High-resolution solid-state 13C NMR of the LH1 from Rhodospirillum rubrum

High-resolution solid-state 13C NMR spectra of the light-harvesting antenna complex (LH1) from Rhodospirillum rubrum were observed for the first time by cross-polarization (CP), magic angle spinning (MAS) methods with a total elimination of spinning side band technique (TOSS). Chemical shift analysis of the CP/MAS/TOSS 13C NMR spectra confirmed that the LH1 consists mainly of -helices in the solid state. Time constants of cross polarization (TCH) and relaxation time T1 in a rotating frame (T1H) were determined from the experiments at various contact times. Smaller values of TCH were obtained for the carbons attached directly with protons in a rigid state. Relaxation times T1H revealed the dynamic structure of the complex and showed that bacteriochlorophyll a in the LH1 has high internal mobility even in the solid state. The proton spin-lattice relaxation time in a laboratory frame (T1H) determined by the 13C NMR signal amplitude changes suggested that protons in the LH1 proteins have such strong interaction among them that the spins of all protons in the protein can diffuse through spin-lattice-relaxation.     

Hydrogen Bonding Geometry of a Protein-bound Carbohydrate from Water Exchange-mediated Cross-relaxation

We present heteronuclear two-dimensional methods for the analysis of the geometry of exchangeable protons on a protein-bound carbohydrate. By using a water-selective NOESY-HSQC, we observed cross-relaxation between carbohydrate hydroxyl protons and non-exchangeable ring protons in the complex of [13C6]--methyl-D-mannopyranoside with recombinant rat mannose binding protein. Using a simple kinetic model, we were able to explain the differences in the initial slopes of the resulting cross-relaxation buildup curves in terms of the geometry of the hydroxyl protons in the bound state. The hydroxyl rotamers consistent with our cross-relaxation data fit very well with predictions based on the crystal structure of MBP bound to a mannose-rich oligosaccharide. These methods should be applicable to other systems where both ligand exchange and water exchange are fast relative to the rate of cross-relaxation.     

Conformational analysis of a Chlamydia-specific disaccharide α-Kdo-(2→8)-α-Kdo-(2→O)-allyl in aqueous solution and bound to a monoclonal antibody: Observation of intermolecular transfer NOEs

The disaccharide -Kdo-(28)--Kdo (Kdo: 3-deoxy-d-manno-oct-2-ulosonic acid) represents a genus-specific epitope of the lipopolysaccharide of the obligate intracellular human pathogen Chlamydia. The conformation of the synthetically derived disaccharide -Kdo-(28)--Kdo-(2O)-allyl was studied in aqueous solution, and complexed to a monoclonal antibody S25-2. Various NMR experiments based on the detection of NOEs (or transfer NOEs) and ROEs (or transfer ROEs) were performed. A major problem was the extensive overlap of almost all ¹H NMR signals of -Kdo-(28)--Kdo-(2O)-allyl. To overcome this difficulty, HMQC-NOESY and HMQC-trNOESY experiments were employed. Spin diffusion effects were identified using trROESY experiments, QUIET-trNOESY experiments and MINSY experiments. It was found that protein protons contribute to the observed spin diffusion effects. At 800 MHz, intermolecular trNOEs were observed between ligand protons and aromatic protons in the antibody binding site. From NMR experiments and Metropolis Monte Carlo simulations, it was concluded that -Kdo-(28)--Kdo-(2O)-allyl in aqueous solution exists as a complex conformational mixture. Upon binding to the monoclonal antibody S25-2, only a limited range of conformations is available to -Kdo-(28)--Kdo-(2O)-allyl. These possible bound conformations were derived from a distance geometry analysis using transfer NOEs as experimental constraints. It is clear that a conformation is selected which lies within a part of the conformational space that is highly populated in solution. This conformational space also includes the conformation found in the crystal structure. Our results provide a basis for modeling studies of the antibody–disaccharide complex.     

