Recognition of tRNALeu by Aquifex aeolicus leucyl-tRNA synthetase during the aminoacylation and editing steps

Recognition of tRNA by the cognate aminoacyl-tRNA synthetase during translation is crucial to ensure the correct expression of the genetic code. To understand tRNA^Leu recognition sets and their evolution, the recognition of tRNA^Leu by the leucyl-tRNA synthetase (LeuRS) from the primitive hyperthermophilic bacterium Aquifex aeolicus was studied by RNA probing and mutagenesis. The results show that the base A73; the core structure of tRNA formed by the tertiary interactions U8–A14, G18–U55 and G19–C56; and the orientation of the variable arm are critical elements for tRNA^Leu aminoacylation. Although dispensable for aminoacylation, the anticodon arm carries discrete editing determinants that are required for stabilizing the conformation of the post-transfer editing state and for promoting translocation of the tRNA acceptor arm from the synthetic to the editing site.     

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.     

tRNA nucleotide 47: an evolutionary enigma.

A previous analysis of tRNA sequences suggested a correlation between the absence of a nucleotide at position 47 (nt 47) in the extra loop and the presence of a U13:G22 base pair in the D-stem. We have evaluated the significance of this correlation by determining the in vivo activity of tRNAs containing either a C13:G22 or a U13:G22 pair in tRNA molecules with or without nt 47. Although this correlation might reflect some malfunction of tRNAs lacking nt 47, but containing the C13:G22, assays of the in vivo suppressor activity showed that this tRNA is actually more active than the tRNA with the features found in the database, i.e., a U13:G22 base pair and no nt 47. Moreover, analogous constructs with a GGC anticodon permitted the growth of an Escherichia coli strain deleted for tRNA(Ala)GGC genes equally well. On the other hand, long-term growth experiments with competing E. coli strains harboring the tRNA lacking nt 47, either with the C13:G22 or the U13:G22 base pair demonstrated that the U13:G22 tRNA overtook the C13:G22 strain even when the starting proportion of strains favored the C13:G22 strain. Thus, the preference for the U13:G22 tRNA lacking nt 47 in the sequence database is most likely due to factors that come into play during extended growth or latency rather than to the ability of the tRNA to engage in protein synthesis.     

On the accessibility and selection of the initiator site of mRNA in protein synthesis.

The specificity of the cell-free system of Escherichia coli for mRNA was examined, and the "accessibility" of some natural and synthetic RNAs to the ribosomes was determined by measurement of AcPhe-tRNA and fMet-tRNA binding, AcPhe-puromycin and fMet-puromycin formation, and polypeptide synthesis. The E. coli system effectively initiates the translation of various synthetic RNAs with AcPhe-tRNA or fMet-tRNA under conditions optimal for the translation of viral RNA. Poly(A,G,U) is accessible to the ribosomes according to all of the above criteria. Poly(A,C,G,U), 23 S rRNA, R17 RNA, and MS2 RNA, on the other hand, show limited accessibility when tested for initiator tRNA binding, or for AcPhe-puromycin and fMet-puromycin formation. MS2 and R17 RNA, but not poly(A,C,G,U) and 23 S rRNA, show accessibility when measured by polypeptide synthesis. The results suggest that, except at initiator sites of natural mRNA, an RNA containing about equal amounts of all four bases is inaccessible to E. coli ribosomes for polypeptide synthesis. Rate constants obtained for fMet-tRNA binding with MS2 RNA, poly(A,G,U), and poly(C,G,U) indicate that the ribosomes do not have any special affinity for the viral RNA. Thus, the selection of the initiator site in protein synthesis may be critically determined more by the accessibility of the initiator codon than by ribosomal recognition of the site.     

Interaction between Escherichia coli RNase P RNA and the discriminator base results in slow product release.

We suggested previously that a purine at the discriminator base position in a tRNA precursor interacts with the well-conserved U294 in M1 RNA, the catalytic subunit of Escherichia coli RNase P. Here we investigated this interaction and its influence on the kinetics of cleavage as well as on cleavage site selection. The discriminator base in precursors to tRNA(Tyr)Su3 and tRNA(Phe) was changed from A to C and cleavage kinetics were studied by wild-type M1 RNA and a mutant M1 RNA carrying the compensatory substitution of a U to a G at position 294 in M1 RNA. Our data suggest that the discriminator base interacts with the residue at position 294 in M1 RNA. Although product release is a rate-limiting step both in the absence and in the presence of this interaction, its presence results in a significant reduction in the rate of product release. In addition, we studied cleavage site selection on various tRNA(His) precursor derivatives. These precursors carry a C at the discriminator base position. The results showed that the mutant M1 RNA harboring a G at position 294 miscleaved a wild-type tRNA(His) precursor and a tRNA(His) precursor carrying an inosine at the cleavage site. The combined data suggest a functional interaction between the discriminator base and the well-conserved U294 in M1 RNA. This interaction is suggested to play an important role in determining the rate of product release during multiple turnover cleavage of tRNA precursors by M1 RNA as well as in cleavage site selection.     

