Trimerization and triple helix stabilization of the collagen XIX NC2 domain

The mechanisms of chain selection and assembly of fibril-associated collagens with interrupted triple helices (FACITs) must differ from that of fibrillar collagens, since they lack the characteristic C-propeptide. We analyzed two carboxyl-terminal noncollagenous domains, NC2 and NC1, of collagen XIX as potential trimerization units and found that NC2 forms a stable trimer and substantially stabilizes a collagen triple helix attached to either end. In contrast, the NC1 domain requires formation of an adjacent collagen triple helix to form interchain disulfide bridges. The NC2 domain of collagen XIX and probably of other FACITs is responsible for chain selection and trimerization.     

Glycosylation/Hydroxylation-induced stabilization of the collagen triple helix. 4-trans-hydroxyproline in the Xaa position can stabilize the triple helix

We have shown recently that glycosylation of threonine in the peptide Ac-(Gly-Pro-Thr)(10)-NH(2) with beta-d-galactose induces the formation of a collagen triple helix, whereas the nonglycosylated peptide does not. In this report, we present evidence that a collagen triple helix can also be formed in the Ac-(Gly-Pro-Thr)(10)-NH(2) peptide, if the proline (Pro) in the Xaa position is replaced with 4-trans-hydroxyproline (Hyp). Furthermore, replacement of Pro with Hyp in the sequence Ac-(Gly-Pro-Thr(beta-d-Gal))(10)-NH(2) increases the T(m) of the triple helix by 15.7 degrees C. It is generally believed that Hyp in the Xaa position destabilizes the triple helix because (Pro-Pro-Gly)(10) and (Pro-Hyp-Gly)(10) form stable triple helices but the peptide (Hyp-Pro-Gly)(10) does not. Our data suggest that the destabilizing effect of Hyp relative to Pro in the Xaa position is only true in the case of (Hyp-Pro-Gly)(10). Increasing concentrations of galactose in the solvent stabilize the triple helix of Ac-(Gly-Hyp-Thr)(10)-NH(2) but to a much lesser extent than that achieved by covalently linked galactose. The data explain some of the forces governing the stability of the annelid/vestimentiferan cuticle collagens.     

DNA triple helix stabilization by aminoglycoside antibiotics

The stabilization of the poly(dA) x 2poly(dT) triple helix by neomycin is reported. Preliminary results indicate that neomycin stabilizes DNA triple helices and the double helical structures composed of poly(dA) x poly(dT) are virtually unaffected. This is the first report of the interaction of aminoglycoside antibiotics with DNA triple helices.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Probability of internal unwinding in the triple helix of collagen

Helix probability profiles are calculated for collagen models that take into account specific sequence and unwinding from the ends, by internal loops and by chain dissociation, using parameters from a previous study and the technique of the previous paper.² An analysis is made of the occurrence of imino acids in known collagen sequences and no significant difference is found from random occurrence. Studies of model sequences generated by random placement of the imino acids show no tendency for collagen to unwind via internal loops even when one end is covalently linked and a loop is permanently nucleated at that end.     

Hydration dynamics of the collagen triple helix by NMR

The hydration of the collagen-like Ac-(Gly-Pro-Hyp)(6)-NH(2) triple-helical peptide in solution was investigated using an integrated set of high-resolution NMR hydration experiments, including different recently developed exchange-network editing methods. This approach was designed to explore the hydration dynamics in the proximity of labile groups, such as the hydroxyproline hydroxyl group, and revealed that the first shell of hydration in collagen-like triple helices is kinetically labile with upper limits for water molecule residence times in the nanosecond to sub-nanosecond range. This result is consistent with a "hopping" hydration model in which solvent molecules are exchanged in and out of solvation sites at a rate that is not directly correlated to the degree of site localization. The hopping model thus reconciles the dynamic view of hydration revealed by NMR with the previously suggested partially ordered semi-clathrate-like cylinder of hydration. In addition, the nanosecond to sub-nanosecond upper limits for water molecule residence times imply that hydration-dehydration events are not likely to be the rate-limiting step for triple helix self-recognition, complementing previous investigations on water dynamics in collagen fibers. This study has also revealed labile proton features expected to facilitate the characterization of the structure and folding of triple helices in collagen peptides.     

Hydroxyproline stabilizes the triple helix of chick tendon collagen

The thermal stability of unhydroxylated procollagen relative to hydroxylated procollagen was investigated using pepsin digestion at various temperatures in the interval 15° to 35° as an enzymatic probe of conformation. The results demonstrate that the unhydroxylated molecules thermally denature between 20° and 25°, while the hydroxylated molecules are stable at least to 35°. This finding suggests that the presence of hydroxyproline in the molecule contributes significantly to the thermal stability of collagen. The results also suggest that triple strand formation may be required for normal secretion.     