The solution conformation of sialyl-α(2→6)-lactose studied by modern NMR techniques and Monte Carlo simulations

Summary We present a comprehensive strategy for detailed characterization of the solution conformations of oligosaccharides by NMR spectroscopy and force-field calculations. Our experimental strategy generates a number of interglycosidic spatial constraints that is sufficiently large to allow us to determine glycosidic linkage conformations with a precision heretofore unachievable. In addition to the commonly used {¹H,¹H} NOE contacts between aliphatic protons, our constraints are: (a) homonuclear NOEs of hydroxyl protons in H₂O to other protons in the oligosaccharide, (b) heteronuclear {¹H,¹³C} NOEs, (c) isotope effects of O¹H/O²H hydroxyl groups on¹³C chemical shifts, and (d) long-range heteronuclear scalar coupling across glycosidic bonds.We have used this approach to study the trisaccharide sialyl-(26)-lactose in aqueous solution. The experimentally determined geometrical constraints were compared to results obtained from force-field calculations based on Metropolis Monte Carlo simulations. The molecule was found to exist in 2 families of conformers. The preferred conformations of the (26)-linkage of the trisaccharide are best described by an equilibrium of 2 conformers with angles at –60° or 180° and of the 3 staggered rotamers of the angle with a predominantgt conformer. Three intramolecular hydrogen bonds, involving the hydroxyl protons on C8 and C7 of the sialic acid residue and on C3 of the reducing-end glucose residue, contribute significantly to the conformational stability of the trisaccharide in aqueous solution. Supplementary material available from the corresponding author: Table containing values for the dihedral angles , , , , and for bond angles , for the six lowest-energy conformations of sialyl-(26)-lactose (1 page).     

Selectively 13C-enriched DNA: 13C and 1H assignments of a triple helix by two-dimensional relayed HMQC experiments

Summary We present NMR studies of an intramolecular triple helix, the three strands of which have been linked by a hexaethylene glycol chain. To overcome the generally encountered difficulties of assignment in the homopyrimidine strands, the carbon C1 of the pyrimidines were selectively ¹³C-enriched. Assignments of the aromatic and sugar protons were obtained from NOESY-HMQC and TOCSY-HMQC spectra. We show that the recognition of a DNA duplex by a third strand via triplex formation is easily carried out in solution by observing the changes of the ¹H1–¹³C1 connectivities as a function of pH. Furthermore, the conformation of the sugars has been found to be C2-endo, on the basis of the coupling constant values directly measured in an HSQC spectrum.     

Sequential backbone assignment of isotopically enriched proteins in D2O by deuterium-decoupled HA(CA)N and HA(CACO)N

Summary It is demonstrated that sequential resonance assignment of the backbone ¹H and ¹⁵N resonances of proteins can be obtained without recourse to the backbone amide protons, an approach which should be useful for assignment of regions with rapidly exchanging backbone amide protons and for proteins rich in proline residues. The method relies on the combined use of two 2D experiments, HA(CA)N and HA(CACO)N or their 3D analogs, which correlate ¹H with the intraresidue ¹⁵N and with the ¹⁵N resonance of the next residue. The experiments are preferably conducted in D₂O, where very high resolution in the ¹⁵N dimension can be achieved by using ²H decoupling. The approach is demonstrated for a sample of human ubiquitin, uniformly enriched in ¹³C and ¹⁵N. Complete backbone and ¹³C/¹H resonance assignments are presented.     

OR3 operator of bacteriophage λ in a 23 base-pair DNA fragment: Sequence-specific 1H NMR assignments for the non-labile protons and comparison with the isolated 17 base-pair operator

Sequence-specific ¹H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the O_R3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY 2-dimensional correlated spectroscopy - NOESY 2-dimensional nuclear-Overhauser-enhancement spectroscopy - RELAYED-COSY 2-dimensional relayed coherence transfer spectroscopy - 2Q two-quantum - ppm parts per million - 23-bp DNA d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT) - 17-bp DNA (O_R3) d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA) - d_i(X;Y) intra-residue distance between protons X and Y - d_s(X;Y) sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3     

The influence of anions and inhibitors on the catalytic metal ion in Co(II)-substituted horse liver alcohol dehydrogenase

