共查询到20条相似文献,搜索用时 78 毫秒
1.
Patti J. Miller Claudio L. Afonso Erica Spackman Melissa A. Scott Janice C. Pedersen Dennis A. Senne Justin D. Brown Chad M. Fuller Marcela M. Uhart William B. Karesh Ian H. Brown Dennis J. Alexander David E. Swayne 《Journal of virology》2010,84(21):11496-11504
The biological, serological, and genomic characterization of a paramyxovirus recently isolated from rockhopper penguins (Eudyptes chrysocome) suggested that this virus represented a new avian paramyxovirus (APMV) group, APMV10. This penguin virus resembled other APMVs by electron microscopy; however, its viral hemagglutination (HA) activity was not inhibited by antisera against any of the nine defined APMV serotypes. In addition, antiserum generated against this penguin virus did not inhibit the HA of representative viruses of the other APMV serotypes. Sequence data produced using random priming methods revealed a genomic structure typical of APMV. Phylogenetic evaluation of coding regions revealed that amino acid sequences of all six proteins were most closely related to APMV2 and APMV8. The calculation of evolutionary distances among proteins and distances at the nucleotide level confirmed that APMV2, APMV8, and the penguin virus all were sufficiently divergent from each other to be considered different serotypes. We propose that this isolate, named APMV10/penguin/Falkland Islands/324/2007, be the prototype virus for APMV10. Because of the known problems associated with serology, such as antiserum cross-reactivity and one-way immunogenicity, in addition to the reliance on the immune response to a single protein, the hemagglutinin-neuraminidase, as the sole base for viral classification, we suggest the need for new classification guidelines that incorporate genome sequence comparisons.Viruses from the Paramyxoviridae family have caused disease in humans and animals for centuries. Over the last 40 years, many paramyxoviruses isolated from animals and people have been newly described (16, 17, 22, 29, 31, 32, 36, 42, 44, 46, 49, 58, 59, 62-64). Viruses from this family are pleomorphic, enveloped, single-stranded, nonsegmented, negative-sense RNA viruses that demonstrate serological cross-reactivity with other paramyxoviruses related to them (30, 46). The subfamily Paramyxovirinae is divided into five genera: Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, and Avulavirus (30). The Avulavirus genus contains nine distinct avian paramyxovirus (APMV) serotypes (Table (Table1),1), and information on the discovery of each has been reported elsewhere (4, 6, 7, 9, 12, 34, 41, 50, 51, 60, 68).
Open in a separate windowaRequires the addition of an exogenous protease.bProtease requirement depends on the isolate examined.cPutative.Six of these serotypes were classified in the latter half of the 1970s, when the most reliable assay available to classify paramyxoviruses was the hemagglutination inhibition (HI) assay (61). However, there are multiple problems associated with the use of serology, including the inability to classify some APMVs by comparing them to the sera of the nine defined APMVs alone (2, 8). In addition, one-way antigenicity and cross-reactivity between different serotypes have been documented for many years (4, 5, 14, 25, 29, 33, 34, 41, 51, 52, 60). The ability of APMVs, like other viruses, to show antigenic drift as it evolves over time (37, 43, 54) and the wide use and availability of precise molecular methods, such as PCR and genome sequencing, demonstrate the need for a more practical classification system.The genetic diversity of APMVs is still largely unexplored, as hundreds of avian species have never been surveyed for the presence of viruses that do not cause significant signs of disease or are not economically important. The emergence of H5N1 highly pathogenic avian influenza (HPAI) virus as the cause of the largest outbreak of a virulent virus in poultry in the past 100 years has spurred the development of surveillance programs to better understand the ecology of avian influenza (AI) viruses in aquatic birds around the globe, and in some instances it has provided opportunities for observing other viruses in wild bird populations (15, 53). In 2007, as part of a seabird health surveillance program in the Falkland Islands (Islas Malvinas), oral and cloacal swabs and serum were collected from rockhopper penguins (Eudyptes chrysocome) and environmental/fecal swab pools were collected from other seabirds.While AI virus has not yet been isolated from penguins in the sub-Antarctic and Antarctic areas, there have been two reports of serum antibodies positive to H7 and H10 from the Adélie species (11, 40). Rare isolations of APMV1, both virulent (45) and of low virulence (8), have been reported from Antarctic penguins. Sera positive for APMV1 and AMPV2 have also been reported (21, 24, 38, 40, 53). Since 1981, paramyxoviruses have been isolated from king penguins (Aptenodytes patagonicus), royal penguins (Eudyptes schlegeli), and Adélie penguins (Pygoscelis adeliae) from Antarctica and little blue penguins (Eudyptula minor) from Australia that cannot be identified as belonging to APMV1 to -9 and have not yet been classified (8, 11, 38-40). The morphology, biological and genomic characteristics, and antigenic relatedness of an APMV recently isolated from multiple penguin colonies on the Falkland Islands are reported here. Evidence that the virus belongs to a new serotype (APMV10) and a demonstration of the advantages of a whole genome system of analysis based on random sequencing followed by comparison of genetic distances are presented. Only after all APMVs are reported and classified will epidemiological information be known as to how the viruses are moving and spreading as the birds travel and interact with other avian species. 相似文献
TABLE 1.
Characteristics of prototype viruses APMV1 to APMV9 and the penguin virusStrain | Host | Disease | Distribution | Fusion cleavagec | GI accession no. |
---|---|---|---|---|---|
APMV1/Newcastle disease virus | >250 species | High mortality | Worldwide | GRRQKRF | 45511218 |
Inapparent | Worldwide | GGRQGRLa | 11545722 | ||
APMV2/Chicken/CA/Yucaipa/1956 | Turkey, chickens, psittacines, rails, passerines | Decrease in egg production and respiratory disease | Worldwide | DKPASRF | 169144527 |
APMV3/Turkey/WI/1968 | Turkey | Mild respiratory disease and moderate egg decrease | Worldwide | PRPSGRLa | 209484147 |
APMV3/Parakeet/Netherlands/449/1975 | Psittacines, passerines, flamingos | Neurological, enteric, and respiratory disease | Worldwide | ARPRGRLa | 171472314 |
APMV4/Duck/Hong Kong/D3/1975 | Duck, geese, chickens | None known | Worldwide | VDIQPRF | 210076708 |
APMV5/Budgerigar/Japan/Kunitachi/1974 | Budgerigars, lorikeets | High mortality, enteric disease | Japan, United Kingdom, Australia | GKRKKRFa | 290563909 |
APMV6/Duck/Hong Kong/199/1977 | Ducks, geese, turkeys | Mild respiratory disease and increased mortality in turkeys | Worldwide | PAPEPRLb | 15081567 |
APMV7/Dove/TN/4/1975 | Pigeons, doves, turkeys | Mild respiratory disease in turkeys | United States, England, Japan | TLPSSRF | 224979458 |
APMV8/Goose/DE/1053/1976 | Ducks, geese | None known | United States, Japan | TYPQTRLa | 226343050 |
APMV9/Duck/NY/22/1978 | Ducks | None known | Worldwide | RIREGRIa | 217068693 |
APMV10/Penguin/Falkland Islands/324/2007 | Rockhopper penguins | None Known | Falkland Islands | DKPSQRIa | 300432141 |
2.