Conformational effects of Gly-X-Gly interruptions in the collagen triple helix

The collagen model peptide with sequence (Pro-Hyp-Gly)4-Pro-Gly-(Pro-Hyp-Gly)5 contains a central Gly-Pro-Gly interruption in the consensus collagen sequence. Its high-resolution crystal structure defines the molecular consequences of such an interruption for the collagen triple-helical conformation, and provides insight into possible structural and biological roles of similar interruptions in the -Gly-X-Y- repeating pattern found in non-fibrillar collagens. The peptide (denoted as the Hyp minus peptide or Hyp-) forms a rod-like triple helix structure without any bend or kink, and crystallizes in a quasi-hexagonal lattice. The two Pro-Hyp-Gly zones adopt the typical triple-helical collagen conformation with standard Rich and Crick II hydrogen bonding topology. Notably, the central zone containing the Gly-Pro-Gly interruption deviates from the standard structure in terms of hydrogen bonding topology, torsion angles, helical, and superhelical parameters. These deviations are highly localized, such that the standard features are regained within one to two residues on either side. Conformational variations and high temperature factors seen for the six chains of the asymmetric unit in the zone around the interruption point to the presence of a local region of considerable plasticity and flexibility embedded within two highly rigid and ordered standard triple-helical segments. The structure suggests a role for Gly-X-Gly interruptions as defining regions of flexibility and molecular recognition in the otherwise relatively uniform repeating collagen conformation.     

Collagen helix stabilization by hydroxyproline in (Ala-Hyp-Gly)n.

(Ala-Hyp-Gly)_n was synthesized and fractionated to yield three fractions in the molecular weight range 10,000 to 2,500. Optical rotatory and circular dichroism measurements indicated the collagen-like properties of this polymer in contrast to those reported for (Ala-Pro-Gly)_n. We conclude that hydroxyproline contributes to collagen-helix stability in general, independent of the presence of an adjacent proline residue as in previously studied synthetic polypeptides. (Pro-Hyp-Gly)_n showed identical circular dichroism spectra whether polymerized via the nitrophenyl ester or tetraethylpyrophosphite.     

Sequence specific thermal stability of the collagen triple helix

Theoretical calculations of the thermal stability of collagen triple helices using empirical values for the contribution of individual tripeptide units are presented and compared with direct measurements of the thermal stability of various types of collagens. Relative stabilities are assigned to the positions of the tripeptide units in the amino acid sequence along the length of the collagen molecule. The sequence specific relative stabilities of type I and type XI collagens are compared. These offer insight into the reasons for the existence of unfolding intermediates in type XI collagen that are absent in type I collagen. The pattern of relative stabilities calculated for mouse type IV collagen is consistent with experimental results which indicate that the amino terminal region is very stable and that the interruptions cause increased flexibility and independently unfolding domains. Mutations in the triple helical domain of human type I procollagen occurring in brittle bone disease (osteogenesis imperfecta) show varying effects on the thermal stability of the molecule. The sequence specific thermal stability calculations shed some light on why some mutations of cysteine for glycine have greater effects on the thermal stability than others.     

Conformational preferences of substituted prolines in the collagen triple helix

Researchers have recently questioned the role hydroxylated prolines play in stabilizing the collagen triple helix. To address these issues, we have developed new molecular mechanics parameters for the simulation of peptides containing 4(R)-fluoroproline (Flp), 4(R)-hydroxyproline (Hyp), and 4(R)-aminoproline (Amp). Simulations of peptides based on these parameters can be used to determine the components that stabilize hydroxyproline over proline in the triple helix. The dihedrals F-C-C-N, O-C-C-N, and N-C-C-N were built using a N-beta-ethyl amide model. One nanosecond simulations were performed on the trimers [(Pro-Pro-Gly)(10)](3), [(Pro-Hyp-Gly)(10)](3), [(Pro-Amp-Gly)(10)](3), [(Pro-Amp(1+)-Gly)(10)](3), and [(Pro-Flp-Gly)(10)](3) in explicit solvent. The results of our simulations suggest that pyrrolidine ring conformation is mediated by the strength of the gauche effect and classical electrostatic interactions.     

Mechanics and structural stability of the collagen triple helix

1. Download : Download high-res image (222KB)
2. Download : Download full-size image

     

Interstrand dipole-dipole interactions can stabilize the collagen triple helix

The amino acid sequence of collagen is composed of GlyXaaYaa repeats. A prevailing paradigm maintains that stable collagen triple helices form when (2S)-proline (Pro) or Pro derivatives that prefer the C(γ)-endo ring pucker are in the Xaa position and Pro derivatives that prefer the C(γ)-exo ring pucker are in the Yaa position. Anomalously, an amino acid sequence in an invertebrate collagen has (2S,4R)-4-hydroxyproline (Hyp), a C(γ)-exo-puckered Pro derivative, in the Xaa position. In certain contexts, triple helices with Hyp in the Xaa position are now known to be hyperstable. Most intriguingly, the sequence (GlyHypHyp)(n) forms a more stable triple helix than does the sequence (GlyProHyp)(n). Competing theories exist for the physicochemical basis of the hyperstability of (GlyHypHyp)(n) triple helices. By synthesizing and analyzing triple helices with different C(γ)-exo-puckered proline derivatives in the Xaa and Yaa positions, we conclude that interstrand dipole-dipole interactions are the primary determinant of their additional stability. These findings provide a new framework for understanding collagen stability.     