¹H-NMR and electronic spectroscopic data are reported for the interaction of the effector molecule imidazole and the inhibitor molecule pyrazole with horse liver alcohol dehydrogenase whose catalytic zinc ions were replaced by Co(II). In addition ¹³C-NMR and optical data are given for the binding of acetate to this enzyme species. For the binary complex with imidazole an assignment of the protons of the metal-coordinated imidazole has been made and it was found that the rate of exchange of the effector molecule is slow on the NMR time scale. In the presence of NADH which is bound to the open conformation of the binary complex, the most pronounced change is a shift of the -CH₂ protons of the metal-coordinated cysteine residues which is attributed to hydrogen bonding interactions between the carboxamide group of the nicotinamide moiety with cysteine 46. The ¹H-NMR spectra of the binary complex of Co(II)-HLADH with pyrazole show resonances assigned to the protons in the 3-and 4-positions of the bound inhibitor, the NH proton resonance is not detectable. In the ternary complex with pyrazole and NAD⁺ only the resonances of the -CH₂ protons (beyond 150 ppm) are changed whereas the protons of histidine 67 and the bound inhibitor are unchanged. The data demonstrate that the coordination environment of the catalytic metal ion is changed very little when the protein changes from the open to the closed conformation. The only changes observed are the -CH₂ proton resonances of the metal-coordinating cysteines which are sensitive to local conformational changes within the ternary complex Co(II)-HLADH · Imidazole · NADH in the open conformation or global changes in the ternary complex Co(II)-HLADH · Pyrazole · NAD⁺ in the closed conformation. Acetate which can be regarded as a substrate model was shown to induce a similar change in the optical spectra of the Co(II) enzyme as all other anions observed so far. From the optical changes a dissociation constant of acetate at the catalytic metal site of 200±50 mM was calculated and from the changes of the ¹³C-NMR linewidth of ¹³C acetate direct bonding of the anion to the catalytic Co(II) ion can be demonstrated to occur under the conditions of rapid exchange. The implications of these data for the assessment of tetracoordination around the catalytic metal ion as well as the chemical nature of intermediates occurring along the catalytic pathway are discussed.This work has been performed with contribution of the project Projetto Strategico Biotechnologie CNR and with financial support from the Deutsche Forschungsgemeinschaft, NATO, Bundesminister für Forschung und Technologie, and the Universität des Saarlandes     

Chemical shift as a probe of molecular interfaces: NMR studies of DNA binding by the three amino-terminal zinc finger domains from transcription factor IIIA

We report the NMR resonance assignments for a macromolecular protein/DNA complex containing the three amino-terminal zinc fingers (92 amino acid residues) of Xenopus laevis TFIIIA (termed zf1-3) bound to the physiological DNA target (15 base pairs), and for the free DNA. Comparisons are made of the chemical shifts of protein backbone¹ H^N, ¹⁵N,¹³ C and¹³ C and DNA base and sugar protons of the free and bound species. Chemical shift changes are analyzed in the context of the structures of the zf1-3/DNA complex to assess the utility of chemical shift change as a probe of molecular interfaces. Chemical shift perturbations that occur upon binding in the zf1-3/DNA complex do not correspond directly to the structural interface, but rather arise from a number of direct and indirect structural and dynamic effects.     

Unambiguous NOE assignments in proteins by a combination of through-bond and through-space correlations

Heteronuclear editing has found widespread use in the detection ofproton–proton dipolar interactions in isotopically labelled proteins.However, in cases where both the resonances of protons and directly bound¹³C or ¹⁵N spins of two or more sites aredegenerate, unambiguous assignments are difficult to obtain by conventionalmethods. Here, we present simple extensions of well-known triple-resonancepulse sequences which improve the dispersion of NOESY spectra. In order torecord the chemical shifts of backbone nuclei which allow a resolution ofoverlapping cross peaks, the magnetization is relayed via the scalarcoupling network either before or after the NOE mixing period. The novelpulse sequences are applied to flavodoxin from the sulfate-reducing organismDesulfovibrio vulgaris. A number of previously unassigned NOE interactionsinvolving -, - and amide protons can be unequivocallyidentified, suggesting that the accuracy of protein structure determinationcan be improved.     

