Light-dependent phagotrophy in the freshwater mixotrophic chrysophyte Dinobryon cylindricum

The mixotrophic (bacterivorous), freshwater chrysophyte Dinobryon cylindricum was cultured under a variety of light regimes and in bacterized and axenic cultures to investigate the role of phototrophy and phagotrophy for the growth of this alga. D. cylindricum was found to be an obligate phototroph. The alga was unable to survive in continuous darkness even when cultures were supplemented with high concentrations of bacteria, and bacterivory ceased in cultures placed in the dark for a period longer than one day. Axenic growth of the alga was poor even in an optimal light regime. Live bacteria were required for sustained, vigorous growth of the alga in the light. Carbon (C), nitrogen (N), and phosphorus (P) budgets determined for the alga during growth in bacterized cultures indicated that bacterial biomass ingested by the alga may have contributed up to 25% of the organic carbon budget of the alga. Photosynthesis was the source of most (75%) of the organic carbon of the alga. D. cylindricum populations survived but did not grow when cultured in a continuous low light intensity (30 E m^–2 sec^–1), or in a light intensity of 150 E m^–2 sec^–1 for only two hours each day. Net efficiency of incorporation of bacterial C, N, and P into algal biomass under these two conditions was zero (i.e., no net algal population growth). We conclude that the primary function of bacterivorous behavior in D. cylindricum may be to provide essential growth factor(s) or major nutrients for photosynthetic growth, or to allow for the survival of individuals during periods of very low light intensity or short photoperiod. Offprint requests to: David A. Caron     

Seasonal variations in the metabolic activity of cells of <Emphasis Type="Italic">Fucus vesiculosus</Emphasis> Linnaeus, 1753 (Phaeophyta: Fucales) from the Barents Sea

The cellular metabolic activity was studied in the brown alga Fucus vesiculosus from the Barents Sea. Several phases of activity of physiological processes in cells of this alga during a 1-year period have been identified. This study shows that the onset and duration of the three main phases of seasonal development of alga, viz., the resting phase, growth, and the accumulation of reserve nutrients, can be determined based on the level and dynamics of the cellular metabolic activity. Each development phase in F. vesiculosus is characterized by a specific rhythm of the daily metabolic activity of cells.     

Enhanced β-lactam antibiotic production by coimmobilization of fungus and alga

Summary It was determined thatCephalosporium acremonium, an oxygenconsuming fungus, had a symbiotic relationship withChlorella pyrenoidosa, an oxygen-generating alga. The fungus and the alga were coimmobilized by entrapment in calcium alginate beads. The production rate of -lactam antibiotics was evaluated at various ratios of the fungus and the alga cells in the free and immobilized states. When the ratio of fungus to alga was one to eight in free mixed culture, the production rate of -lactam antibiotics was 240% of the rate in the presence of fungus alone in the free state. In coimmobilized cell system, the increased amount was 370% in comparison with immobilized fungus alone.     

An NADP-dependent Glutamate Dehydrogenase in Chloroplasts from the Marine Green Alga Caulerpa simpliciuscula

NADP-dependent glutamate dehydrogenase was partially purified from extracts of the marine siphonous green alga Caulerpa simpliciuscula. The enzyme had an apparent Km NH(4) (+) of 0.4 to 0.7 mm and was highly specific for NADPH, alpha-ketoglutarate, and ammonium ions.The bulk of the NADP-glutamate dehydrogenase was isolated with the chloroplast fraction in cell-free preparations of this alga and was released from these "chloroplast fractions" as a soluble enzyme on gentle lysis of chloroplast membranes.     

Identification of Calmodulin in the Red Alga Susabi Laver (Porphyra yezoensis)

To test whether calmodulin is present in the red alga Susabi laver (Porphyra yezoensis), materials was concentrated from this alga, using hydrophobic chromatography. In this case, 0.25 m (NH₄)₂SO₄ should be added to bind the protein to the column in the presence of 5 mm CaCl₂. Calmodulin is present in the marine red alga, although at a very low concentration.     

Glycerolipid Acyl Hydrolase Activity in the Brown Alga Cladosiphon okamuranus TOKIDA

The brown alga, Cladosiphon okamuranus TOKIDA, was found to contain a large amount of free fatty acid (45% of the total lipids). A crude enzyme preparation from the alga showed activity for hydrolyzing the acyl groups of various glycerolipids. The results suggest that the free fatty acid in C. okamuranus was released mainly from glycoglycerolipids, which were the major lipid components in the alga, by such glycerolipid acyl hydrolases as galactolipase.     

