Adsorption kinetics and equilibria of bovine serum albumin on rigid ion-exchange and hydrophobic interaction chromatography matrices in a stirred cell

Rigid adsorbents have advantages over soft gel media for downstream processing of proteins. The adsorption of bovine serum albumin (BSA) has been investigated on a rigid adsorbent based on a wide-pore, hydrophilically coated, silica-gel matrix. The effects of surface chemistry (weak anion exchanger and hydrophobic interaction chromatography) and particle size have been studied on the physical properties of the adsorbent and on the adsorption equilibria and adsorption kinetics. The rates of adsorption of BSA have been measured in a stirred cell and are found to be satisfactorily described by a two-step theoretical model, in which the mass transfer involves a pore diffusion resistance and an extra-particle film resistance. On the anion exchanger, the effective pore diffusivity decreases substantially with increasing protein concentration, approximately halving as the initial concentration rises from 0.7 to 2g/l. In the hydrophobic interaction chromatography medium, the pore diffusivity is less sensitive to protein concentration and is also reduced by a factor of about 4 by aggregation of the protein. Effective pore diffusivities with the "wide-pore" silica adsorbents in anion-exchange form are 36-94 times lower than the diffusivity in free solution and are comparable with the lower of the wide range of values published for soft gels.     

Purification of recombinant aprotinin from transgenic corn germ fraction using ion exchange and hydrophobic interaction chromatography

Plants have attracted interest as hosts for protein expression because of the promise of a large production capacity and a low production cost. However, recovery costs remain a challenge as illustrated for recovery of recombinant aprotinin, a trypsin inhibitor, with removal of native corn trypsin inhibitor from transgenic corn (Azzoni et al. in Biotechnol Bioeng 80:268–276, 2002). When expression is targeted to corn grain fractions, dry milling can separate germ and endosperm fractions. Hence, only the product-containing fraction needs to be extracted, reducing the cost of extraction and the impurity level of the extract. Selective extraction conditions can reduce impurity levels to the point that low-cost adsorbents can result in relatively high purity levels. In this work, we attempted to achieve comparable purity with these lower cost methods. We replaced whole grain extraction and purification of recombinant aprotinin with sequential trypsin affinity and IMAC steps with an alternative of germ fraction extraction and purification with ion exchange and hydrophobic interaction chromatography (HIC). Using germ extraction at acidic pH supplemented with heat precipitation to remove additional host proteins resulted in a higher specific activity feed to the chromatographic steps. The cation exchange step provided 7.6× purification with 76.4% yield and no sodium dodecyl sulfate–polyacrylamide gel electrophoresis detectable native corn trypsin inhibitor. After the HIC step (2.7× step purification with 44.0% yield), the final product had a specific activity that was 75.3% of that of the affinity-purified aprotinin.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Spectroscopic studies on the interaction of riboflavin with bovine serum albumin

The mechanism of interaction of riboflavin (RF) with bovine serum albumin (BSA) using fluorometric and circular dichroism (CD) methods has been reported. The association constant (K) for RF-BSA binding shows that the interaction is non-covalent in nature. Stern-Volmer analysis of fluorescence quenching data shows that the fraction of fluorophore (BSA) accessible to the quencher (RF) is close to unity, indicating that both tryptophan residues of BSA are involved in the interaction. The high magnitude of rate constant for quenching kq (10(13) M(-1) s(-1) indicates that RF binding site is in close proximity to tryptophan residue of BSA. Thermodynamic parameters obtained from data at different temperatures showed that the binding of RF to BSA predominantly involves the formation of hydrophobic bonds. Binding studies in the presence of a hydrophobic probe 8-anilino-1-naphthalene sulphonic acid, sodium salt (ANS) showed that RF and ANS do not share common sites in BSA. The small decrease in critical micellar concentration of anionic surfactant, sodium dodecyl sulphate in the presence of RF shows that ionic character of RF also contributes to binding and is not solubilized inside the micelle. Significant decrease in concentration of free RF has been observed in the presence of paracetamol. The CD spectrum shows the binding of RF leads to a change in the alpha helical structure of BSA.     

Kinetics of formation of hydrophobic regions during refolding of bovine serum albumin

The rate of formation of hydrophobic regions during refolding of bovine serum albumin was studied using 1-anilinonaphthalene-8-sulfonate as the hydrophobic fluorescent probe. The refolding of serum albumin exhibited a sigmoidal behavior. The exhibition of a lag phase followed by a faster kinetic phase suggested that the refolding is a cooperative, sequential process. Refolding under reducing conditions almost completely inhibited the regeneration of hydrophobic binding regions, suggesting that the formation of disulfide bonds plays an important role in the refolding of serum albumin. The rate and the extent of refolding was apparently maximum at about 20 degrees; at 37 degrees the extent of refolding was very low compared to that at the other temperatures studied. Based on the results, the mechanism of albumin refolding is interpreted in terms of domain structures and interdomain interactions.     