Measurement of inter-glycosidic 13C-1H coupling constants in a cyclic β(1→2)-glucan by 13C-filtered 2D {1H,1H}ROESY

Summary A method for measuring three-bond ¹³C-¹H scalar coupling constants across glycosidic bonds in a cyclic (12)-glucan icosamer is presented. This oligosaccharide molecule, with its high degree of symmetry, represents a particular challenge for NMR spectroscopy to distinguish inter-residue from intra-residue heteronuclear coupling effects. Chemically equivalent H2 protons in adjacent glucosyl residues are distinguished on the basis of their different through-space, dipolar interactions with the anomeric protons (H1). The strong NOE contact between anomeric (H1) and aglyconic (H2) protons permits the selective observation of the inter-residue heteronuclear couplings ³J_C1H2 and ³J_C2H1 in a natural-abundance ¹³C-₁-half-filtered {¹H,¹H} ROESY experiment.Abbreviations COSY scalar correlated spectroscopy - NOE nuclear Overhauser effect - NOESY NOE spectroscopy - ROESY rotating-frame NOE spectroscopy     

Measurement of intrinsic exchange rates of amide protons in a 15N-labeled peptide

Summary We have used a modified version of a previously proposed technique, MEXICO [Gemmecker et al. (1993) J. Am. Chem. Soc., 115, 11620], and improved data analysis procedures in order to measure rapid hydrogen exchange (HX) rates of amide protons in peptides labeled only with ¹⁵N. The requirement of ¹³C-/¹⁵N-labeled material has been circumvented by adjusting conditions so that NOE effects associated with amide protons can be neglected (i.e., _0c~1). The technique was applied to an unstructured ¹⁵N-labeled 12-residue peptide to measure intrinsic HX rates, which are the essential reference for examining protein and peptide structure and dynamics through deceleration of HX rates. The method provided accurate HX rates from 0.5 to 50 s^-1 under the conditions used. The measured rates were in good agreement with those predicted using correction factors determined by Englander and co-workers [Bai et al. (1993) Proteins, 17, 75], with the largest deviations from the predicted rates found for residues close to the N-terminus. The exchange rates were found to exhibit significant sensitivity to the concentration of salt in the sample.     

Equilibrium amide hydrogen exchange and protein folding kinetics

The classical Linderstrøm-Lang hydrogen exchange (HX) model is extended to describe the relationship between the HX behaviors (EX1 and EX2) and protein folding kinetics for the amide protons that can only exchange by global unfolding in a three-state system including native (N), intermediate (I), and unfolded (U) states. For these slowly exchanging amide protons, it is shown that the existence of an intermediate (I) has no effect on the HX behavior in an off-pathway three-state system (IUN). On the other hand, in an on-pathway three-state system (UIN), the existence of a stable folding intermediate has profound effect on the HX behavior. It is shown that fast refolding from the unfolded state to the stable intermediate state alone does not guarantee EX2 behavior. The rate of refolding from the intermediate state to the native state also plays a crucial role in determining whether EX1 or EX2 behavior should occur. This is mainly due to the fact that only amide protons in the native state are observed in the hydrogen exchange experiment. These new concepts suggest that caution needs to be taken if one tries to derive the kinetic events of protein folding from equilibrium hydrogen exchange experiments.     

Identification and localization of bound internal water in the solution structure of interleukin 1 beta by heteronuclear three-dimensional 1H rotating-frame Overhauser 15N-1H multiple quantum coherence NMR spectroscopy

The presence and location of bound internal water molecules in the solution structure of interleukin 1 beta have been investigated by means of three-dimensional 1H rotating-frame Overhauser 1H-15N multiple quantum coherence spectroscopy (ROESY-HMQC). In this experiment through-space rotating-frame Overhauser (ROE) interactions between NH protons and bound water separated by less than or equal to 3.5 A are clearly distinguished from chemical exchange effects, as the cross-peaks for these two processes are of opposite sign. The identification of ROEs between NH protons and water is rendered simple by spreading out the spectrum into a third dimension according to the 15N chemical shift of the directly bonded nitrogen atoms. By this means, the problems that prevent, in all but a very few limited cases, the interpretation, identification, and assignment of ROE peaks between NH protons and water in a 2D 1H-1H ROESY spectrum of a large protein such as interleukin 1 beta, namely, extensive NH chemical shift degeneracy and ROE peaks obscured by much stronger chemical exchange peaks, are completely circumvented. We demonstrate the existence of 15 NH protons that are close to bound water molecules. From an examination of the crystal structure of interleukin 1 beta [Finzel, B. C., Clancy, L. L., Holland, D. R., Muchmore, S. W., Watenpaugh, K. D., & Einspahr, H. M. (1989) J. Mol. Biol. 209, 779-791], the results can be attributed to 11 water molecules that are involved in interactions bridging hydrogen-bonding interactions with backbone amide and carbonyl groups which stabilize the 3-fold pseudosymmetric topology of interleukin 1 beta and thus constitute an integral part of the protein structure in solution.     