Glutaraldehyde-induced states of stress of the collagen triple helix.

Demonstration of a decrease in pitch of some turns of the collagen triple helix caused by glutaraldehyde as shown in the stress and low-angle X-ray diagram by use of synchrotron radiation.     

Pyrimidine morpholino oligonucleotides form a stable triple helix in the absence of magnesium ions

Oligonucleotides can be used as sequence-specific DNA ligands by forming a local triple helix. In order to form more stable triple-helical structures or prevent their degradation in cells, oligonucleotide analogues that are modified at either the backbone or base level are routinely used. Morpholino oligonucleotides appeared recently as a promising modification for antisense applications. We report here a study that indicates the possibility of a triple helix formation with a morpholino pyrimidine TFO and its comparison with a phosphodiester and a phosphoramidate oligonucleotide. At a neutral pH and in the presence of a high magnesium ion concentration (10 mM), the phosphoramidate oligomer forms the most stable triple helix, whereas in the absence of magnesium ion but at a physiological monovalent cation concentration (0.14 M) only morpholino oligonucleotides form a stable triplex. To our knowledge, this is the first report of a stable triple helix in the pyrimidine motif formed by a noncharged oligonucleotide third strand (the morpholino oligonucleotide) and a DNA duplex. We show here that the structure formed with the morpholino oligomer is a bona fide triple helix and it is destabilized by high concentrations of potassium ions or divalent cations (Mg(2+)).     

Complex between triple helix of collagen and double helix of DNA in aqueous solution

We demonstrate in this paper that one example of a biologically important and molecular self-assembling complex system is a collagen–DNA ordered aggregate which spontaneously forms in aqueous solutions. Interaction between the collagen and the DNA leads to destruction of the hydration shell of the triple helix and stabilization of the double helix structure. From a molecular biology point of view this nano-scale self-assembling superstructure could increase the stability of DNA against the nucleases during collagen diseases and the growth of collagen fibrills in the presence of DNA.     

Dissecting a bacterial collagen domain from Streptococcus pyogenes: sequence and length-dependent variations in triple helix stability and folding

To better investigate the relationship between sequence, stability, and folding, the Streptococcus pyogenes collagenous domain CL (Gly-Xaa-Yaa)(79) was divided to create three recombinant triple helix subdomains A, B, and C of almost equal size with distinctive amino acid features: an A domain high in polar residues, a B domain containing the highest concentration of Pro residues, and a very highly charged C domain. Each segment was expressed as a monomer, a linear dimer, and a linear trimer fused with the trimerization domain (V domain) in Escherichia coli. All recombinant proteins studied formed stable triple helical structures, but the stability varied depending on the amino acid sequence in the A, B, and C segments and increased as the triple helix got longer. V-AAA was found to melt at a much lower temperature (31.0 °C) than V-ABC (V-CL), whereas V-BBB melted at almost the same temperature (～36-37 °C). When heat-denatured, the V domain enhanced refolding for all of the constructs; however, the folding rate was affected by their amino acid sequences and became reduced for longer constructs. The folding rates of all the other constructs were lower than that of the natural V-ABC protein. Amino acid substitution mutations at all Pro residues in the C fragment dramatically decreased stability but increased the folding rate. These results indicate that the thermostability of the bacterial collagen is dominated by the most stable domain in the same manner as found with eukaryotic collagens.     

Thermostability gradient in the collagen triple helix reveals its multi-domain structure

A triple-helical conformation and stability at physiological temperature are critical for the mechanical and biological functions of the fibril-forming collagens. Here, we characterized the role of consecutive domains of collagen II in stabilizing the triple helix. Analysis of melting temperatures of genetically engineered collagen-like proteins consisting of tandem repeats of the D1, D2, D3 or D4 collagen II periods revealed the presence of a gradient of thermostability along the collagen molecule with thermolabile N-terminal domains and thermostable C-terminal domains. These results imply a multi-domain character of the collagen triple helix. Assays of thermostabilities of the Arg75Cys and Arg789Cys collagen II mutants suggest that, in contrast to the thermostable domains, the thermolabile domains are able to accommodate amino acid substitutions without altering the thermostability of the entire collagen molecule.