Microquantitative determination of Pi-ATP and ADP-ATP exchange kinetics using thin-layer chromatography on silica gel

A new method for determination of 32Pi-ATP and [14C]ADP-ATP exchange rates is described. It is based upon separation of nucleotides and Pi by thin-layer chromatography on commercial aluminum or plastic sheets precoated with silica gel. The method permits avoiding special procedures for stopping of the reaction and for preparation of aliquots for thin-layer chromatography separation. It also allows to separate all adenine nucleotides and Pi in one chromatography procedure, and to work with a double label. The volume of the reaction mixture was 50-100 microliters. Aliquots (2-6 microliters) of the reaction mixture were taken at various moments without stopping the reaction and were layered immediately on a heated silica gel sheets. The nucleotides and Pi were separated in a solvent system which consisted of dioxane, isopropanol, 25% ammonia, and water (4:2:3:4, v/v). The nucleotide spots were detected in ultraviolet light, cut out, and their radioactivity was measured with a liquid scintillation counter. The method for measurement of kinetics of exchange reactions catalyzed by reconstituted into liposomes H+-ATPase complexes from beef heart mitochondria and high plant chloroplasts, is described.     

Binding of lead ion to bovine serum albumin studied by ion selective electrode

The binding of Pb2+ to bovine serum albumin (BSA) at neutral pH was studied using lead ion selective electrode. The binding data was treated according to Scatchard Equation. The number of binding classes and the number of binding sites, intrinsic dissociation constants and stepwise binding constants for each class were determined. Two binding classes were found. Four binding sites in the first class and five binding sites in the second class were determined. Binding in the first class was stronger than in the second. Similar binding studies were carried out with heat treated BSA. It was found that not only the number of binding sites but also the strength of binding increases upon heat treatment.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.     

Determination of the specific interaction between palmatine and bovine serum albumin

The binding of palmatine to bovine serum albumin (BSA) was studied under physiological conditions (pH = 7.40) by molecular spectroscopic approach. It was proved that the fluorescence quenching of BSA by palmatine is a result of the formation of palmatine–BSA complex. Binding parameters were determined using the modified Stern–Volmer equation and Scatchard equation, to measure the specific binding between palmatine and BSA. The thermodynamic parameters calculated, ∆G°, ∆H° and ∆S° indicate that the electrostatic interactions play a major role in the palmatine–BSA association. Site marker competitive displacement experiments demonstrated that palmatine binds with specific affinity to site II (subdomain IIIA) of BSA. Furthermore, the specific binding distance r (3.36 nm) was obtained according to fluorescence resonance energy transfer. The results of synchronous fluorescence spectra and UV–Visible absorption spectra show that the conformation of bovine serum albumin has been changed.     

Spectroscopic studies of interaction between CuO nanoparticles and bovine serum albumin

Recently, the great interests in manufacturing and application of metal oxide nanoparticles in commercial and industrial products have led to focus on the potential impact of these particles on biomacromolecules. In the present study, the interaction of copper oxide (CuO) nanoparticles with bovine serum albumin (BSA) was studied by spectroscopic techniques. The zeta potential value for BSA and CuO nanoparticles with average diameter of around 50 nm at concentration of 10 μM in the deionized (DI) water were ?5.8 and ?22.5 mV, respectively. Circular dichroism studies did not show any changes in the content of secondary structure of the protein after CuO nanoparticles interaction. Fluorescence data revealed that the fluorescence quenching of BSA by CuO nanoparticles was the result of the formed complex of CuO nanoparticles – BSA. Binding constants and other thermodynamic parameters were determined at three different temperatures. The hydrogen bond interactions are the predominant intermolecular forces to stabilize the CuO nanoparticle – BSA complex. This study provides important insight into the interaction of CuO nanoparticles with proteins, which may be of importance for further application of these nanoparticles in biomedical applications.     

Beaded matrices from cross-linked alginate for affinity and ion exchange chromatography of proteins

Summary To obtain a low cost, beaded chromatographic matrix, calcium alginate beads were cross-linked with epichlorohydrin, and calcium was removed by sodium citrate treatment. The cross-linking reaction for obtaining stable beads was optimized. For purification of haemoglobin by ion exchange, cross-linked calcium-free alginate beads have a q_max of 60 mg/ml and a K_d of 0.02 mg/ml gel, while for affinity polygalacturonase purification K_aff was 0.007 ml/g.     

