Spectroscopic studies on the interaction of riboflavin with bovine serum albumin

The mechanism of interaction of riboflavin (RF) with bovine serum albumin (BSA) using fluorometric and circular dichroism (CD) methods has been reported. The association constant (K) for RF-BSA binding shows that the interaction is non-covalent in nature. Stern-Volmer analysis of fluorescence quenching data shows that the fraction of fluorophore (BSA) accessible to the quencher (RF) is close to unity, indicating that both tryptophan residues of BSA are involved in the interaction. The high magnitude of rate constant for quenching kq (10(13) M(-1) s(-1) indicates that RF binding site is in close proximity to tryptophan residue of BSA. Thermodynamic parameters obtained from data at different temperatures showed that the binding of RF to BSA predominantly involves the formation of hydrophobic bonds. Binding studies in the presence of a hydrophobic probe 8-anilino-1-naphthalene sulphonic acid, sodium salt (ANS) showed that RF and ANS do not share common sites in BSA. The small decrease in critical micellar concentration of anionic surfactant, sodium dodecyl sulphate in the presence of RF shows that ionic character of RF also contributes to binding and is not solubilized inside the micelle. Significant decrease in concentration of free RF has been observed in the presence of paracetamol. The CD spectrum shows the binding of RF leads to a change in the alpha helical structure of BSA.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.     

The interaction between cholesterol and human serum albumin

The interaction between cholesterol and Human Serum Albumin (HSA) was studied by fluorescence technique. Addition of cholesterol causes decreasing of the fluorescence intensity of HSA and the mechanism can be attributed to static quenching. Both negative enthalpy and entropy change indicate this binding was an "enthalpy-driven" reaction. The number of binding site and distance between residues and ligands were also calculated: n = 0.98, r = 3.84 nm. UV-vis spectra showed HSA molecules unfolded to some extent and the hydrophobicity was decreased in the presence of cholesterol.     

Fluorescence spectrometric study on the interaction of tamibarotene with bovine serum albumin

The interaction between tamibarotene and bovine serum albumin (BSA) was studied using fluorescence quenching technique and ultraviolet–visible spectrophotometry. The results of experiments showed that tamibarotene could strongly quench the intrinsic fluorescence of BSA by a dynamic quenching mechanism. The apparent binding constant, number of binding site and corresponding thermodynamic parameters at different temperatures were calculated respectively, and the main interaction force between tamibarotene and BSA was proved to be hydrophobic force. Synchronous fluorescence spectra showed that tamibarotene changed the molecular conformation of BSA. When BSA concentration was 1.00 × 10^?6 mol L^?1, the quenched fluorescence ΔF had a good linear relationship with the concentration of tamibarotene in the range 1.00 × 10^?6 to 12.00 × 10^?6 mol L^?1 with the detection limit of 6.52 × 10^?7 mol L^?1. Copyright © 2010 John Wiley & Sons, Ltd.     

Spectroscopic study of the interaction of gossypol with bovine serum albumin

The interaction of gossypol with bovine serum albumin (BSA) at pH 7.6 in 0.02 M borax-borate buffer has been followed by circular dichroism (CD) and difference spectroscopy. From the extrinsic CD band at 390 nm, a binding constant of 2.7 X 10(3) M-1 was calculated. At 54 degrees the induced CD spectrum was abolished, suggesting that the interaction is not favoured at that temperature. The effect of various solvents and salts on the interaction has been followed by difference spectroscopy. The modification of epsilon-amino groups of lysine did not affect the interaction. Binding of gossypol to BSA does not cause a change in its secondary structure or sedimentation coefficient.     

Analysis of the calcium-dependent interaction of calmodulin with bovine serum albumin

An air-driven ultracentrifuge has been used to investigate the calcium-dependent association between calmodulin and bovine serum albumin. Procedures were described which allowed the interaction to be analyzed to yield the equilibrium constant. At low ionic strength (25 mm Tris-HCl, pH 7.5, pCa 6.68, 9°C) the equilibrium constant for the interaction was estimated to be 2.1 × 10⁴m⁻¹, while at high ionic strength (25 mm Tris-HCl, pH 7.5, 150 mm KCl, pCa 6.68, 9°C) the value was 4.5 × 10³m⁻¹. Under similar conditions, calmodulin was also found to interact with β-lactoglobulin A and gelatin, but no detectable association was observed with ovalbumin.     

