments of Brachycome dichromosomatica

After selective enrichment and differential hybridisation of C_ot-1 DNA fractions of plants with and without polymorphic heterochromatic segments, a repetitive sequence (called Bds1) specific to the polymorphic chromosome segments of Brachycome dichromosomatica (Brachyscome dichromosomatica) was isolated. A single repeat unit of Bds1 is 92 bp long and is organised in tandem arrays at three different polymorphic segment sites on the chromosomes of cytodeme A2. Although all three sites showed extensive polymorphism between plants, the karyotypes of all analysed mitotic root cells were stable within a single plant. Electron microscopy revealed heavily condensed chromatin structures at the most obvious polymorphic site. The mechanisms that generate and maintain the observed chromosome structure polymorphisms are discussed. Received: 16 March 1999; in revised form: 28 September 1999 / Accepted: 11 November 1999     

Preparation of monosomal lines containing individual human 15, 21, and X chromosomes]

Sorting of human--mouse or human--hamster hybrid cells with particular human chromosomes was performed by in situ hybridization. Total human genomic DNA was heavily labelled with. H and hybridized to metaphase spreads from hybrid clone cells. The method allowed us to not only identify human chromosomes in hybrid cells but also to detect terminal translocations and insertions from 1-2 bands in length to large ones. Biochemical markers of some human chromosomes were analysed using electrophoretic technique in the clones selected. Cytogenetic analysis (G staining) of these clones was made to visualize human chromosomes. Total 99 initial hybrid human--hamster and 26 human--mouse clones were obtained. 53 clones were analysed by in situ hybridization, only one of them being monochromosomal; the latter contained human X chromosome on the background of Chinese hamster chromosomes. Two other monochromosomal clones containing particular 15 and 21 chromosomes, respectively, were obtained by more complicated way from human--mouse hybrid clones using back selection, repeated hybridization and passing through a number of subsequent subclonings.     

B chromosomes in Nierembergia aristata (Solanaceae): nucleolar activity and competition with the A chromosomes

B chromosomes are additional dispensable chromosomes that may be present in some individuals, populations, or species, which have probably arisen from the A chromosomes but follow their own evolutionary pathway. Supposedly, B chromosomes do not contain major genes except for ribosomal DNA (rDNA) sequences that have been mapped on the supernumerary chromosomes of many plants and animals. This paper is a new report of B chromosome occurrence in plants. B chromosomes with nucleolar organizing regions (NORs) were found in a diploid sample of Nierembergiaaristata D. Don (sub nom. N. stricta Miers) (2n = 2x = 16). This is an extreme case in which B chromosomes possess not only strong nucleolar activity, as revealed by conventional staining methods, AgNOR and fluorescence banding, and fluorescent in situ hybridization (FISH), but also show nucleolar competition with the A chromosomes. The observed phenomenon could be analogous to the nucleolar dominance or 'differential amphiplasty' phenomenon that occurs in interspecific hybrids.     

Influence of the Presence of B Chromosomes on DNA Damage in Crepis capillaris

The sensitivity of different plant species to mutagenic agents is related to the DNA content and organization of the chromatin, which have been described in ABCW and bodyguard hypotheses, respectively. Plant species that have B chromosomes are good models for the study of these hypotheses. This study presents an analysis of the correlation between the occurrence of B chromosomes and the DNA damage that is induced by the chemical mutagen, maleic hydrazide (MH), in Crepis capillaris plants using comet assay. The presence of B chromosomes has a detectable impact on the level of DNA damage. The level of DNA damage after MH treatment was correlated with the number of B chromosomes and it was observed that it increased significantly in plants with 3B chromosomes. We did not find evidence of the protective role from chemical mutagens of the constitutive heterochromatin for euchromatin in relation to DNA damage. The DNA damage involving the 25S rDNA sequences was analyzed using the comet-FISH technique. Fragmentation within or near the 25S rDNA involved the loci on the A and B chromosomes. The presence of B chromosomes in C. capillaris cells had an influence on the level of DNA damage that involves the 25S rDNA region.