Interaction of water with oriented DNA in the A- and B-form conformations.

High resolution 2H nuclear magnetic resonance (NMR) was used to investigate the interaction of D2O with solid samples of uniaxially oriented Li-DNA (B-form DNA) and Na-DNA (A- and B-form DNA). At low levels of hydration, 0 approximately 4 D2O/nucleotide, the 2H spectra shows a very weak (due to short T2) broad single resonance, suggestive of unrestricted rotational diffusion of the water. At approximately 5 or more D2O/nucleotide, the Li-DNA (B-form) spectra suddenly exhibit a large doublet splitting, characteristic of partially ordered water. With increasing hydration, the general trend is a decrease of this splitting. From our analysis we show that the DNA water structure reorganizes as the DNA is progressively hydrated. The D2O interaction with Na-DNA is rather different than with Li-DNA. Below 10 D2O/nucleotide Na-DNA is normally expected to be in the A-form, and a small, or negligible splitting is observed. In the range 9-19 D2O/nucleotide, the splitting increases with increasing hydration. Above approximately 20 D2O/nucleotide Na-DNA converts entirely to the B-form and the D2O splittings are then similar to those found in Li-DNA. We show that the complex Na-DNA results obtained in the range 0-20 D2O/nucleotide are caused by a mixture of A- and B-DNA in those samples.     

The mechanism of ATP–G-actin hydrolysis in Mg<Superscript>2+</Superscript>-containing solutions

NMR proton spectra were recorded in the range of proton resonance in the nucleotide aromatic ring of monomeric ATP–G-actin and the Mg²⁺–ATP–G-actin solutions in D2O to study the mechanism of ATP–G-actin hydrolysis and its role in F-actin formation in Mg²⁺-containing solutions. The experimental data show variations in the proton chemical shifts of the H2 and H8 peaks and splitting of the H8 resonance peak of G-actin-bound ATP adenine caused by interaction with magnesium dication. The observed variations in spectra are explained by hydrolysis of monomeric ATP–G-actin to ADP–G-actin, which is regarded as the initial stage of the G-actin to F-actin transformation.     

Structural basis for VO<Superscript>2+</Superscript> inhibition of nitrogenase activity (A): <Superscript>31</Superscript>P and <Superscript>23</Superscript>Na interactions with the metal at the nucleotide binding site of the nitrogenase Fe protein identified by ENDOR spectroscopy

We previously reported the vanadyl hyperfine couplings of VO(2+)-ATP and VO(2+)-ADP complexes in the presence of the nitrogenase Fe protein from Klebsiella pneumoniae (Petersen et al. in Biochemistry 41:13253-13263, 2002). It was demonstrated that different VO(2+)-nucleotide coordination environments coexist and are distinguishable by electron paramagnetic resonance (EPR) spectroscopy. Here orientation-selective continuous-wave electron-nuclear double resonance (ENDOR) spectra have been investigated especially in the low-radio-frequency range in order to identify superhyperfine interactions with nuclei other than protons. Some of these resonances have been attributed to the presence of a strong interaction with a 31P nucleus although no resolvable superhyperfine structure due to 31P or other nuclei was detected in the EPR spectra. The superhyperfine coupling component is determined to be about 25 MHz. Such a 31P coupling is consistent with an interaction of the metal with phosphorus from a directly, equatorially coordinated nucleotide phosphate group(s). Additionally, novel more prominent 31P ENDOR signals are detected in the low-frequency region. Some of these correspond to a relatively weak 31P coupling. This coupling is present with ATP for all pH forms but is absent with ADP. The ENDOR resonances of these weakly coupled 31P are likely to originate from an interaction of the metal with a nucleotide phosphate group of the nucleoside triphosphate and are attributed to a phosphorus with axial characteristics. Another set of resonances, split about the nuclear Zeeman frequency of 23Na, was detected, suggesting that a monovalent Na+ ion is closely associated with the divalent metal-nucleotide binding site. Na+ replacement by K+ unambiguously confirmed that ENDORs at radio frequencies between 3.0 and 4.5 MHz arise from an interaction with Na+ ions. In contrast to the low-frequency 31P signal, these resonances are present in spectra with both ADP and ATP, and for both low- and neutral-pH forms, although slight differences are detected, showing that these are sensitive to the nucleotide and pH.     