The RNA origin of transfer RNA aminoacylation and beyond

Aminoacylation of tRNA is an essential event in the translation system. Although in the modern system protein enzymes play the sole role in tRNA aminoacylation, in the primitive translation system RNA molecules could have catalysed aminoacylation onto tRNA or tRNA-like molecules. Even though such RNA enzymes so far are not identified from known organisms, in vitro selection has generated such RNA catalysts from a pool of random RNA sequences. Among them, a set of RNA sequences, referred to as flexizymes (Fxs), discovered in our laboratory are able to charge amino acids onto tRNAs. Significantly, Fxs allow us to charge a wide variety of amino acids, including those that are non-proteinogenic, onto tRNAs bearing any desired anticodons, and thus enable us to reprogramme the genetic code at our will. This article summarizes the evolutionary history of Fxs and also the most recent advances in manipulating a translation system by integration with Fxs.     

Mutant aminoacyl-tRNA synthetase that compensates for a mutation in the major identity determinant of its tRNA

A single G3.U70 base pair in the acceptor helix is the major determinant for the identity of alanine transfer RNAs (Hou & Schimmel, 1988). Introduction of this base pair into foreign tRNA sequences confers alanine acceptance on them. Moreover, small RNA helices with as few as seven base pairs can be aminoacylated with alanine, provided that they encode the critical base pair (Francklyn & Schimmel, 1989). Alteration of G3.U70 to G3.C70 abolishes aminoacylation with alanine in vivo and in vitro. We describe here the mutagenesis and selection of a single point mutation in Escherichia coli Ala-tRNA synthetase that compensates for a G3.C70 mutation in tRNAAla. The mutation maps to a region previously implicated as proximal to the acceptor end of the bound tRNA. In contrast to the wild-type enzyme, the mutant charges small RNA helices that encode a G3.C70 base pair. However, the mutant enzyme retains specificity for alanine tRNA and can serve as the sole source of Ala-tRNA synthetase in vivo. The results demonstrate the capacity of an aminoacyl-tRNA synthetase to compensate through a single amino acid substitution for mutations in the major determinant of its cognate tRNA.     

Orientation of the tRNA anticodon in the ribosomal P-site: quantitative footprinting with U33-modified, anticodon stem and loop domains.

Binding of transfer RNA (tRNA) to the ribosome involves crucial tRNA-ribosomal RNA (rRNA) interactions. To better understand these interactions, U33-substituted yeast tRNA(Phe) anticodon stem and loop domains (ASLs) were used as probes of anticodon orientation on the ribosome. Orientation of the anticodon in the ribosomal P-site was assessed with a quantitative chemical footprinting method in which protection constants (Kp) quantify protection afforded to individual 16S rRNA P-site nucleosides by tRNA or synthetic ASLs. Chemical footprints of native yeast tRNA(Phe), ASL-U33, as well as ASLs containing 3-methyluridine, cytidine, or deoxyuridine at position 33 (ASL-m3U33, ASL-C33, and ASL-dU33, respectively) were compared. Yeast tRNAPhe and the ASL-U33 protected individual 16S rRNA P-site nucleosides differentially. Ribosomal binding of yeast tRNA(Phe) enhanced protection of C1400, but the ASL-U33 and U33-substituted ASLs did not. Two residues, G926 and G1338 with KpS approximately 50-60 nM, were afforded significantly greater protection by both yeast tRNA(Phe) and the ASL-U33 than other residues, such as A532, A794, C795, and A1339 (KpS approximately 100-200 nM). In contrast, protections of G926 and G1338 were greatly and differentially reduced in quantitative footprints of U33-substituted ASLs as compared with that of the ASL-U33. ASL-m3U33 and ASL-C33 protected G530, A532, A794, C795, and A1339 as well as the ASL-U33. However, protection of G926 and G1338 (KpS between 70 and 340 nM) was significantly reduced in comparison to that of the ASL-U33 (43 and 61 nM, respectively). Though protections of all P-site nucleosides by ASL-dU33 were reduced as compared to that of the ASL-U33, a proportionally greater reduction of G926 and G1338 protections was observed (KpS = 242 and 347 nM, respectively). Thus, G926 and G1338 are important to efficient P-site binding of tRNA. More importantly, when tRNA is bound in the ribosomal P-site, G926 and G1338 of 16S rRNA and the invariant U33 of tRNA are positioned close to each other.     