Andrew D. Morgan R. Craig MacLean Kristina L. Hillesland Gregory J. Velicer 《Applied and environmental microbiology》2010,76(20):6920-6927
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.
Open in a separate window 相似文献
TABLE 1.
List of myxobacteria used, with geographical originOrganism abbreviation used in text | Species | Strain | Geographic origin | Reference(s) |
---|---|---|---|---|
A9 | Myxococcus xanthus | A9 | Tübingen, Germany | 78 |
A23 | Myxococcus xanthus | A23 | Tübingen, Germany | 78 |
A30 | Myxococcus xanthus | A30 | Tübingen, Germany | 78 |
A41 | Myxococcus xanthus | A41 | Tübingen, Germany | 78 |
A46 | Myxococcus xanthus | A46 | Tübingen, Germany | 78 |
A47 | Myxococcus xanthus | A47 | Tübingen, Germany | 78 |
A75 | Myxococcus xanthus | A75 | Tübingen, Germany | 78 |
A85 | Myxococcus xanthus | A85 | Tübingen, Germany | 78 |
TV | Myxococcus xanthus | Tvärminne | Tvärminne, Finland | 79 |
PAK | Myxococcus xanthus | Paklenica | Paklenica, Croatia | 79 |
MAD | Myxococcus xanthus | Madeira 1 | Madeira, Portugal | 79 |
WAR | Myxococcus xanthus | Warwick 1 | Warwick, UK | 79 |
TOR | Myxococcus xanthus | Toronto 1 | Toronto, Ontario, Canada | 79 |
SUL2 | Myxococcus xanthus | Sulawesi 2 | Sulawesi, Indonesia | 79 |
KAL | Myxococcus xanthus | Kalalau | Kalalau, HI | 79 |
DAV | Myxococcus xanthus | Davis 1A | Davis, CA | 79 |
GJV1 | Myxococcus xanthus | GJV 1 | Unknown | 35, 72 |
MXFL1 | Myxococcus flavescens | Mx fl1 | Unknown | 65 |
MXV2 | Myxococcus virescens | Mx v2 | Unknown | 65 |
CCM8 | Myxococcus macrosporus | Cc m8 | Unknown | 65 |
3.
Relatively little is known about the small subset of peroxisomal proteins with predicted protease activity. Here, we report that the peroxisomal LON2 (At5g47040) protease facilitates matrix protein import into Arabidopsis (Arabidopsis thaliana) peroxisomes. We identified T-DNA insertion alleles disrupted in five of the nine confirmed or predicted peroxisomal proteases and found only two—lon2 and deg15, a mutant defective in the previously described PTS2-processing protease (DEG15/At1g28320)—with phenotypes suggestive of peroxisome metabolism defects. Both lon2 and deg15 mutants were mildly resistant to the inhibitory effects of indole-3-butyric acid (IBA) on root elongation, but only lon2 mutants were resistant to the stimulatory effects of IBA on lateral root production or displayed Suc dependence during seedling growth. lon2 mutants displayed defects in removing the type 2 peroxisome targeting signal (PTS2) from peroxisomal malate dehydrogenase and reduced accumulation of 3-ketoacyl-CoA thiolase, another PTS2-containing protein; both defects were not apparent upon germination but appeared in 5- to 8-d-old seedlings. In lon2 cotyledon cells, matrix proteins were localized to peroxisomes in 4-d-old seedlings but mislocalized to the cytosol in 8-d-old seedlings. Moreover, a PTS2-GFP reporter sorted to peroxisomes in lon2 root tip cells but was largely cytosolic in more mature root cells. Our results indicate that LON2 is needed for sustained matrix protein import into peroxisomes. The delayed onset of matrix protein sorting defects may account for the relatively weak Suc dependence following germination, moderate IBA-resistant primary root elongation, and severe defects in IBA-induced lateral root formation observed in lon2 mutants.Peroxisomes are single-membrane-bound organelles found in most eukaryotes. Peroxin (PEX) proteins are necessary for various aspects of peroxisome biogenesis, including matrix protein import (for review, see Distel et al., 1996; Schrader and Fahimi, 2008). Most matrix proteins are imported into peroxisomes from the cytosol using one of two targeting signals, a C-terminal type 1 peroxisome-targeting signal (PTS1) or a cleavable N-terminal type 2 peroxisome-targeting signal (PTS2) (Reumann, 2004). PTS1- and PTS2-containing proteins are bound in the cytosol by soluble matrix protein receptors, escorted to the peroxisome membrane docking complex, and translocated into the peroxisome matrix (for review, see Platta and Erdmann, 2007). Once in the peroxisome, many matrix proteins participate in metabolic pathways, such as β-oxidation, hydrogen peroxide decomposition, and photorespiration (for review, see Gabaldon et al., 2006; Poirier et al., 2006).In addition to metabolic enzymes, several proteases are found in the peroxisome matrix. Only one protease, DEG15/Tysnd1, has a well-defined role in peroxisome biology. The rat Tysnd1 protease removes the targeting signal after PTS2-containing proteins enter the peroxisome and also processes certain PTS1-containing β-oxidation enzymes (Kurochkin et al., 2007). Similarly, the Arabidopsis (Arabidopsis thaliana) Tysnd1 homolog DEG15 (At1g28320) is a peroxisomal Ser protease that removes PTS2 targeting signals (Helm et al., 2007; Schuhmann et al., 2008).In contrast with DEG15, little is known about the other eight Arabidopsis proteins that are annotated as proteases in the AraPerox database of putative peroxisomal proteins (Reumann et al., 2004; Carter et al., 2004; Shimaoka et al., 2004), which, in combination with the minor PTS found in both of these predicted proteases (Reumann, 2004), suggests that these enzymes may not be peroxisomal. Along with DEG15, only two of the predicted peroxisomal proteases, an M16 metalloprotease (At2g41790), which we have named PXM16 for peroxisomal M16 protease, and a Lon-related protease (At5g47040/LON2; Ostersetzer et al., 2007), are found in the proteome of peroxisomes purified from Arabidopsis suspension cells (Eubel et al., 2008). DEG15 and LON2 also have been validated as peroxisomally targeted using GFP fusions (Ostersetzer et al., 2007; Schuhmann et al., 2008).