EPR spectroscopy shows a microtubule-dependent conformational change in the kinesin switch 1 domain

We have used site-directed spin-labeling and electron paramagnetic resonance spectroscopy to monitor a conformational change at the nucleotide site of kinesin. Cys-lite kinesin (K349 monomer) with the mutation S188C was spin labeled with MSL or MTSL. This residue is at the junction between the switch 1 region (which is a structure known to be sensitive to bound nucleotide in the G-proteins) and the alpha3-helix, adjacent to the nucleotide site. The spectra showed two or more components of mobility, which were independent of nucleotide in the absence of microtubules (MTs). The spectra of both labels showed a change of mobility upon binding to MTs. A more mobile spectral component became enhanced for all triphosphate analogs examined, AMPPNP, ADP.AlFx, or ADP.BeFx, in the presence of MTs, although the magnitude of the new component and the degree of mobility varied with nucleotide analog. The ADP state showed a much-reduced spectral change with a small shift to the more immobilized component in the presence of MTs. For kinesin.ADP.MT, a van't Hoff plot gave DeltaH degrees = -96 kJ/mol implying that the conformational change was extensive. We conclude there is a conformational change in the switch 1-alpha3-helix domain when kinesin binds to MTs.     

Influence of the bound nucleotide on the molecular dynamics of actin

Rotational dynamics of actin spin-labelled with maleimide probes at the reactive thiol Cys-374 were studied. Replacement of the bound nucleotide by Br8ATP in G-actin and Br8ADP in F-actin causes significant increase of the rotational correlation time of the spin probe, indicating reduced motion in both G and F-actin. The orientation dependence of the electron paramagnetic resonance spectra in oriented F-actin filaments revealed an altered molecular order of the probe when the nucleotide was a Br-substituted one. The bound nucleotide affects the myosin S1 ATPase activation by actin; both Vmax and K(actin) decreased significantly when the bound nucleotide of actin was Br8ADP.     

Structural Dynamics as a Contributor to Error-prone Replication by an RNA-dependent RNA Polymerase

RNA viruses encoding high- or low-fidelity RNA-dependent RNA polymerases (RdRp) are attenuated. The ability to predict residues of the RdRp required for faithful incorporation of nucleotides represents an essential step in any pipeline intended to exploit perturbed fidelity as the basis for rational design of vaccine candidates. We used x-ray crystallography, molecular dynamics simulations, NMR spectroscopy, and pre-steady-state kinetics to compare a mutator (H273R) RdRp from poliovirus to the wild-type (WT) enzyme. We show that the nucleotide-binding site toggles between the nucleotide binding-occluded and nucleotide binding-competent states. The conformational dynamics between these states were enhanced by binding to primed template RNA. For the WT, the occluded conformation was favored; for H273R, the competent conformation was favored. The resonance for Met-187 in our NMR spectra reported on the ability of the enzyme to check the correctness of the bound nucleotide. Kinetic experiments were consistent with the conformational dynamics contributing to the established pre-incorporation conformational change and fidelity checkpoint. For H273R, residues comprising the active site spent more time in the catalytically competent conformation and were more positively correlated than the WT. We propose that by linking the equilibrium between the binding-occluded and binding-competent conformations of the nucleotide-binding pocket and other active-site dynamics to the correctness of the bound nucleotide, faithful nucleotide incorporation is achieved. These studies underscore the need to apply multiple biophysical and biochemical approaches to the elucidation of the physical basis for polymerase fidelity.     

31P-NMR spectra of the Ha-ras p21.nucleotide complexes

Phosphorus nuclear magnetic resonance spectra of the Ha-ras oncogene product p21 and its nucleotide complexes have been obtained. It is shown that the 31P nuclear magnetic resonance spectra of a number of nucleotide-enzyme complexes show some common features. In particular, the chemical shift values of the beta-phosphorus resonance of enzyme-bound NTP and NDP (N = A, G) of hydrolases exhibit a downfield shift virtually identical for myosin, elongation factor Tu, and the Ha-ras oncogene product p21. This suggests that the stereochemistry around the beta-phosphorus might be similar in these compounds.     

