Binding of EBNA-1 to DNA creates a protease-resistant domain that encompasses the DNA recognition and dimerization functions.

The Epstein-Barr virus nuclear antigen EBNA-1 is essential for replication of the viral DNA during latency. EBNA-1 binds as a dimer to palindromic recognition sequences within the plasmid origin of replication, ori-P. In this study, proteinase K susceptibility has been used to further characterize the DNA-binding domain of EBNA-1. Limited protease digestion of EBNA-1 (amino acids 408 to 641) generated a smaller DNA-binding species that had a degree of inherent protease resistance. When EBNA-1 was preincubated with a specific DNA probe, the protease resistance of the smaller binding species increased 100-fold, suggesting that the conformation of EBNA-1 changes on binding. The protease-resistant species comprised an 18-kDa polypeptide that was further cleaved at high levels of protease to 11- and 5.4-kDa products. A model of the proposed protease-resistant domain structure is presented. Constructions carrying serial, internal deletions across the 18-kDa domain were created. Each of the deletions perturbed dimerization ability and abolished DNA binding. These studies suggest that the DNA-binding and dimerization motifs of EBNA-1 lie within a conformationally discrete domain whose overall integrity is necessary for EBNA-1-DNA interaction.     

Modeling multi-component protein-DNA complexes: the role of bending and dimerization in the complex of p53 dimers with DNA

We used molecular modeling to study the optimal conformation of the complex between two p53 DNA-binding domain monomers and a 12 base-pair target DNA sequence. The complex was constructed using experimental data on the monomer binding conformation and a new approach to deform the target DNA sequence. Combined with an internal/helicoidal coordinate model of DNA, this approach enables us to bend the target sequence in a controlled way while respecting the contacts formed with each p53 monomer. The results show that the dimeric complex favors DNA bending towards the major groove at the dimer junction by a value close to experimental findings. In contrast to inferences from earlier models, the calculation of key contributions to the free energy of the complexes indicates a determinant role for DNA in the formation of the complex with the dimer of the p53 DNA-binding domains.     

Flexibility of DNA in complex with proteins deduced from the distribution of bending angles observed by scanning force microscopy

Flexibility and dynamics of DNA are important for DNA-binding and recognition by proteins. Here the flexibility of DNA is calculated from the distribution of DNA-bending angles of single DNA molecules as observed by scanning force microscopy by applying an equation that links the force constant of DNA-bending (f) to the variance of the distribution of bending angles (sigma): f=RT/sigma(2). Using published data, f is calculated to be 3-5 J/degree(2) for free DNA. Thus, bending DNA by 20 degrees requires approx. 0.5-1 kJ/mol. This result shows that DNA is very flexible and readily can be bent by thermal motion. DNA-flexibility is not altered in some protein-DNA complexes (HhaI methyltransferase, EcoRV restriction endonuclease). In contrast, DNA-binding by EcoRI endonuclease increases DNA-flexibility and binding by EcoRI methyltransferase restricts the flexibility of DNA. During the transition of the RNA polymerase-sigma(54)-DNA complex from the closed to the open form and of cro repressor from a non-specific to a specific binding mode the flexibility of the DNA is strongly reduced.     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.     

Analysis of the binding of C-reactive protein to chromatin subunits

C-reactive protein (CRP) is an acute phase serum protein in man. The functional activities of CRP, like Ig, include complement activation and enhancement of phagocytosis. CRP binding to several substrates, including phosphocholine, individual denatured histones, and chromatin, has been demonstrated. We previously demonstrated that CRP binding to chromatin is dependent on the presence of histone H1, despite the fact that CRP binds to purified individual histones H2A and H2B, as well as to H1. In this report we examined the binding of CRP to native sub-nucleosomal chromatin fragments. CRP binding to the H2A-H2B dimer and (H3-H4)2 tetramer was demonstrated and these reactions were inhibited by phosphocholine. However, no binding to the subnucleosome complexes (H2A-H2B)-DNA and (H3-H4)2-DNA was seen. Similarly, CRP binding to H1 was eliminated when H1 was reconstituted with DNA. The reconstitution of H1-depleted chromatin with H1 restored CRP binding. CRP binding to nucleosome core particles, as previously demonstrated by others, was confirmed. Therefore, the interaction of CRP with individual core histones does not appear to be responsible for the binding of CRP to native chromatin. However, binding to core particles could be mediated by differentially exposed determinants on H2A and H2B.