Studies on the interaction between benzophenone and bovine serum albumin by spectroscopic methods

The interaction between benzophenone (BP) and bovine serum albumin (BSA) was investigated by the methods of fluorescence spectroscopy combined with UV–Vis absorption and circular dichroism (CD) measurements under simulative physiological conditions. The experiment results showed that the fluorescence quenching of BSA by BP was resulted from the formation of a BP–BSA complex and the corresponding association constants (K _a) between BP and BSA at four different temperatures had been determined using the modified Stern–Volmer equation. The enthalpy change (ΔH) and entropy change (ΔS) were calculated to be –43.73 kJ mol⁻¹ and −53.05 J mol⁻¹ K⁻¹, respectively, which suggested that hydrogen bond and van der Waals force played major roles in stabilizing the BP–BSA complex. Site marker competitive experiments indicated that the binding of BP to BSA primarily took place in site I (sub-domain IIA). The conformational investigation showed that the presence of BP decreased the α-helical content of BSA and induced the slight unfolding of the polypeptides of protein, which confirmed some micro-environmental and conformational changes of BSA molecules.     

Studies on the interaction between benzidine and bovine serum albumin by spectroscopic methods

The interaction between bovine serum albumin (BSA) and benzidine (BD) in aqueous solution was investigated by fluorescence spectroscopy, circular dichroism (CD) spectra and UV–Vis spectroscopy, as well as resonance light scattering spectroscopy (RLS). It was proved from fluorescence spectra that the fluorescence quenching of BSA by BD was a result of the formation of BD–BSA complex, and the binding constants (K _a) were determined according to the modified Stern–Volmer equation. The enthalpy change (ΔH) and entropy change (ΔS) were calculated to be ?34.11 kJ mol^?1 and ?25.89 J mol^?1 K^?1, respectively, which implied that van der Waals force and hydrogen bond played predominant roles in the binding process. The addition of increasing BD to BSA solution caused the gradual enhancement in RLS intensity, exhibiting the forming of the aggregate. Moreover, the competitive experiments of site markers suggested that the binding site of BD to BSA was located in the region of subdomain IIA (sudlow site I). The distance (r) between the donor (BSA) and the acceptor (BD) was 4.44 nm based on the Förster theory of non–radioactive energy transfer. The results of synchronous fluorescence and CD spectra demonstrated the microenvironment and the secondary conformation of BSA were changed.     

Studies on the interaction between Oxaprozin-E and bovine serum albumin by spectroscopic methods

The interaction between Oxaprozin-E and bovine serum albumin (BSA) was studied by spectroscopic methods including fluorescence and UV–vis absorption spectroscopy. The quenching mechanism of fluorescence of BSA by Oxaprozin-E was discussed to be a dynamic quenching procedure. The number of binding sites n and apparent binding constant K was measured by fluorescence quenching method. The thermodynamics parameter ΔH, ΔG, ΔS were calculated. The results indicate the binding reaction was mainly entropy-driven and hydrophobic forces played major role in the binding reaction. The distance r between donor (BSA) and acceptor (Oxaprozin-E) was obtained according to Förster theory of non-radioactive energy transfer.     

Spectroscopic study of the interaction of gossypol with bovine serum albumin

The interaction of gossypol with bovine serum albumin (BSA) at pH 7.6 in 0.02 M borax-borate buffer has been followed by circular dichroism (CD) and difference spectroscopy. From the extrinsic CD band at 390 nm, a binding constant of 2.7 X 10(3) M-1 was calculated. At 54 degrees the induced CD spectrum was abolished, suggesting that the interaction is not favoured at that temperature. The effect of various solvents and salts on the interaction has been followed by difference spectroscopy. The modification of epsilon-amino groups of lysine did not affect the interaction. Binding of gossypol to BSA does not cause a change in its secondary structure or sedimentation coefficient.     

The effect of microwave thermal denaturation on release properties of bovine serum albumin and gluten matrices

The purpose of this study was to compare the effects of denaturation by microwave irradiation on release properties of 2 physically different proteins. Matrices were prepared from water-soluble bovine serum albumin loaded with metoclopramide and sorbed with adequate amount of moisture were thermally denatured in a microwave oven. The release profile of the rather insoluble denatured albumin matrices followed the classical Fickian diffusion profile. The release rate was dependent on the degree of denaturation, which was highly dependent on the level of moisture originally absorbed by the albuminoidal matrices and the period of exposure to microwave energy. Consersely, attempts to reduce the rate of drug release through microwave irradiation of metoclopramide-loaded matrices prepared from water-insoluble gluten were futile. The denaturation process was shown to be limited to the relatively water-soluble protein core fraction, while aggregation between neighboring gluten proteins in the matrix was not achieved even in the presence of considerable amounts of sorbed water. Published: February 10, 2006