Structural States and Dynamics of the D-Loop in Actin

Conformational changes induced by ATP hydrolysis on actin are involved in the regulation of complex actin networks. Previous structural and biochemical data implicate the DNase I binding loop (D-loop) of actin in such nucleotide-dependent changes. Here, we investigated the structural and conformational states of the D-loop (in solution) using cysteine scanning mutagenesis and site-directed labeling. The reactivity of D-loop cysteine mutants toward acrylodan and the mobility of spin labels on these mutants do not show patterns of an α-helical structure in monomeric and filamentous actin, irrespective of the bound nucleotide. Upon transition from monomeric to filamentous actin, acrylodan emission spectra and electron paramagnetic resonance line shapes of labeled mutants are blue-shifted and more immobilized, respectively, with the central residues (residues 43–47) showing the most drastic changes. Moreover, complex electron paramagnetic resonance line shapes of spin-labeled mutants suggest several conformational states of the D-loop. Together with a new (to our knowledge) actin crystal structure that reveals the D-loop in a unique hairpin conformation, our data suggest that the D-loop equilibrates in F-actin among different conformational states irrespective of the nucleotide state of actin.     

Nuclear magnetic resonance studies on transfer ribonucleic acid: assignment of AU tertiary resonances.

The hydrogen-bonded ring NH nuclear magnetic resonance (NMR) spectra of several transfer ribonucleic acid (RNA) species have been examined with particular emphasis on the extreme low-field portion. Betwen --13.8 and --15 ppm there are two extra resonances which are not derived from cloverleaf base pairs. A combined approach involving undermodified tRNAs, chemical modification, and hairpin fragment studies has assigned the T54--A58 resonance at --14.3 ppm in yeast tRNAPhe and Escherichia coli tRNA1 Val., the U8--A14 resonance has been assigned at --14.3 ppm, and the s4U8--A14 resonance in bacterial tRNAs has been assigned at --14.9 ppm. The T54--A58 resonance shifts between --14.3. and --13.8 ppm depending on the surrounding nucleotide sequence in the ribothymidine loop.     

Differential anti-proliferative properties of novel hydroxydicarboxylatoplatinum(II) complexes with high or low reactivity with thiols

We have examined the anti-proliferative effect of 13 recently synthesised platinum dicarboxylate complexes, very similar in their chemical, structural and kinetic properties to carboplatin. We used the L5178Y model: two murine lymphoma sublines, which differ in nucleotide excision repair ability and hence, in sensitivity to those platinum complexes that react with DNA. The anti-proliferative effect of the examined compounds mainly depends on the kind of amine ligand. Complexes with the primary amine (ethylenediamine) are more effective than complexes containing the tertiary amine (1-alkylimidazole). The ethylenediaminemalatoplatinum(II) complexes show a differential in vitro anti-proliferative activity in the L5178Y model; hence, it may be expected that they inflict DNA lesions that are repaired by the nucleotide excision system. The cytotoxicity of these complexes is directly correlated with reactivity with glutathione (GSH). The 1-alkylimidazole complexes are of low toxicity and moderate to low reactivity with GSH; in contrast to the ethylenediaminemalatoplatinum(II) complexes, their cytotoxicity is inversely correlated with reactivity with GSH. Two of the 1-alkylimidazole complexes, bis(1-ethylimidazole)(L-malato)platinum(II) and bis(1-propylimidazole (L-malato)platinum(II), show a considerable ability to arrest cells in G2 phase. We expect that the properties of these two groups of platinum complexes may be exploited in combined platinum complex treatment and irradiation.     

Resonance raman spectroscopy of iron (3)--ovotransferrin and iron (3)--human serum transferrin

We report the resonance Raman spectra in the frequency range 300–1800 cm^?1 of Fe (III)-ovotransferrin and Fe (III)-human serum transferrin in aqueous solution at about 10^?4M protein concentration. This is the first observation of resonance Raman scattering ascribable to amino acid ligand vibrational modes of a nonheme iron protein. The resonance Raman spectra of the transferrins are similar except that the resonance band near 1270 cm^?1 is shifted to a higher frequency for Fe(III)-human serum transferrin than that for Fe(III)-ovotransferrin. The resonance Raman bands observed near 1170, 1270, 1500 and 1600 cm^?1 may reflect resonance enhancement of p-hydroxy-phenyl frequencies of tyrosine residues and/or imidazolium frequencies of histidine residues.     

Conformational transition of polypeptide chain elongation factor G as determined by electron spin resonance.