Open in a separate windowaMajor PTS1 (Reumann, 2004).bMinor PTS1 (Reumann, 2004).cValidated PTS1 (Reumann et al., 2007).dMinor PTS2 (Reumann, 2004).PXM16 is the only one of the nine Arabidopsis M16 (pitrilysin family) metalloproteases (García-Lorenzo et al., 2006; Rawlings et al., 2008) containing a predicted PTS. M16 subfamilies B and C contain the plastid and mitochondrial processing peptidases (for review, see Schaller, 2004), whereas PXM16 belongs to M16 subfamily A, which includes insulin-degrading peptidases (Schaller, 2004). A tomato (Solanum lycopersicum) M16 subfamily A protease similar to insulin-degrading enzymes with a putative PTS1 was identified in a screen for proteases that cleave the wound response peptide hormone systemin (Strassner et al., 2002), but the role of Arabidopsis PXM16 is unknown.Arabidopsis LON2 is a typical Lon protease with three conserved domains: an N-terminal domain, a central ATPase domain in the AAA family, and a C-terminal protease domain with a Ser-Lys catalytic dyad (Fig. 1A; Lee and Suzuki, 2008). Lon proteases are found in prokaryotes and in some eukaryotic organelles (Fig. 1C) and participate in protein quality control by cleaving unfolded proteins and can regulate metabolism by controlling levels of enzymes from many pathways, including cell cycle, metabolism, and stress responses (for review, see Tsilibaris et al., 2006). Four Lon homologs are encoded in the Arabidopsis genome; isoforms have been identified in mitochondria, plastids, and peroxisomes (Ostersetzer et al., 2007; Eubel et al., 2008; Rawlings et al., 2008). Mitochondrial Lon protesases are found in a variety of eukaryotes (Fig. 1A) and function both as ATP-dependent proteases and as chaperones promoting protein complex assemblies (Lee and Suzuki, 2008). LON2 is the only Arabidopsis Lon isoform with a canonical C-terminal PTS1 (SKL-COOH; Ostersetzer et al., 2007) or found in the peroxisome proteome (Eubel et al., 2008; Reumann et al., 2009). Functional studies have been conducted with peroxisomal Lon isoforms found in the proteome of peroxisomes purified from rat hepatic cells (pLon; Kikuchi et al., 2004) and the methylotrophic yeast Hansenula polymorpha (Pln; Aksam et al., 2007). Rat pLon interacts with β-oxidation enzymes, and a cell line expressing a dominant negative pLon variant has decreased β-oxidation activity, displays defects in the activation processing of PTS1-containing acyl-CoA oxidase, and missorts catalase to the cytosol (Omi et al., 2008). H. polymorpha Pln is necessary for degradation of a misfolded, peroxisome-targeted version of dihydrofolate reductase and for degradation of in vitro-synthesized alcohol oxidase in peroxisomal matrix extracts, but does not contribute to degradation of peroxisomally targeted GFP (Aksam et al., 2007).Open in a separate windowFigure 1.Diagram of LON2 protein domains, gene models for LON2, PXM16, DEG15, PED1, PEX5, and PEX6, and phylogenetic relationships of LON family members. A, Organization of the 888-amino acid LON2 protein. Locations of the N-terminal domain conserved among Lon proteins, predicted ATP-binding Walker A and B domains (black circles), active site Ser (S) and Lys (K) residues (asterisks), and the C-terminal Ser-Lys-Leu (SKL) peroxisomal targeting signal (PTS1) are shown (Lee and Suzuki, 2008). B, Gene models for LON2, PXM16, DEG15, PED1, PEX5, and PEX6 and locations of T-DNA insertions (triangles) or missense alleles (arrows) used in this study. Exons are depicted by black boxes, introns by black lines, and untranslated regions by gray lines. C, Phylogenetic relationships among LON homologs. Sequences were aligned using MegAlign (DNAStar) and the ClustalW method. The PAUP 4.0b10 program (Swofford, 2001) was used to generate an unrooted phylogram from a trimmed alignment corresponding to Arabidopsis LON2 residues 400 to 888 (from the beginning of the ATPase domain to the end of the protein). The bootstrap method was performed for 500 replicates with distance as the optimality criterion. Bootstrap values are indicated at the nodes. Predicted peroxisomal proteins have C-terminal PTS1 signals in parentheses and are in light-gray ovals. Proteins in the darker gray oval have N-terminal extensions and include mitochondrial and chloroplastic proteins. Sequence identifiers are listed in Supplemental Table S2.In this work, we examined the roles of several putative peroxisomal proteases in Arabidopsis. We found that lon2 mutants displayed peroxisome-deficient phenotypes, including resistance to the protoauxin indole-3-butyric acid (IBA) and age-dependent defects in peroxisomal import of PTS1- and PTS2-targeted matrix proteins. Our results indicate that LON2 contributes to matrix protein import into Arabidopsis peroxisomes. 相似文献
Table I.
Putative Arabidopsis proteases predicted or demonstrated to be peroxisomalAGI Identifier | Alias | Protein Class | T-DNA Insertion Alleles | PTS | Localization Evidence | Localization References |
---|---|---|---|---|---|---|
At1g28320 | DEG15 | PTS2-processing protease | SALK_007184 (deg15-1) | SKL>a | GFP | Reumann et al., 2004; Helm et al., 2007; Eubel et al., 2008; Schuhmann et al., 2008) |
Proteomics | ||||||
Bioinformatics | ||||||
At2g41790 | PXM16 | Peptidase M16 family protein | SALK_019128 (pxm16-1) | PKL>b | Proteomics | Reumann et al., 2004, 2009; Eubel et al., 2008) |
SALK_023917 (pxm16-2) | Bioinformatics | |||||
At5g47040 | LON2 | Lon protease homolog | SALK_128438 (lon2-1) | SKL>a | GFP | Reumann et al., 2004, 2009; Ostersetzer et al., 2007; Eubel et al., 2008) |
SALK_043857 (lon2-2) | Proteomics | |||||
Bioinformatics | ||||||
At2g18080 | Ser-type peptidase | SALK_020628 | SSI>c | Bioinformatics | (Reumann et al., 2004) | |
SALK_102239 | ||||||
At2g35615 | Aspartyl protease | SALK_090795 | ANL>b | Bioinformatics | (Reumann et al., 2004) | |
SALK_036333 | ||||||
At3g57810 | Ovarian tumor-like Cys protease | SKL>a | Bioinformatics | (Reumann et al., 2004) | ||
At4g14570 | Acylaminoacyl-peptidase protein | CKL>b | Bioinformatics (peroxisome) | (Reumann et al., 2004; Shimaoka et al., 2004) | ||
Proteomics (vacuole) | ||||||
At4g20310 | Peptidase M50 family protein | RMx5HLd | Bioinformatics | (Reumann et al., 2004) | ||
At4g36195 | Ser carboxypeptidase S28 family | SSM>b | Bioinformatics (peroxisome) | (Carter et al., 2004; Reumann et al., 2004) | ||
Proteomics (vacuole) |
4.
Todd J. Ward Thomas Usgaard Peter Evans 《Applied and environmental microbiology》2010,76(19):6680-6684
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number ).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table NC_003210(Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology. 相似文献
TABLE 1.