Symbiosis of Mycale (Mycale) vansoesti sp. nov. (Porifera, Demospongiae) with a coralline alga from North Sulawesi (Indonesia)

Abstract. The symbiotic association between the new sponge species Mycale vansoesti and the coralline alga Amphiroa sp. from the Bunaken Marine Park (North Sulawesi, Indonesia) is described. The alga completely pervades the sponge. The color of the sponge ectosome is white, both on the external surface and on the atrial wall, but where the alga is present the sponge takes on the light pink color of the alga. The sponge spicular complement is characterized by mycalostyles, anisochelae of two types, sigmas (often "C" shaped), and extremely abundant toxas organized in bundles forming toxadragma. In the association, the sponge shows very low silicate value, and consequently the alga represents the main skeleton of the sponge. On the other hand, the sponge affects the morphology of the alga, leading to a cylindrical shape, with thalli running parallel to the sponge surface. This association seems to be obligate for the sponge, as we found no sponges of this species living in isolation.     

Why does herbivore sex matter? Sexual differences in utilization of Fucus vesiculosus by the isopod Idotea baltica

Optimal feeding is often constrained by predation avoidance, which may direct feeding to take place on more sheltered, but less profitable, parts of the habitat. Though constrained, feeding preferences and/or digestive capabilities should co-evolve with the energetic and nutritional needs of the animal. These needs, as well as risk taking for these goals, may differ between the sexes. We studied sexual differences in the utilization of the brown alga Fucus vesiculosus by the marine isopod Idotea baltica . In a feeding preference test with small pieces of alga both sexes prefer the apical, newly grown parts to the basal parts. However, males show stronger preference than females. When isopods are reared on the apical or basal part of the alga alone, sexes grow differently on these parts. Females gain weight equally well and their intermolt duration is the same on both parts of the alga, while males perform clearly worse on the basal than on the apical part. Despite the better quality of the apical parts of the alga, in a grazing experiment in a "semi-natural" environment with whole bushes of F. vesiculosus also the basal parts are consumed, and even preferred over apical parts by females. We suggest that feeding preferences are subordinate to microhabitat choice, and therefore predation avoidance constrains optimal feeding. We hypothesize that the better ability of females than that of males to utilize the basal parts of the alga for growth is a co-adaptation to their risk-averse general reproductive strategy. We discuss the sexual differences in host plant utilization in the context of reproductive strategies of the sexes, especially different risk sensitivity of foraging, and its potential consequences on plant-herbivore interaction.     

Influence of environmental factors on the growth in culture of a New Zealand strain of the fast-spreading algaHydrodictyon reticulatum (water-net)

Hydrodictyon reticulatum (L.) Lagerh. is a recent addition to the New Zealand flora and is expanding its distribution rapidly. Proliferations of the alga now constitute an economic nuisance in waters which have not previously suffered filamentous algal blooms. To better understand the current and likely future spread of the alga and to identify possible management options the alga's growth requirements have been investigated. A strain isolated from New Zealand tolerated temperatures between 5 and 40 °C and salinities from 0 to 5. Optimal growth was at 25 °C, 150 mol photon m^–2s^–1 and in freshwater. Nett photosynthesis was saturated at photon flux densities of 100 and 160 mol m^–2s^–1 at 12 and 20 °C, respectively. Growth rate was linearly related to internal N concentration and hyperbolically to internal P concentration. Minimum cellular nutrient contents, by weight, were 1% N and 0.2% P. Growth was saturated at contents of 5% N and 0.5% P under the conditions of culture (20 °C, 150 mol photon m^–2s^–1). The alga maintained optimal cellular N content at low ambient nitrate concentrations (100 mg m^–3) half optimum content at 18 mg m^–3. Affinity for filtrable reactive phosphorus was not unusually high compared to other filamentous algae. We suggest that this alga is occupying a niche in New Zealand which has been precluded from other filamentous nuisance algae by low N concentration and N:P ratio. The significance of these findings in setting environmental targets for management of this nuisance alga is discussed.Author for correspondence     

The action of <Emphasis Type="Italic">Laminaria japonica</Emphasis> extractives on 1,3-β-D-glucanase,a digestive enzyme of the <Emphasis Type="Italic">Strongylocentrotus intermedius</Emphasis> sea urchin

Nutritional attractiveness of the brown alga Laminaria japonica for the sea urchin Strongylocentrotus intermedius was studied. The composition of L. japonica was analyzed after one and two years of its life under natural conditions, in its seedlings, and in the alga partially degraded by natural factors. Substances extracted with various solvents were tested for the presence of inhibitors and activators of 1,3-β-D-glucanase, a digestive enzyme of the sea urchin. Ethanolic extract of freshly harvested L. japonica was found to suppress the enzyme activity. Substances present in ethanolic extracts of the alga after one or two years of its life cycle and in the alga, partly degraded by natural factors, activated the sea urchin enzyme. This fact is in agreement with earlier natural observations concerning the nutritional attractiveness of such L. japonica samples for Strongylocentrotus intermedius.     