The conformational transition of the polypeptide chain elongation factor G (EF-G) induced by interaction with guanine nucleotide has been investigated by means of the spin-labeling technique. Various spin-label probes were attached specifically to the sulfhydryl group of the protein that is essential for binding to ribosomes, and the effects of these ligands on the electron spin resonance (ESR) spectra were examined. It was found that the ESR spectra of EF-G labeled with nitroxide maleimide reagents were modified by the addition of various guanine nucleotides such as GDP, GTP and, to a lesser extent, by Gpp(NH)p and Gpp(CH2)p, indicating that conformational changes accompany the binding of nucleotide ligand. However, the ESR spectra of labeled EF-G-GDP and EF-G-GTP were almost identical. On the other hand, when EF-G was labeled with nitroxide iodoacetamide reagents, a clear difference in the ESR spectra of EF-G-GDP and EF-G-GTP derivatives was observed. In this case, the spectral shape of the spin-labeled EF-G in the presence of GTP or its analogs, Gpp(NH)p or Gpp(CH2)p, was quite similar to that of free, unliganded EF-G derivative. These results, together with those previously obtained using hydrophobic probes (Arai, Arai, & Kaziro (1975) J. Biochem. 78, 243-246) demonstrate the existence of an EF-G-guanine nucleotide binary complex. They also indicate that there is a substantial difference in conformation between free EF-G, EF-G-GDP, and EF-G-GTP near the active site essential for interaction with ribosomes.     

Observation of slow dynamic exchange processes in Ras protein crystals by 31P solid state NMR spectroscopy

The folding, structure and biological function of many proteins are inherently dynamic properties of the protein molecule. Often, the respective molecular processes are preserved upon protein crystallization, leading, in X-ray diffraction experiments, to a blurring of the electron density map and reducing the resolution of the derived structure. Nuclear magnetic resonance (NMR) is known to be an alternative method to study molecular structure and dynamics. We designed and built a probe for phosphorus solid state NMR that allows for the first time to study static properties as well as dynamic processes in single-crystals of a protein by NMR spectroscopy. The sensitivity achieved is sufficient to detect the NMR signal from individual phosphorus sites in a 0.3mm(3) size single-crystal of GTPase Ras bound to the nucleotide GppNHp, that is, the signal from approximately 10(15) phosphorus nuclei. The NMR spectra obtained are discussed in terms of the conformational variability of the active center of the Ras-nucleotide complex. We conclude that, in the crystal, the protein complex exists in three different conformations. Magic angle spinning (MAS) NMR spectra of a powder sample of Ras-GppNHp show a splitting of one of the phosphate resonances and thus confirm this conclusion. The MAS spectra provide, furthermore, evidence of a slow, temperature-dependent dynamic exchange process in the Ras protein crystal.     

Magic angle spinning carbon-13 NMR of tobacco mosaic virus. An application of the high-resolution solid-state NMR spectroscopy to very large biological systems.

Magic angle spinning 13C NMR was used to study tobacco mosaic virus (TMV) in solution. Well-resolved 13C NMR spectra were obtained, in which several carbon resonances of amino acids of the TMV coat protein subunits that are not observable by conventional high-resolution NMR spectroscopy can be designed. RNA resonance were absent, however, in the magic angle spinning 13C NMR spectra. Since three different binding sites are available for each nucleotide of the RNA, this is probably due to a line broadening caused by distributions of isotropic chemical shift values. In 13C-enriched TM 13C-13C dipolar interactions also gave rise to line broadening. By suitable pulse techniques that discriminate carbon resonances on the basis of their T1 and T1 rho values, it was possible to select particular groups of carbon nuclei with characteristic motional properties. Magic angle spinning 13C NMR spectra obtained with these pulse techniques are extremely well resolved.     

Resolution of conformational states of spin-labeled myosin during steady-state ATP hydrolysis