Primers used in multiplex amplification for the TMLGT assayAmplicon | Positiona | Gene(s) | Primer | Sequence (5′-3′)b |
---|---|---|---|---|
INLa | 455381-456505 | inlA | inl2-a1 | GTCCTTGATAGTCTACTG |
inl2-a2 | ACCAAATTAGTAATCTAGCAC | |||
INLb | 457726-458752 | inlB | inl-f1d | GAATTRTTTAGYCAAGAATGT |
inlb-r | CTACCGGRACTTTATAGTAYG | |||
LMO | 325116-326096 | lmo0298-lmo0300 | lmo-a1 | AAGGCTTACAAGATGGCT |
lmo1a-1r | AAATAATAYGTGATACCGAC | |||
VGCa | 205366-206622 | plcA, hly | plca-f | CTCATCGTATCRTGTGTACC |
hly-r | TCTGGAAGGTCKTGTAGGTTC | |||
VGCb | 208447-209465 | mpl | ra_mpl-f | GTGGAYAGAACTCATAAAGG |
ra_mpl-r | ACTCCCTCCTYGTGATASGCT | |||
VGCc | 209728-211239 | actA | vgc1a-2f | TTCMATRCCAGCAGAACG |
vgc1a-2r | GCAGACCTAATAGCAATGTTG |
TABLE 2.
TMLGT probes and probe performance dataProbeb | Target (n)c | Probe sequenced | IDe | Sensitivity (%) | Specificity (%) |
---|---|---|---|---|---|
VGCb-21 | Lineage I (506) | AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc | 7.3 | 100 | 100 |
VGCa-94 | Lineage I | CTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc | 51.7 | 100 | 100 |
VGCc-8 | Lineage II (340) | AATCCTTTTACATTCATTACTTACattagctgattcgctttcct | 14.1 | 100 | 100 |
INLb-51 | Lineage II | TCATTTCAATCAATCATCAACAATagcgccaataaagctggc | 21.9 | 100 | 100 |
VGCb-19 | Lineage III (50) | TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca | 31.0 | 100 | 100 |
VGCb-29 | Lineage III | AATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt | 45.1 | 100 | 100 |
LMO-17 | Lineage IV (10) | CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt | 11.8 | 100 | 100 |
VGCa-27 | Lineage IV | CTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac | 58.3 | 100 | 100 |
INLb-84 | Serogroup 4b (213) | TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg | 9.7 | 100 | 100 |
INLb-85 | Serogroup 4b | ATACTACATCATAATCAAACATCActcgtgaacaagctttcc | 5.5 | 100 | 100 |
INLb-16 | Serogroup 1/2b (293) | AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta | 11.7 | 100 | 100 |
INLb-100 | Serogroup 1/2b | CTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat | 13.0 | 100 | 100 |
LMO-42 | Serogroup 1/2a (268) | CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg | 6.6 | 100 | 100 |
VGCb-40 | Serogroup 1/2a | CTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag | 10.4 | 100 | 98.6 |
LMO-9 | Serogroup 1/2c (72) | TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg | 13.5 | 100 | 100 |
VGCb-5 | Serogroup 1/2c | CAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac | 20.8 | 98.6 | 100 |
LMO-10 | ECI (111) | ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag | 19.0 | 100 | 100 |
LMO-28 | ECI | CTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt | 23.7 | 100 | 100 |
VGCc-80 | ECIa (44) | CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc | 10.7 | 100 | 100 |
VGCa-35 | ECIa | CAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt | 9.2 | 100 | 100 |
LMO-12 | ECII (35) | TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt | 3.8 | 100 | 100 |
LMO-30 | ECII | TTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa | 7.5 | 100 | 100 |
VGCc-45 | ECIII (10) | TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc | 21.1 | 100 | 99.4 |
INLa-3 | ECIII | TACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta | 17.0 | 100 | 99.4 |
INLa-1 | INLa control | CTTTAATCTCAATCAATACAAATCagaagtggaagctgggaa | NAa | NA | NA |
INLb-13 | INLb control | CAATAAACTATACTTCTTCACTAAtgcacctaaacctccgac | NA | NA | NA |
LMO-88 | LMO control | TTACTTCACTTTCTATTTACAATCccgtttccttatgccaca | NA | NA | NA |
VGCa-23 | VGCa control | TTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcg | NA | NA | NA |
VGCb-25 | VGCb control | CTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrcca | NA | NA | NA |
VGCc-82 | VGCc control | TACATACACTAATAACATACTCATgactgcatgctagaatctaag | NA | NA | NA |
5.
6.
7.
Retrograde Intraflagellar Transport Mutants Identify Complex A Proteins With Multiple Genetic Interactions in Chlamydomonas reinhardtii
下载免费PDF全文
![点击此处可从《Genetics》网站下载免费的PDF全文](/ch/ext_images/free.gif)
The intraflagellar transport machinery is required for the assembly of cilia. It has been investigated by biochemical, genetic, and computational methods that have identified at least 21 proteins that assemble into two subcomplexes. It has been hypothesized that complex A is required for retrograde transport. Temperature-sensitive mutations in FLA15 and FLA17 show defects in retrograde intraflagellar transport (IFT) in Chlamydomonas. We show that IFT144 and IFT139, two complex A proteins, are encoded by FLA15 and FLA17, respectively. The fla15 allele is a missense mutation in a conserved cysteine and the fla17 allele is an in-frame deletion of three exons. The flagellar assembly defect of each mutant is rescued by the respective transgenes. In fla15 and fla17 mutants, bulges form in the distal one-third of the flagella at the permissive temperature and this phenotype is also rescued by the transgenes. These bulges contain the complex B component IFT74/72, but not α-tubulin or p28, a component of an inner dynein arm, which suggests specificity with respect to the proteins that accumulate in these bulges. IFT144 and IFT139 are likely to interact with each other and other proteins on the basis of three distinct genetic tests: (1) Double mutants display synthetic flagellar assembly defects at the permissive temperature, (2) heterozygous diploid strains exhibit second-site noncomplemention, and (3) transgenes confer two-copy suppression. Since these tests show different levels of phenotypic sensitivity, we propose they illustrate different gradations of gene interaction between complex A proteins themselves and with a complex B protein (IFT172).CILIA and flagella are microtubule-based organelles that are found on most mammalian cells. They provide motility to cells and participate in many sensory processes. Defects in or loss of cilia/flagella cause a variety of human diseases that include polycystic kidney disease, retinal degeneration, infertility, obesity, respiratory defects, left–right axis determination, and polydactyly (Fliegauf et al. 2007). Mouse mutants demonstrate that cilia are essential for viability, neural tube closure, and bone development (Eggenschwiler and Anderson 2007; Fliegauf et al. 2007). Cilia and flagella are also present in protists, algae, moss, and some fungi.The assembly and maintenance of cilia and flagella require intraflagellar transport (IFT) (Kozminski et al. 1995). IFT involves the movement of 100- to 200-nm-long protein particles from the basal body located in the cell body to the tip of the flagella using the heterotrimeric kinesin-2 (anterograde movement) (Kozminski et al. 1995) and movement back to the cell body (retrograde movement) using the cytoplasmic dynein complex (Pazour et al. 1999; Porter et al. 1999). IFT particles change their direction of movement as well as their size, speed, and frequency at the ends of the flagella as they switch from anterograde to retrograde movement (Iomini et al. 2001). Biochemical isolation of IFT particles reveals that they are composed of at least 16 proteins and that these particles can be dissociated into two complexes in vitro by changing the salt concentration (Cole et al. 1998; Piperno et al. 1998). Recent genetic and bioinformatics analysis adds at least 7 more proteins to the IFT particle (Follit et al. 2009) (Eggenschwiler and Anderson 2007).