ATP formation onset lag and post-illumination phosphorylation initiated with single-turnover flashes. II. Two modes of post-illumination phosphorylation driven by either delocalized or localized proton gradient coupling

Two modes of chloroplast membrane post-illumination phosphorylation were detected, using the luciferin-luciferase ATP assay, one of which was not influenced by added permeable buffer (pyridine). That finding provides a powerful new tool for studying proton-membrane interactions during energy coupling. When ADP and P_i were added to the thylakoid suspension after a train of flashes [similar to the traditional post-illumination phosphorylation protocol (termed PIP^– here)], the post-illumination ATP yield was influenced by pyridine as expected, in a manner consistent with the ATP formation, in part, being driven by protons present in the bulk inner aqueous phase, i.e., through a delocalized protonmotive force. However, when ADP and P_i were present during the flash train (referred to as PIP⁺), and ATP formation occurred during the flash train, the post-illumination ATP yield was unaffected by the presence of pyridine, consistent with the hypothesis that localized proton gradients were driving ATP formation. To test this hypothesis further, the pH and flash number dependence of the PIP^– and PIP⁺ ATP yields were measured, the results being consistent with the above hypothesis of dual compartment origins of protons driving post-illumination ATP formation.Measuring proton accumulation during the attainment of the threshold energization level when no component was allowed to form (+ valinomycin, K⁺), and testing for pyridine effects on the proton uptake, reveals that the onset of ATP formation requires the accumulation of about 60 nmol H⁺ (mg Chl)^–1. Between that level and about 110–150 nmol H⁺ (mg Chl)^–1, the accumulation appears to be absorbed by localized-domain membrane buffering groups, the protons of which do not equilibrate readily with the inner aqueous (lumen) phase. Post-illumination phosphorylation driven by the dissipation of the domain protons was not affected by pyridine (present in the lumen), even though the effective pH in the domains must have been well into the buffering range of the pyridine. That finding provides additional insight into the localized domains, namely that protons can be absorbed by endogenous low pK buffering groups, and released at a low enough pH (5.7 when the external pH was 8, 4.7 at pH 7 external) to drive significant ATP formation when no further proton production occurs due to the redox turnovers. We propose that proton accumulation beyond the 110–150 nmol (mg Chl)^–1 level spills over into the lumen, interacting with additional, lumenal endogenous buffering groups and with pyridine, and subsequent efflux of those lumenal protons can also drive ATP formation. Such a dual-compartment thylakoid model for the accumulation of protons competent to drive ATP formation would require a gating mechanism to switch the proton flux from the localized pathway into the lumen, as discussed by R. A. Dilley, S. M. Theg, and W. A. Beard (1987)Annu. Rev. Plant Physiol. 38, 348–389, and recently suggested by R. D. Horner and E. N. Moudrianakis (1986)J. Biol. Chem. 261, 13408–13414. The model can explain conflicting data from past work showing either localized or delocalized gradient coupling patterns.     

Optimized labeling of 13CHD2 methyl isotopomers in perdeuterated proteins: Potential advantages for 13C relaxation studies of methyl dynamics of larger proteins

¹³CHD₂ methyl isotopomers are particularly useful to study methyl dynamics in proteins because, as compared with other methyl isotopomers, the ¹³C relaxation mechanism for this isotopomer is straightforward. However, in the case of proteins, where ()² 1, the refocused INEPT pulse sequence does not completely suppress unwanted ¹³CH₃ signals. The presence of weak ¹³CH₃ peaks is usually not a serious problem for smaller proteins because there are relatively few methyl signals and they are sharp; however, signal overlap becomes more common as the size of the protein increases. We overcome this problem by preparing a protein using a 98% D₂O cell culture medium containing 3-¹³C pyruvic acid, 50–60% deuterated at the 3-position, and 4-¹³C 2-ketobutyric acid, 98% and 62% deuterated at the 3- and 4-positions, respectively. This approach significantly reduces the population of the CH₃ isotopomer while optimizing the production of ¹³CHD₂, the isotopomer desired for ¹³C relaxation measurements. In larger proteins where the deuterium T₂ may be too short to measure accurately, we also suggest the alternative measurement of the proton T₂ of the ¹³CH₂D methyl isotopomer, because these protons are well-isolated from other protons in these highly deuterated samples.     