We have measured the conventional electron paramagnetic resonance (EPR) spectrum of spin-labeled myosin filaments as a function of the nucleotide occupancy of the active site of the enzyme. The probe used was 4-(2-iodoacetamido)-2,2,6,6-tetramethylpiperidine-1-oxyl (IASL), which reacts specifically with sulfhydryl 1 of the myosin head. In the absence of nucleotide, the probe remains strongly immobilized (rigidly attached to the myosin head) so that no nanosecond rotational motions are detectable. When MgADP is added to IASL-labeled myosin filaments (T = 20 degrees C), the probe mobility increases slightly. During steady-state MgADP hydrolysis (T = 20 degrees C), the probe undergoes large-amplitude nanosecond rotational motion. These results are consistent with previous studies of myosin monomers, heavy meromyosin, and myosin subfragment 1. Isoclinic points observed in overlays of sequential EPR spectra recorded during ATP hydrolysis strongly suggest that the probes fall into two motional classes, separated by approximately an order of magnitude in effective rotational correlation time. Both of the observed states are distinct from the conformation of myosin in the absence of nucleotides, and the spectrum of the less mobile population is indistinguishable from that observed in the presence of MgADP. The addition of ADP and vanadate to IASL-myosin gives rise to two motional classes virtually identical with those observed in the presence of ATP, but the relative concentrations of the spin populations are significantly different. We have quantitated the percentage of myosin in each motional state during ATP hydrolysis. The result agrees well with the predicted percentages in the two predominant chemical states in the myosin ATPase cycle. Spectra obtained in the presence of nucleotide analogues permit us to assign the conformational states to specific chemical states. We propose that the two motional classes represent two distinct local conformations of myosin that are in exchange with one another during the ATP hydrolysis reaction cycle.     

Insect crossbridges, relaxed by spin-labeled nucleotide, show well-ordered 90 degrees state by X-ray diffraction and electron microscopy, but spectra of electron paramagnetic resonance probes report disorder.

The structure of glycerinated Lethocerus insect flight muscle fibers, relaxed by spin-labeled ATP and vanadate (Vi), was examined using X-ray diffraction, electron microscopy and electron paramagnetic resonance (e.p.r.) spectra. We obtained excellent relaxation of MgATP quality as determined by mechanical criteria, using vanadate trapping of 2' spin-labeled 3' deoxyATP at 3 degree C. In rigor fibers, when the diphosphate analog is bound in the absence of Vi, the probes on myosin heads are well-ordered, in agreement with electron microscopic and X-ray patterns showing that myosin heads are ordered when attached strongly to actin. In relaxed muscle, however, e.p.r. spectra report orientational disorder of bound (Vi-trapped) spin-labeled nucleotide, while electron microscopic and X-ray patterns both show well-ordered bridges at a uniform 90 degrees angle to the filament axis. The spin-labeled nucleotide orientation is highly disordered, but not completely isotropic; the slight anisotropy observed in probe spectra is consistent with a shift of approximately 10% of probes from angles close to 0 degrees to angles close to 90 degrees. Measurements of probe mobility suggest that the interaction between probe and protein remains as tight in relaxed fibers as in rigor, and thus that the disorder in relaxed fibers arises from disorders of (or within) the protein and not from disorder of the probe relative to the protein. Fixation of the relaxed fibers with glutaraldehyde did not alter any aspect of the spectrum of the Vi-trapped analog, including the slight order observed, showing that the extensive inter- and intra-molecular cross-linking of the first step of sample preparation for electron microscopy had not altered relaxed crossbridge orientations. Two models that may reconcile the apparently disparate results obtained on relaxed fibers are presented: (1) a rigid myosin head could possess considerable disorder in the regular array about the thick filament; or (2) the nucleotide site could be on a disordered, probably distal, domain of myosin, while a more proximal region is well ordered on the thick filament backbone. Our findings suggest that when e.p.r. probes signal disorder of a local site or domain, this is complementary, not contradictory, to signals of general order. The e.p.r. spectra show that a portion of the myosin molecule can be disordered at the same time as the X-ray diffraction and electron microscopy show the bulk of myosin head mass to be uniformly oriented and regularly arrayed.     

Nucleotide binding to the multidrug resistance P-glycoprotein as studied by ESR spectroscopy