Open in a separate window—, no mutant found to date in Chlamydomonas.A collection of temperature-sensitive mutant strains that fail to assemble flagella at the restrictive temperature of 32° was isolated in Chlamydomonas (Huang et al. 1977; Adams et al. 1982; Piperno et al. 1998; Iomini et al. 2001). Analysis of the flagella at 21° permits the measurement of the velocity and frequency of IFT particles in the mutant strains. This analysis suggested that assembly has four phases: recruitment to the basal body, anterograde movement (phases I and II), retrograde movement, and return to the cytoplasm (phases III and IV) (Iomini et al. 2001). Different mutants were classified as defective in these four phases. However, because different alleles of FLA8 were classified as defective in different phases (Iomini et al. 2001; Miller et al. 2005), we combined mutants with IFT defects into just two classes. The first group (phases I and II) includes mutant strains that show decreased anterograde velocities, a decreased ratio of anterograde to retrograde particles, and an accumulation of complex A proteins at the basal body. This group includes mutations in the FLA8 and FLA10 genes, which encode the two motor subunits of kinesin-2 (Walther et al. 1994; Miller et al. 2005), as well as mutations in three unknown genes (FLA18, FLA27, and FLA28). The second group includes mutant strains that show the reciprocal phenotype (phases III and IV); these phenotypes include decreased retrograde velocities, an increased ratio of anterograde to retrograde particles, and an accumulation of complex B proteins in the flagella. With the exception of the FLA11 gene, which encodes IFT172, a component of complex B (Pedersen et al. 2005), the gene products in this class are unknown (FLA2, FLA15, FLA16, FLA17, and FLA24). One might predict that mutations in this group would map to genes that encode complex A or retrograde motor subunits. Interestingly, IFT particles isolated from fla11, fla15, fla16, and fla17-1 flagella show depletion of complex A polypeptides (Piperno et al. 1998; Iomini et al. 2001). The inclusion of IFT172 in this class is explained by the observations that IFT172 plays a role in remodeling the IFT particles at the flagellar tip to transition from anterograde to retrograde movement (Pedersen et al. 2005). The remaining mutant strains do not show obvious defects in velocities, ratios, or accumulation at 21° and may reflect a less severe phenotype at the permissive temperature or a non-IFT role for these genes.Direct interactions occur between components of complex B. IFT81 and IFT74/72 interact to form a scaffold required for IFT complex B assembly (Lucker et al. 2005). IFT57 and IFT20 also interact with each other and kinesin-2 (Baker et al. 2003). While physical interactions are being used to define IFT particle architecture, genetic interactions among loci encoding IFT components should be instructive regarding their function as well. To probe retrograde movement and its function, we have identified the gene products encoded by two retrograde defective mutant strains. They are FLA15 and FLA17 and encode IFT144 and IFT139, respectively. The genetic interactions of these loci provide interesting clues about the assembly of the IFT particles and possible physical interactions in the IFT particles. 相似文献
TABLE 1
Proteins and gene names for the intraflagellar transport particles in Chlamydomonas, C. elegans, and mouseProtein | Motif | Chlamydomonas gene | C. elegans gene | Mouse gene | References to worm and mouse genes |
---|---|---|---|---|---|
Complex A | |||||
IFT144 | WD | FLA15 | |||
IFT140 | WD | — | che-11 | Qin et al. (2001) | |
IFT139 | TRP | FLA17 | dyf-2 | THM1 | Efimenko et al. (2006); Tran et al. (2008) |
IFT122 | WD | — | IFTA-1 | Blacque et al. (2006) | |
IFT121 | WD | — | daf-10 | Bell et al. (2006) | |
IFT43 | — | ||||
Complex B | |||||
IFT172 | WD | FLA11 | osm-1 | Wimple | Huangfu et al. (2003); Pedersen et al. (2005); Bell et al. (2006) |
IFT88 | TRP | IFT88 | osm-5 | Tg737/Polaris | Pazour et al. (2000); Qin et al. (2001) |
IFT81 | Coil | — | ift-81 | CDV1 | Kobayashi et al. (2007) |
IFT80 | WD | — | che-2 | Wdr56 | Fujiwara et al. (1999) |
IFT74/72 | Coil | — | ift-74 | Cmg1 | Kobayashi et al. (2007) |
IFT57/55 | Coil | — | che-13 | Hippi | Haycraft et al. (2003) |
IFT54 | Microtubule binding domain MIP-T3 | — | dyf-11 | Traf3IP1 | Kunitomo and Iino (2008); Li et al. (2008); Omori et al. (2008); Follit et al. (2009) |
IFT52 | ABC type | BLD1 | osm-6 | Ngd2 | Brazelton et al. (2001); Bell et al. (2006) |
IFT46 | IFT46 | dyf-6 | Bell et al. (2006); Hou et al. (2007) | ||
IFT27 | G protein | — | Not present | Rabl4 | |
IFT25 | Hsp20 | — | Not present | HSP16.1 | Follit et al. (2009) |
IFT22 | G protein | — | IFTA-2 | Rabl5 | Schafer et al. (2006) |
IFT20 | Coil | — | Follit et al. (2006) | ||
FAP22 | Cluamp related protein | — | dyf-3 | Cluamp1 | Murayama et al. (2005); Follit et al. (2009) |
DYF13 | — | dyf-13 | Ttc26 | Blacque et al. (2005) |
8.
9.
10.
11.
12.
13.