A 3D NOESY-(HCACO)NH experiment for the measurement of NOEs involving 1Hα in 13C-/15N-labeled proteins dissolved in H2O

Summary A 3D NOESY-(HCACO)NH experiment is described that transfers NOEs from ¹H to the backbone ¹H^N in the succeeding residue for detection. Using this strategy, NOEs involving ¹H protons that resonate exactly at the water frequency can be detected. NOEs from an overlapping ¹H proton that is attached to degenerate ¹³C can also be resolved. The performance of this approach is demonstrated for the ¹³C-/¹⁵N-labeled Hck/SH2 dissolved in H₂O.     

Prediction of proton chemical shifts in RNA – Their use in structure refinement and validation

An analysis is presented of experimental versus calculated chemical shifts of the non-exchangeable protons for 28 RNA structures deposited in the Protein Data Bank, covering a wide range of structural building blocks. We have used existing models for ring-current and magnetic-anisotropy contributions to calculate the proton chemical shifts from the structures. Two different parameter sets were tried: (i) parameters derived by Ribas-Prado and Giessner-Prettre (GP set) [(1981) J. Mol. Struct., 76, 81–92.]; (ii) parameters derived by Case [(1995) J. Biomol. NMR, 6, 341–346]. Both sets lead to similar results. The detailed analysis was carried using the GP set. The root-mean-square-deviation between the predicted and observed chemical shifts of the complete database is 0.16 ppm with a Pearson correlation coefficient of 0.79. For protons in the usually well-defined A-helix environment these numbers are, 0.08 ppm and 0.96, respectively. As a result of this good correspondence, a reliable analysis could be made of the structural dependencies of the ¹H chemical shifts revealing their physical origin. For example, a down-field shift of either H2 or H3 or both indicates a high-syn/syn -angle. In an A-helix it is essentially the 5-neighbor that affects the chemical shifts of H5, H6 and H8 protons. The H5, H6 and H8 resonances can therefore be assigned in an A-helix on the basis of their observed chemical shifts. In general, the chemical shifts were found to be quite sensitive to structural changes. We therefore propose that a comparison between calculated and observed ¹H chemical shifts is a good tool for validation and refinement of structures derived from NOEs and J-couplings.     

Novel 2D and 3D multiple-quantum bi-directional HCNCH experiments for the correlation of ribose and base protons/carbons in 13C/15N labeled RNA

Multiple-quantum 2D and 3D bi-directional HCNCH experiments are presented for the correlation of base and ribose protons/carbons in ¹³C/¹⁵N labeled HIV-1 TAR RNA. In both 2D and 3D experiments, the magnetization of H1 is transferred to H6/H8 and H1 through H1-C1-N1/9-C6/8-H6/8 and H1-C1-N1/9-C1-H1 pathways, and the magnetization of H6/8 is transferred to H1 and H6/8 through H6/8-C6/8-N1/9-C1-H1 and H6/8-C6/8-N1/9-C6/8-H6/8 pathways. Chemical shifts of four different nuclei (H1, C1, C6/8 and H6/8) are sampled in the 2D experiment. The correlation of base and ribose protons/carbons is established by the rectangular arrangement of crossover and out-and-back peaks in the proton/carbon correlated spectrum. The rectangular connections can be further resolved using the nitrogen dimension in a ¹H/¹³C/¹⁵N 3D experiment. Furthermore, by taking advantage of the well separated chemical shifts of N1 (pyrimidine) and N9 (purine), the 2D spectrum can be simplified into two sub-spectra based on their base type. Both experiments were tested on a ¹³C/¹⁵N labeled 27-mer HIV-1 TAR RNA containing a UUCG hairpin loop.