Electron spin resonance (ESR) spectroscopy using spin-labeled ATP was used to study nucleotide binding to and structural transitions within the multidrug resistance P-glycoprotein, P-gp. Spin-labeled ATP (SL-ATP) with the spin label attached to the ribose, was observed to be an excellent substrate analogue for P-gp. SL-ATP was hydrolyzed in a drug-stimulated fashion at about 14% of the rate for normal ATP and allowed reversible trapping of the enzyme in transition and ground states. Equilibrium binding of a total of two nucleotides per P-gp was observed with a binding affinity of 366 microM in the presence of Mg2+ but in the absence of transport substrates such as verapamil. Binding of SL-ATP to wild-type P-gp in the presence of verapamil resulted in reduction of the protein-bound spin-label moiety, most likely due to a conformational transition within P-gp that positioned cysteines in close proximity to the spin label to allow chemical reduction of the radical. We circumvented this problem by using a mutant of P-gp in which all naturally occurring cysteines were substituted for alanines. Equilibrium binding of SL-ATP to this mutant P-gp resulted in maximum binding of two nucleotides; the binding affinity was 223 microM in the absence and 180 microM in the presence of verapamil. The corresponding ESR spectra of wild-type and Cys-less P-gp in the presence of SL-ATP indicate that a cysteine side chain of P-gp is located close to the ribose of the bound nucleotide. Trapping SL-ATP as an AlF(x)-adduct resulted in ESR spectra that showed strong immobilization of the radical, supporting the formation of a closed conformation of P-gp in its transition state. This study is the first to employ ESR spectroscopy with the use of spin-labeled nucleotide analogues to study P-glycoprotein. The study shows that SL-ATP is an excellent substrate analogue that will allow further exploration of structure and dynamics within the nucleotide binding domains of this important enzyme.     

Identification of candidate SNPs for drug induced toxicity from differentially expressed genes in associated tissues

The growing collection of publicly available high-throughput data provides an invaluable resource for generating preliminary in silico data in support of novel hypotheses. In this study we used a cross-dataset meta-analysis strategy to identify novel candidate genes and genetic variations relevant to paclitaxel/carboplatin-induced myelosuppression and neuropathy. We identified genes affected by drug exposure and present in tissues associated with toxicity. From ten top-ranked genes 42 non-synonymous single nucleotide polymorphisms (SNPs) were identified in silico and genotyped in 94 cancer patients treated with carboplatin/paclitaxel. We observed variations in 11 SNPs, of which seven were present in a sufficient frequency for statistical evaluation. Of these seven SNPs, three were present in ABCA1 and ATM, and showed significant or borderline significant association with either myelosuppression or neuropathy. The strikingly high number of associations between genotype and clinically observed toxicity provides support for our data-driven computations strategy to identify biomarkers for drug toxicity.     

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.     

Orientation of spin-labeled nucleotides bound to myosin in glycerinated muscle fibers.

Electron paramagnetic resonance (EPR) spectroscopy of paramagnetic derivatives of ATP has been used to probe the angular distribution of myosin in glycerinated muscle fibers. Three nucleotide spin labels have been prepared with the nitroxide free radical moiety attached, via an ester linkage to either: the 2' or 3' positions of the ribose unit of ATP (SL-ATP), the 2' position of 3' deoxy ATP (2'SL-dATP), or the 3' position of 2' deoxy ATP (3'SL-dATP). In muscle fibers, these nucleotides are quickly hydrolyzed to their diphosphate forms. All three diphosphate analogues bind to the nucleotide site of myosin with similar affinities: rabbit psoas fibers, 7 X 10(3)/M; insect flight muscle, 5 X 10(3)/M; and rabbit soleus muscle, 2 X 10(4)/M. Analysis of the spectra showed that the principal z-axis of the nitroxide attached to bound nucleotides was oriented with respect to the filament axis. The principal axes of 3'SL-dADP and 2'SL-dADP appeared to be preferentially aligned at mean angles of 67 degrees +/- 4 degrees and 55 degrees +/- 5 degrees, respectively. The distribution of probes about these angles can be described by Gaussians with widths of 16 degrees +/- 4 degrees and 13 degrees +/- 5 degrees, respectively. The spectrum of bound SL-ADP was a linear combination of the spectra of the two deoxy analogues. These orientations were the same in the three muscle types examined, indicating a high degree of homology in the nucleotide binding site. Applying static strains as high as 0.2 N/mm2 to muscle fibers caused no change in the orientation of myosin-bound, spin-labeled nucleotides. When muscle fibers were stretched to decrease actin and myosin filament overlap, bound SL-ADP produced EPR spectra indicative of probes with a highly disordered angular distribution. Sodium vanadate and SL-ATP caused fiber stiffness to decrease, and the EPR spectrum of the bound analogue indicated an increase in the fraction of disoriented probes with a concomitant decrease in the fraction of oriented probes. These findings indicate that when myosin is bound to actin its nucleotide site is highly oriented relative to the fiber axis, and when this interaction is removed the orientation of the nucleotide site becomes highly disordered.