Haruyuki Nakayama-Imaohji Hideki Hirakawa Minoru Ichimura Shin Wakimoto Satoru Kuhara Tetsuya Hayashi Tomomi Kuwahara 《Journal of bacteriology》2009,191(19):6003-6011
The human gut microbe Bacteroides fragilis can alter the expression of its surface molecules, such as capsular polysaccharides and SusC/SusD family outer membrane proteins, through reversible DNA inversions. We demonstrate here that DNA inversions at 12 invertible regions, including three gene clusters for SusC/SusD family proteins, were controlled by a single tyrosine site-specific recombinase (Tsr0667) encoded by BF0667 in B. fragilis strain YCH46. Genetic disruption of BF0667 diminished or attenuated shufflon-type DNA inversions at all three susC/susD genes clusters, as well as simple DNA inversions at nine other loci, most of which colocalized with susC/susD family genes. The inverted repeat sequences found within the Tsr0667-regulated invertible regions shared the consensus motif sequence AGTYYYN4GDACT. Tsr0667 specifically mediated the DNA inversions of 10 of the 12 regions, even under an Escherichia coli background when the invertible regions were exposed to BF0667 in E. coli cells. Thus, Tsr0667 is an additional globally acting DNA invertase in B. fragilis, which probably involves the selective expression of SusC/SusD family outer membrane proteins.The human gut harbors an abundant and diverse microbiota. Bacteroides is one of the most abundant genera of human gut microflora (10, 17, 20), and the biological activities of Bacteroides species are deeply integrated into human physiology through nutrient degradation, the production of short-chain fatty acids, or immunomodulatory molecules (11-14, 24). Recent genomic analyses of Bacteroides have revealed that the bacteria possess redundant abilities not only to bind and degrade otherwise indigestible dietary polysaccharides but also to produce vast arrays of capsular polysaccharide (5, 19, 38, 39). These functional redundancies have been established by the extensive duplication of various genes that encode molecules such as glycosylhydrolases, glycosyltransferases, and outer membrane proteins of the SusC/SusD family (starch utilization system) known to be involved in polysaccharide recognition and transport (7, 27, 28, 30). It has been assumed that these functional redundancies of Bacteroides contribute to the stability of the gut ecosystem (3, 21, 23, 32, 39).Another characteristic feature common in Bacteroides species is that the expression of some of the genes is altered in an on-off manner by reversible DNA inversions at gene promoters or within the protein-coding regions (5, 9, 19, 38, 39). These phase-variable phenotypes are associated with surface architectures such as capsular polysaccharides and SusC/SusD family proteins (5, 6, 16, 19). Our previous genomic analyses of Bacteroides fragilis strain YCH46 revealed that it contained as many as 31 invertible regions in its chromosome (19). These invertible regions can be grouped into six classes according to the internal motif sequences within inverted repeat sequences (IRs) (Table (Table1).1). The DNA inversions within these regions are thought to be controlled by site-specific DNA invertases specific to each class. B. fragilis strain YCH46 contains 33 tyrosine site-specific recombinases (Tsr) genes and four serine site-specific recombinases (Ssr) genes. Generally, DNA invertases mediate DNA inversions at adjacent regions, such as FimB and FimE, that flip their immediate downstream promoters to generate a phase-variable phenotype of type I pili in Escherichia coli (15). B. fragilis is unique in that this anaerobe possesses not only locally acting DNA invertases but also globally acting DNA invertases that mediate DNA inversions at distant loci (8, 29). It has been reported that B. fragilis possesses at least two types of master DNA invertase that regulate DNA inversions at multiple loci simultaneously (8, 29). One is Mpi, an Ssr that mediates the on-off switching of 13 promoter regions (corresponding to class I regions in B. fragilis strain YCH46), including seven promoter regions for capsular polysaccharide biosynthesis in B. fragilis strain NCTC9343 (8). The other master DNA invertase is Tsr19, a Tsr that regulates DNA inversions at two distantly located promoter regions (corresponding to class IV regions in B. fragilis strain YCH46) associated with the large encapsulation phenotype (6, 26, 29). The invertible regions contain specific consensus motifs within the IRs corresponding to each DNA invertase and constitute a regulatory unit. We designated this type of regulatory unit as an “inverlon,” which consists of at least two invertible regions controlled by a single master DNA invertase.
Open in a separate windowaOur previous classification of the invertible regions identified in B. fragilis strain YCH46 genome (19).bConsensus motif sequences found within IRs are shown. R = A or G, W = A or T, and N = A, G, C, or T.cThe gene identifications in B. fragilis strain YCH46 genome are shown.Our previous studies indicated that an additional inverlon other than the Mpi- and Tsr19-regulated inverlons is present in B. fragilis, based on the finding that at least 10 invertible regions (corresponding to class II regions in B. fragilis strain YCH46) contain a particular consensus motif sequence (AAGTTCN5GAACTT) within their IRs (19) but do not appear to colocalize with a DNA invertase gene. The majority of the class II regions were associated with the selective switching of a particular set of susC/susD family genes. Since the SusC/SusD family of outer membrane proteins play an important role in polysaccharide utilization by Bacteroides (3, 23, 32), the inverlon associated with the phase variation of SusC/SusD family proteins would likely be involved in the survival of this anaerobe in the distal gut.In the present study, we sought to identify the DNA invertase regulating the additional inverlon in B. fragilis. Our results indicated that the Tsr encoded by BF0667 is a master DNA invertase for this inverlon (designated the Tsr0667-inverlon) in B. fragilis. 相似文献
TABLE 1.
Classification of the invertible regions in B. fragilis strain YCH46 based on internal motif sequences within IRsClassa | No. | Consensus motif sequencesb | Master DNA invertase genec | Regulated genes | Source or reference(s) |
---|---|---|---|---|---|
I | 14 | ARACGTWCGT | BF2765 (mpi) | Capsular polysaccharide biosynthesis genes | 8 |
II | 10 | AGTTC{N5}GAACT | BF0667 | susC/susD paralogs | This study |
III | 3 | GTTAC{N7}GTAAC | BF3038, BF4033, BF4283 | Putative outer membrane protein genes | 36 |
IV | 2 | TACTTANTAGGTAANAGAA | BF2766 | Extracellular polysacharide biosynthesis genes | 6, 26, 29 |
V | 1 | TCTGCAAAGNCTTTGCAGA | BF0667 | susC/susD paralogs | This study |
VI | 1 | ACTAAGTTCTATCGG | BF0667 | susC/susD paralogs | This study |
14.
15.
16.
Epistatic Interactions between Opaque2 Transcriptional Activator and Its Target Gene CyPPDK1 Control Kernel Trait Variation in Maize 总被引:1,自引:0,他引:1
下载免费PDF全文
![点击此处可从《Plant physiology》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Domenica Manicacci Letizia Camus-Kulandaivelu Marie Fourmann Chantal Arar Stéphanie Barrault Agnès Rousselet No?l Feminias Luciano Consoli Lisa Francès Valérie Méchin Alain Murigneux Jean-Louis Prioul Alain Charcosset Catherine Damerval 《Plant physiology》2009,150(1):506-520
17.
Sandra Wydau Guillaume van der Rest Caroline Aubard Pierre Plateau Sylvain Blanquet 《The Journal of biological chemistry》2009,284(21):14096-14104
Several l-aminoacyl-tRNA synthetases can transfer a
d-amino acid onto their cognate tRNA(s). This harmful reaction is
counteracted by the enzyme d-aminoacyl-tRNA deacylase. Two distinct
deacylases were already identified in bacteria (DTD1) and in archaea (DTD2),
respectively. Evidence was given that DTD1 homologs also exist in nearly all
eukaryotes, whereas DTD2 homologs occur in plants. On the other hand, several
bacteria, including most cyanobacteria, lack genes encoding a DTD1 homolog.