In vitro selection of RNAs that undergo autolytic cleavage with Pb2+.

An in vitro selection method has been developed to obtain RNA molecules that specifically undergo autolytic cleavage reactions by Pb2+ ion. The method utilizes a circular RNA intermediate which is regenerated following the cleavage reaction to allow amplification and multiple cycles of selection. Pb2+ is known to catalyze a specific cleavage reaction between U17 and G18 of yeast tRNA(Phe). Starting from pools of RNA molecules which have a random distribution of sequences at nine or ten selected positions in the sequence of yeast tRNA(Phe), we have isolated many RNA molecules that undergo rapid and specific self-cleavage with Pb2+ at a variety of different sites. Terminal truncation experiments suggest that most of these self-cleaving RNA molecules do not fold like tRNA. However, two of the variants are cleaved rapidly with Pb2+ at U17 even though they lack the highly conserved nucleotides G18 and G19. Both specific mutations and terminal truncation experiments suggest that the D and T loops of these two variants interact in a manner similar to that of tRNA(Phe) despite the absence of the G18U55 and G19C56 tertiary interactions. A model for an alternate tertiary interaction involving a U17U55 pair is presented. This model may be relevant to the structure of about 100 mitochondrial tRNAs that also lack G18 and G19. The selection method presented here can be directly applied to isolate catalytic RNAs that undergo cleavage in the presence of other metal ions, modified nucleotides, or sequence-specific nucleases.     

The origin of the protein synthesis mechanism

The origin and development of the protein synthesis mechanism is considered in four successive steps. The genetic code is supposed to be controlled by the relative amount (availability) of various amino acids and nucleotides on the one hand, and utility on each amino acid in the polypeptide. on the other hand. Thus, more simple (inutile) and abundant amino acids tended to correspond to codons which were rich in the less frequent base species, G and C. Features of primitive tRNA in the discrimination of amino acid are discussed. Primitive tRNA is proposed to have a discriminator site for amino acid and, separated from it, an anticodon site for interaction with nucleotides. A hypothetical course of subdivision of various nucleic acid species is proposed. In the scheme, mRNA and ribosomal RNA (rRNA) were derived from more primitive insoluble RNA. DNA appeared in the late, not first, step of the development. Several other aspects of evolutionary development of the whole protein synthesis mechanism, e.g., role of the discriminator site on primitive tRNA, modification and subdivision of code catalogue into a more precise specification of amino acids, and possible primordial interactions between tRNA and tRNA-binding sites on insoluble rRNA, are discussed.     

A single base pair affects binding and catalytic parameters in the molecular recognition of a transfer RNA

A single G3.U70 base pair in the acceptor helix is a major determinant of the identity of an alanine transfer RNA. Alteration of this base pair to A.U or G.C prevents aminoacylation with alanine. We show here that, at approximate physiological conditions (pH 7.5, 37 degrees C), high concentrations of the mutant A3.U70 species do not inhibit aminoacylation of a wild-type alanine tRNA. The observation suggests that, under these conditions, the G3 to A3 substitution increases Km for tRNA by more than 30-fold. Other experiments at pH 7.5 show that no aminoacylation of A3.U70, G3.C70, or U3.G70 mutant tRNAs occurs with substrate levels of enzyme. This suggests that kcat for these mutant tRNAs is sharply reduced as well and that the catalytic defect is not due to slow release of charged mutant tRNAs from the enzyme. Investigations were also done at pH 5.5, where association of tRNAs with synthetases is generally stronger and where binding can be conveniently measured apart from aminoacylation. Under these conditions, the binding of the A3.U70 and G3.C70 species is readily detected and is only 3-5-fold weaker than the binding of the wild-type tRNA. Although the A3.U70 species was demonstrated to compete with the wild-type tRNA for the same site on the enzyme, no aminoacylation could be detected. Thus, even when conditions are adjusted to obtain strong competitive binding, a sharp reduction in kcat prevents aminoacylation of a tRNA(Ala) species with a substitution at position 3.70.     

Amplification of the sequences displaying the pattern RNY in the RNA world: the translation --> translation/replication hypothesis

Based on previous considerations published in J. theor. Biol., new analyses of the organization of the genetic system are reported in this paper. We show that theoretical considerations about the order observed in the genetic code table support the idea of a primitive self-aminoacylation process achieved by primordial tRNAs. The physico-chemical constraints connected with this process may explain why a primitive genetic system predominantly uses sequences with the codonic pattern RNN (R=purine; Y=pyrimidine; N=any of the four bases) to polymerize the amino acids into peptides through translation. These considerations lead us to propose the Translation --> Translation/Replication hypothesis, which may explain why only RNA sequences with the pattern RNY, instead of less restrictive RNN, are susceptible to amplification. Using these ideas, supported by properties of symmetry, features of the genetic code may be connected with the replication of specific RNA sequences in the RNA world.     