Alloxan: A growth accelerator for a nitrogen-fixing blue-green alga

Effect of Alloxan was studied on a nitrogen-fixing blue-green alga: Westiellopsis prolifica in pure cultures. Concentrations of Alloxan, 10 g to 50 g/ml stimulate the growth of the alga and increase the chlorophyll, carotin and phycocyanin content of the cultures.     

Uptake of free amino acids by the diatom,Melosira mediocris

Individual ¹⁴C-labelled amino acids are rapidly removed from dilute solution in artificial sea water (0.2 mol 1^–1) by suspensions of Meliosira medocris. The rate of disappearance of radioactivity corresponds closely to removal of primary amines as determined by measurement of the rate of decrease of fluorescamine-positive material. Net removal of naturally occurring free amino acids from the sea water habitat from which the alga was isolated is demonstrated using high performance liquid chromatography. Removal of amino acids from natural sources makes a significant contribution to the carbon requirements of the alga as well as supplying significant amounts of amino nitrogen.     

Associations Between Macroinvertebrates and <Emphasis Type="Italic">Paralemanea mexicana</Emphasis>, an Endemic Freshwater Red Alga from a Mountain River in Central Mexico

Macrophytes are common inhabitants of lotic environments and, depending on their morphological traits, possess adaptations that provide shelter to aquatic invertebrates against strong river flow and predators. They may also be used as a food source by macroinvertebrates. The main goal of this study was to determine the relationship between the red alga Paralemanea mexicana and its role as a shelter and/or food source for lotic macroinvertebrates. We also conducted research on the role of microhabitat and morphological variations of the alga in determining macroinvertebrate taxon abundance, diversity, and functional group composition in a high-current velocity river. Results showed that changes in cover and morphology of P. mexicana were mostly correlated with river current velocity, irradiance, and seasonal variation. In turn, these were related to changes in abundance and diversity of the associated macroinvertebrate community. In addition, six macroinvertebrate functional feeding groups were evaluated for associations with the red alga: filtering and gathering collectors, piercers, scrapers, herbivore shredders, and predators. The results showed that the Trichoptera Hydroptilidae genera Ochrotrichia and Metrichia use P. mexicana as a food source and case-building material. The Trichoptera Glossosomatidae Mortoniella uses the alga as a substrate. The biotic interactions between P. mexicana and associated macroinvertebrates reveal the importance of macrophytes as purveyors of substrate, as food and shelter for macroinvertebrates, and also as promoters of macroinvertebrate community diversity. In addition, it was shown that macroinvertebrate herbivory likely facilitates vegetative propagation of the red alga through increased release and germination of carpospores and new gametophytes.     

Complexity and idiosyncrasy in the responses of algae to disturbance in mono- and multi-species assemblages

There is considerable debate about whether stability (e.g. inertia) of an assemblage, or of individuals in an assemblage, is positively associated with the number of species or whether there are idiosyncratic effects of particular species. We assessed the general model that the loss of an individual alga, caused by trampling, is greater in monospecific than in multi-species stands but that the responses of algae are idiosyncratic, depending on the morphology of the species. The experiment was done on conspicuous and dominant algae with different morphology on temperate Australian rocky shores: the fucalean algae Hormosira banksii and Sargassum sp. and the coralline alga Corallina officinalis. We assessed the relative and interactive effects of the extent of trampling (number of paths) and the localised intensity of trampling (number of travels per path) on the three algae. The number of paths trampled (the extent of disturbance) had more impact on each alga than the number of times paths were travelled (the intensity of disturbance). As predicted, H. banksii was most susceptible to trampling at each level than were the coarser algae Sargassum sp. and C. officinalis. There was a consistent trend for each alga to be more inert to trampling when in the presence of the other two species than when in monospecific stands, but this was only statistically significant (P < 0.05) for the softer alga H. banksii. The responses of H. banksii and Sargassum sp. to disturbance seemed, in many cases, to be due to the presence of C. officinalis rather than to "diversity" per se. The relationship between the number of species and stability is complex in intertidal habitats, depending on the species and the combinations of species with which it grows.     