Here we show that Synechocystis sp. PCC6803 produces a third type of
deacylase (DTD3). Inactivation of the corresponding gene (dtd3)
renders the growth of Synechocystis sp. hypersensitive to the
presence of d-tyrosine. Based on the available genomes, DTD3-like
proteins are predicted to occur in all cyanobacteria. Moreover, one or several
dtd3-like genes can be recognized in all cellular types, arguing in
favor of the nearubiquity of an enzymatic function involved in the defense of
translational systems against invasion by d-amino acids.Although they are detected in various living organisms (reviewed in Ref.
1), d-amino acids
are thought not to be incorporated into proteins, because of the
stereospecificity of aminoacyl-tRNA synthetases and of the translational
machinery, including EF-Tu and the ribosome
(2). However, the
discrimination between l- and d-amino acids by
aminoacyl-tRNA synthetases is not equal to 100%. Significant
d-aminoacylation of their cognate tRNAs by Escherichia
coli tyrosyl-, tryptophanyl-, aspartyl-, lysyl-, and histidyl-tRNA
synthetases has been characterized in vitro
(3–9).
Recently, using a bacterium, transfer of d-tyrosine onto
tRNATyr was shown to occur in vivo
(10).With such misacylation reactions, the resulting
d-aminoacyl-tRNAs form a pool of metabolically inactive molecules,
at best. At worst, d-aminoacylated tRNAs infiltrate the protein
synthesis machinery. Although the latter harmful possibility has not yet been
firmly established, several cells were shown to possess a
d-tyrosyl-tRNA deacylase, or DTD, that should help them counteract
the accumulation of d-aminoacyl-tRNAs. This enzyme shows a broad
specificity, being able to remove various d-aminoacyl moieties from
the 3′-end of a tRNA
(4–6,
11). Such a function makes the
deacylase a member of the family of enzymes capable of editing in
trans mis-aminoacylated tRNAs. This family includes several homologs
of aminoacyl-tRNA synthetase editing domains
(12), as well as peptidyl-tRNA
hydrolase (13,
14).Two distinct deacylases have already been discovered. The first one, called
DTD1, is predicted to occur in most bacteria and eukaryotes (see
d-amino acids, including
d-tyrosine (6). In
fact, in an E. coli Δdtd strain grown in the presence
of 2.4 mm d-tyrosine, as much as 40% of the cellular
tRNATyr pool becomes esterified with d-tyrosine
(10).
Open in a separate windowHomologs of dtd/DTD1 are not found in the available archaeal
genomes except that of Methanosphaera stadtmanae. A search for
deacylase activity in Sulfolobus solfataricus and Pyrococcus
abyssi led to the detection of another enzyme (DTD2), completely
different from the DTD1 protein
(15). Importing dtd2
into E. coli functionally compensates for dtd deprivation.
As shown in 16).Several cells contain neither dtd nor dtd2 homologs
(d-tyrosyl-tRNA deacylase
(DTD3). This protein, encoded by dtd3, behaves as a metalloenzyme.
Sensitivity of the growth of Synechocystis to external
d-tyrosine is strongly exacerbated by the disruption of
dtd3. Moreover, expression of the Synechocystis DTD3 in a
Δdtd E. coli strain, from a plasmid, restores the resistance of
the bacterium to d-tyrosine. Finally, using the available genomes,
we examined the occurrence of DTD3 in the living world. The prevalence of
DTD3-like proteins is surprisingly high. It suggests that the defense of
protein synthesis against d-amino acids is universal. 相似文献
TABLE 1
Distribution of DTD1 and DTD2 homologs in various phylogenetic groupsHomologs of DTD1 and DTD2 were searched for using a genomic Blast analysis against complete genomes in the NCBI Database (www.ncbi.nlm.nih.gov). Values in the table are number of species. For instance, E. coli is counted only once in γ-proteobacteria despite the fact that several E. coli strains have been sequenced.DTD1 | DTD2 | DTD1 + DTD2 | None | |
---|---|---|---|---|
Bacteria | ||||
Acidobacteria | 2 | 0 | 0 | 0 |
Actinobacteria | 27 | 0 | 0 | 8 |
Aquificae | 1 | 0 | 0 | 0 |
Bacteroidetes/Chlorobi | 12 | 0 | 0 | 5 |
Chlamydiae | 1 | 0 | 0 | 6 |
Chloroflexi | 4 | 0 | 0 | 0 |
Cyanobacteria | 5 | 0 | 0 | 16 |
Deinococcus/Thermus | 4 | 0 | 0 | 0 |
Firmicutes | ||||
Bacillales | 19 | 0 | 0 | 0 |
Clostridia | 19 | 0 | 0 | 0 |
Lactobacillales | 23 | 0 | 0 | 0 |
Mollicutes | 0 | 0 | 0 | 15 |
Fusobacteria/Planctomycetes | 2 | 0 | 0 | 0 |
Proteobacteria | ||||
α | 6 | 0 | 0 | 55 |
β | 24 | 0 | 0 | 11 |
γ | 80 | 0 | 0 | 8 |
δ | 15 | 0 | 0 | 0 |
ε | 1 | 0 | 0 | 12 |
Spirochaetes | 0 | 0 | 0 | 7 |
Thermotogae | 5 | 0 | 0 | 0 |
Archaea | ||||
Crenarchaeota | 0 | 13 | 0 | 0 |
Euryarchaeota | 1 | 26 | 0 | 2 |
Nanoarchaeota | 0 | 0 | 0 | 1 |
Eukaryota | ||||
Dictyosteliida | 1 | 0 | 0 | 0 |
Fungi/Metazoa | ||||
Fungi | 13 | 0 | 0 | 1 |
Metazoa | 19 | 0 | 0 | 0 |
Kinetoplastida | 3 | 0 | 0 | 0 |
Viridiplantae | 4 | 4 | 4 | 0 |
18.
19.
20.