A nucleotide that enhances the charging of RNA minihelix sequence variants with alanine.

We showed earlier that a single G3.U70 base pair within the amino acid acceptor helix is a major determinant of the identity of tRNA(Ala). In addition, we demonstrated that an RNA hairpin minihelix that recreates the 12 base pair acceptor-T psi C stem of tRNA(Ala) is also aminoacylated in a G3.U70-dependent manner. Determinants for efficient aminoacylation at pH 7.5 have been further investigated with minihelix substrates that have sequence variations at 3.70 and other locations. Although a U,U mismatch and other 3.70 nucleotide alternatives to G.U were recently proposed by others as also important for alanine acceptance, neither that mismatch nor any of four other 3.70 nucleotide combinations confer aminoacylation in vitro with alanine, even with substrate levels of enzyme. In contrast, permutations of the so-called discriminator nucleotide N73 (at position 73) strongly modulate, but do not block, aminoacylation of those substrates that encode G3.U70. In particular, the efficiency of G3.U70-dependent aminoacylation with alanine is strongly enhanced by having the wild-type A73. The effect of N73 alone can explain most of the difference in aminoacylation efficiency of a G3.U70-containing tRNA and a minihelix substrate whose sequences vary significantly from their tRNA(Ala) counterparts. Comparison with earlier work suggests that the substantial modulating effect of N73 is partly or completely obscured when N73 tRNA variants are expressed as amber suppressors in vivo.     

Structure of the acceptor stem of Escherichia coli tRNA Ala: role of the G3.U70 base pair in synthetase recognition.

The fidelity of translation of the genetic code depends on accurate tRNA aminoacylation by cognate aminoacyl-tRNA synthetases. Thus, each tRNA has specificity not only for codon recognition, but also for amino acid identity; this aminoacylation specificity is referred to as tRNA identity. The primary determinant of the acceptor identity of Escherichia coli tRNAAlais a wobble G3.U70 pair within the acceptor stem. Despite extensive biochemical and genetic data, the mechanism by which the G3.U70 pair marks the acceptor end of tRNAAla for aminoacylation with alanine has not been clarified at the molecular level. The solution structure of a microhelix derived from the tRNAAla acceptor end has been determined at high precision using a very extensive set of experimental constraints (approximately 32 per nt) obtained by heteronuclear multidimensional NMR methods. The tRNAAla acceptor end is overall similar to A-form RNA, but important differences are observed. The G3.U70 wobble pair distorts the conformation of the phosphodiester backbone and presents the functional groups of U70 in an unusual spatial location. The discriminator base A73 has extensive stacking overlap with G1 within the G1.C72 base pair at the end of the double helical stem and the -CCA end is significantly less ordered than the rest of the molecule.     

Interaction of translation initiation factor IF1 with the E. coli ribosomal A site

Initiation Factor 1 (IF1) is required for the initiation of translation in Escherichia coli. However, the precise function of IF1 remains unknown. Current evidence suggests that IF1 is an RNA-binding protein that sits in the A site of the decoding region of 16 S rRNA. IF1 binding to 30 S subunits changes the reactivity of nucleotides in the A site to chemical probes. The N1 position of A1408 is enhanced, while the N1 positions of A1492 and A1493 are protected from reactivity with dimethyl sulfate (DMS). The N1-N2 positions of G530 are also protected from reactivity with kethoxal. Quantitative footprinting experiments show that the dissociation constant for IF1 binding to the 30 S subunit is 0.9 microM and that IF1 also alters the reactivity of a subset of Class III sites that are protected by tRNA, 50 S subunits, or aminoglycoside antibiotics. IF1 enhances the reactivity of the N1 position of A1413, A908, and A909 to DMS and the N1-N2 positions of G1487 to kethoxal. To characterize this RNA-protein interaction, several ribosomal mutants in the decoding region RNA were created, and IF1 binding to wild-type and mutant 30 S subunits was monitored by chemical modification and primer extension with allele-specific primers. The mutations C1407U, A1408G, A1492G, or A1493G disrupt IF1 binding to 30 S subunits, whereas the mutations G530A, U1406A, U1406G, G1491U, U1495A, U1495C, or U1495G had little effect on IF1 binding. Disruption of IF1 binding correlates with the deleterious phenotypic effects of certain mutations. IF1 binding to the A site of the 30 S subunit may modulate subunit association and the fidelity of tRNA selection in the P site through conformational changes in the 16 S rRNA.