Chlamydomonas reinhardtii as a new model system for studying the molecular basis of the circadian clock

The genome of the unicellular green alga Chlamydomonas reinhardtii has both plant-like and animal-like genes. It is of interest to know which types of clock genes this alga has. Recent forward and reverse genetic studies have revealed that its clock has both plant-like and algal clock components. In addition, since C. reinhardtii is a useful model organism also called "green yeast", the identification of clock genes will make C. reinhardtii a powerful model for studying the molecular basis of the eukaryotic circadian clock. In this review, we describe our forward genetic approach in C. reinhardtii and discuss some recent findings about its circadian clock.     

Participation of the Green Algae <Emphasis Type="Italic">Ulvaria obscura</Emphasis> in Bioremediation of Sea Water from Oil Products

Participation of green algae in bioremediation of sea water from oil products (OPs) has been studied. Decrease in the content of OPs in water is accompanied by their accumulation by the alga Ulvaria obscura (Chlorophyta). It has been assumed that neutralization of OPs in Ulvaria occurs, similarly to Fucus vesiculosus (Phaeophyta), all over the thallome: destruction of OPs starts on the alga surface by epiphytic hydrocarbonoxidizing bacteria providing absorption and subsequent degradation of OPs by plant cells. The role of macrophytes in bioremediation of coastal areas from OPs is considerably higher than previously supposed.     

Specific dynamic action demonstrated in the herbivorous marine periwinkles,LIttorina littorea L. and Littorina obtusata L. (Mollusca,Gastropoda)

• 1.1. Respiration rates of starved periwinkles, Liltorina littorea and Littorina obtusata, increased by 40–60% when fed their preferred algal food for 1 hr, or after having been exposed for the same period to an aqueous extract of the alga.
• 2.2. The stimulus causing the rise in metabolic rate by algal extracts is therefore thought to be chemosensory in nature, and possibly composed primarily of dissolved free amino acids.
• 3.3. The respiration rates of L. littorea responded only to the green alga Enteromorpha intestinalis while L. obtusata demonstrated an increase in respiration rates when fed the ubiquitous brown alga, Ascophyllum nodosum, and to a lesser degree to Enteromorpha.
• 4.4. These results compare very well to postprandial increases in oxygen consumption demonstrated in vertebrates and marine bivalves where the components of specific dynamic action (SDA) are thought to be chiefly biosynthetic costs of digestion and assimilation.

     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Relationship between phototrophy and phagotrophy in the mixotrophic chrysophytePoterioochromonas malhamensis

The time scales involved in the transition between phototrophic and phagotrophic modes of nutrition were examined in the mixotrophic chrysophytePoterioochromonas malhamensis. Phagotrophy began almost immediately when bacteria were added to phototrophically growing cultures of the alga, and chlorophylla concentration per cell in these cultures decreased over a 24-hour period. Chlorophyll concentrations per cell began to increase when bacteria were grazed to a density of approximately 10⁶ ml^–1, but after more than 24 hours they had not returned to the higher chlorophyll concentrations observed in the phototrophically grown cultures. Bacterivory was the dominant mode of nutrition in all cultures containing heat-killed bacteria. Photosynthesis did not contribute more than 7% of the total carbon budget of the alga when in the presence of abundant heat-killed bacteria. Bacterial density was the primary factor influencing the ability ofP. malhamensis to feed phagotrophically, while light intensity, pH, and the presence of dissolved organic matter had no effect on phagotrophy. We conclude thatP. malhamensis is capable of phagotrophy at all times. In contrast, phototrophy is inducible in the light during starvation and is a long-term survival strategy for this mixotrophic alga (i.e., it operates on time scales greater than a diel cycle).     

Studies on the growth of riverainCladophora in culture

Summary Techniques were developed for studying the effects of environmental factors on the growth in culture ofCladophora glomerata from flowing waters.Cladophora still attached to rocks was transferred from the river to a laboratory stream and incubated there for 4 days under standard conditions. Small pieces of this material were cut off, cleaned, and used as inocula for shake culture experiments. These experiments were mostly designed to test the effect of various agents which have been widely quoted, in literature based on field observations, as limiting the growth ofCladophora. The alga is particularly sensitive to copper and zinc among the metals tested, and to DOBS-055, a soft detergent, among the detergents tested. The experimental results support the hypothesis that the alga may occasionally be limited by high natural iron concentrations, but not that it is so sensitive to high temperature that this factor alone would often limit its growth in British rivers.