Robert Ng Lakshmanan Govindasamy Brittney L. Gurda Robert McKenna Olga G. Kozyreva R. Jude Samulski Kristin N. Parent Timothy S. Baker Mavis Agbandje-McKenna 《Journal of virology》2010,84(24):12945-12957
The three-dimensional structure of adeno-associated virus (AAV) serotype 6 (AAV6) was determined using cryo-electron microscopy and image reconstruction and using X-ray crystallography to 9.7- and 3.0-Å resolution, respectively. The AAV6 capsid contains a highly conserved, eight-stranded (βB to βI) β-barrel core and large loop regions between the strands which form the capsid surface, as observed in other AAV structures. The loops show conformational variation compared to other AAVs, consistent with previous reports that amino acids in these loop regions are involved in differentiating AAV receptor binding, transduction efficiency, and antigenicity properties. Toward structure-function annotation of AAV6 with respect to its unique dual glycan receptor (heparan sulfate and sialic acid) utilization for cellular recognition, and its enhanced lung epithelial transduction compared to other AAVs, the capsid structure was compared to that of AAV1, which binds sialic acid and differs from AAV6 in only 6 out of 736 amino acids. Five of these residues are located at or close to the icosahedral 3-fold axis of the capsid, thereby identifying this region as imparting important functions, such as receptor attachment and transduction phenotype. Two of the five observed amino acids are located in the capsid interior, suggesting that differential AAV infection properties are also controlled by postentry intracellular events. Density ordered inside the capsid, under the 3-fold axis in a previously reported, conserved AAV DNA binding pocket, was modeled as a nucleotide and a base, further implicating this capsid region in AAV genome recognition and/or stabilization.Adeno-associated viruses (AAVs) are nonpathogenic single-stranded DNA (ssDNA) parvoviruses that belong to the Dependovirus genus and require helper viruses, such as Adenovirus or Herpesvirus, for lytic infection (4, 8, 22, 67). These viruses package a genome of ∼4.7 kb inside an icosahedral capsid (∼260 Å in diameter) with a triangulation number equal to 1 assembled from a total of 60 copies of their overlapping capsid viral protein (VP) 1 (VP1), VP2, and VP3 in a predicted ratio of 1:1:8/10 (10). The VPs are encoded from a cap open reading frame (ORF). VP3 is 61 kDa and constitutes 90% of the capsid''s protein composition. The less abundant VPs, VP1 (87 kDa) and VP2 (73 kDa), share the same C-terminal amino acid sequence with VP3 but have additional N-terminal sequences. A rep ORF codes for four overlapping proteins required for replication and DNA packaging.To date, more than 100 AAV isolates have been identified (21). Among the human and nonhuman primate AAVs isolated, 12 serotypes (AAV serotype 1 [AAV1] to AAV12) have been described and are classified into six phylogenetic clades on the basis of their VP sequences and antigenic reactivities, with AAV4 and AAV5 considered to be clonal isolates (21). AAV1 and AAV6, which represent clade A, differ by only 6 out of 736 VP1 amino acids (5 amino acids within VP3) and are antigenically cross-reactive. Other clade representatives include AAV2 (clade B), AAV2-AAV3 hybrid (clade C), AAV7 (clade D), AAV8 (clade E), and AAV9 (clade F) (21).The AAVs are under development as clinical gene delivery vectors (e.g., see references 5, 9, 12, 13, 24, 25, 53, and 61), with AAV2, the prototype member of the genus, being the most extensively studied serotype for this application. AAV2 has been successfully used to treat several disorders, but its broad tissue tropism makes it less effective for tissue-specific applications and the prevalence of preexisting neutralizing antibodies in the human population (11, 43) limits its utilization, especially when readministration is required to achieve a therapeutic outcome. Efforts have thus focused on characterizing the capsid-associated tissue tropism and transduction properties conferred by the capsid of representative serotypes of other clades (21). Outcomes of these studies include the observation that AAV1 and AAV6, for example, transduce liver, muscle, and airway epithelial cells more efficiently (e.g., up to 200-fold) than AAV2 (27, 28, 30). In addition, the six residues (Table (Table1)1) that differ between the VPs of AAV1 and AAV6 (a natural recombinant of AAV1 and AAV2 [56]) confer functional disparity between these two viruses. For example, AAV6 shows ∼3-fold higher lung cell epithelium transduction than AAV1 (27), and AAV1 and AAV6 bind terminally sialylated proteoglycans as their primary receptor, whereas AAV6 additionally binds to heparan sulfate (HS) proteoglycans with moderate affinity (70, 71). Therefore, a comparison of the AAV1 and AAV6 serotypes and, in particular, their capsid structures can help pinpoint the capsid regions that confer differences in cellular recognition and tissue transduction.
Open in a separate windowaMutant residues in boldface have an AAV6 parental original; those underlined have an AAV1 parental origin.bS, sialic acid; HS, heparan sulfate; HS+, HS positive.cThe sialic acid binding phenotypes of these mutants were not discussed in the respective publications but are assumed to be still present.dThe glycan targets for these mutants were not discussed in this publication; thus, the phenotypes indicated are assumed.eThis mutant is sialic acid independent (S-ind) for cellular transduction.The structures of AAV1 to AAV5 and AAV8 have been determined by X-ray crystallography and/or cryo-electron microscopy and image reconstruction (cryo-EM) (23, 36, 47, 52, 66, 73; unpublished data), and preliminary characterization of crystals has also been reported for AAV1, AAV5, AAV7, and AAV9 (15, 45, 46, 55). The capsid VP structures contain a conserved eight-stranded (βB to βI) β-barrel core and large loop regions between the strands that form the capsid surface. The capsid surface is characterized by depressions at the icosahedral 2-fold axes of symmetry, finger-like projections surrounding the 3-fold axes, and canyon-like depressions surrounding the 5-fold axes. A total of nine variable regions (VRs; VRI to VRIX) were defined when the two most disparate structures, AAV2 and AAV4, were compared (23). The VRs contain amino acids that contribute to slight differences in surface topologies and distinct functional phenotypes, such as in receptor binding, transduction efficiency, and antigenic reactivity (10, 23, 37, 47).The structure of virus-like particles (VLPs) of AAV6, produced in a baculovirus/Sf9 insect cell expression system, has been determined by two highly complementary approaches, cryo-EM and X-ray crystallography. The AAV6 VP structure contains the general features already described for the AAVs and has conformational differences in the VRs compared to the VRs of other AAVs. The 9.7-Å-resolution cryoreconstructed structure enabled the localization of the C-α positions of five of the six amino acids that differ between highly homologous AAV6 and AAV1 but did not provide information on the positions of the side chains or their orientations. The X-ray crystal structure determined to 3.0-Å resolution enabled us to precisely map the atomic positions of these five residues at or close to the icosahedral 3-fold axes of the capsid. Reported mutagenesis and biochemical studies had functionally annotated the six residues differing between AAV1 and AAV6 with respect to their roles in receptor attachment and differential cellular transduction. Their disposition identifies the 3-fold capsid region as playing essential roles in AAV infection. 相似文献
TABLE 1.
Amino acid differences between AAV1 and AAV6 and their reported mutantsAAV | Amino acid at positiona: | Glycan targetb | Reference | ||||||
---|---|---|---|---|---|---|---|---|---|
129 | 418 | 531 | 532 | 584 | 598 | 642 | |||
AAV1 | L | E | E | D | F | A | N | S | 70 |
AAV1-E/K | L | E | K | D | F | A | N | HS+ (and S)c | 70 |
AAV6 | F | D | K | D | L | V | H | HS and S | 70 |
AAV6.1 | F | D | E | D | L | V | H | HS− (and S)c | 40, 70 |
AAV6.2 | L | D | K | D | L | V | H | HS (and S)c | 40, 70 |
AAV6R2 | L | D | E | D | L | V | H | HS− (and S)c | 40 |
HAE1 | L | E | E | D | L | V | N | (HS− and S)d | 39 |
HAE2 | L | D | K | D | L | V | N | (HS and S)d | 39 |
shH10 | F | D | K | N | L | V | N | HS (and S-inde) | 33 |