Study on the interaction between isoniazid and bovine serum albumin by fluorescence spectroscopy: the effect of dimethylsulfoxide

The investigation of the binding between isoniazid (or isonicotinic acid hydrazide, INH) and serum albumin is of crucial importance to reveal the reason of resistant Mycobacterium tuberculosis strains towards INH and to increase the anti-tuberculous activity of INH. The interaction between INH and bovine serum albumin (BSA) was studied by fluorescence, UV and FT-IR spectroscopy methods. The analysis of the emission quenching at different temperatures revealed that the quenching mechanism corresponds to a static process and, as consequence; a complex INH-BSA is formed. The modified Stern-Volmer quenching constant K (a) and the corresponding thermodynamic parameters ΔH, ΔG and ΔS were calculated. The distance, r, between donor (BSA) and acceptor (INH) was calculated to be 2.14 nm based on F?rster's non-radiative energy transfer theory (FRET). The results obtained on the basis of fluorescence study of BSA solutions at the presence of dimethylsulfoxide (DMSO) were discussed in terms of the hydration properties and competitive intermolecular interactions between BSA and solvent components. The dependence of binding constant on the concentration of added DMSO as a solvent component showed non monotonous behavior. The conformational changes of BSA and its secondary structure alterations at the presence of INH were revealed.     

The subsequent effect of interaction between Co(2+) and human serum albumin or bovine serum albumin.

A notable hysteretic effect has been observed in the interaction of Co(II) with human serum albumin (HSA) or bovine serum albumin (BSA) using UV-Visible spectrometry at physiological pH (7.43), which shows that the binding between Co(II) and HSA or BSA may induce a slow transition of HSA or BSA from the conformation of weaker affinity for Co(II) to one of stronger affinity (A-B transition). The rate constants and activation parameters of this transition were measured and are discussed. It is inferred that such a conformation transition may occur due to the binding of the first Co(II) ion with the peptide segment of N-terminal residues 1-3, which results in a 'hinged movement' of the relatively hydrophobic 'valley' in the IA subdomain. This process leads to a slow conformational transition in the albumins, makes the other binding sites of Co(II) exposed, and shows a positive cooperativity effect. The LMCT (ligand-to-metal charge transition) bands of the Co(II)-HSA and Co(II)-BSA systems also show a kind of hypochromic effect featuring a dipole-dipole interaction mechanism. This phenomenon is rarely reported.     

Study on the interaction of chromate with bovine serum albumin by spectroscopic method

The interaction between two chromates [sodium chromate (Na₂CrO₄) and potassium chromate K₂CrO₄)] and bovine serum albumin (BSA) in physiological buffer (pH 7.4) was investigated by the fluorescence quenching technique. The results of fluorescence titration revealed that two chromates could strongly quench the intrinsic fluorescence of BSA through a static quenching procedure. The apparent binding constants K and number of binding sites n of chromate with BSA were obtained by the fluorescence quenching method. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) were negative, indicating that the interaction of two chromates with BSA was driven mainly by van der Waals forces and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. The distance r between donor (BSA) and acceptor (chromate) was calculated based on Forster’s non-radiative energy transfer theory. The results of UV–Vis absorption, synchronous fluorescence, three-dimensional fluorescence and circular dichroism (CD) spectra showed that two chromates induced conformational changes of BSA.     

Study on the synthesis of sulfonamide derivatives and their interaction with bovine serum albumin

Three sulfonamide derivatives (SAD) were first synthesized from p‐hydroxybenzoic acid and sulfonamides (sulfadimidine, sulfamethoxazole and sulfachloropyridazine sodium) and were characterized by elemental analysis, ¹H NMR and MS. The interaction between bovine serum albumin (BSA) and SAD was studied using UV/vis absorption spectroscopy, fluorescence spectroscopy, time‐resolved fluorescence spectroscopy and circular dichroism spectra under imitated physiological conditions. The experimental results indicated that SAD effectively quenched the intrinsic fluorescence of BSA via a static quenching process. The thermodynamic parameters showed that hydrogen bonding and van der Waal's forces were the predominant intermolecular forces between BSA and two SADs [4‐((4‐(N‐(4,6‐dimethylpyrimidin‐2‐yl)sulfamoyl)phenyl)carbamoyl)phenyl acetate and 4‐((4‐(N‐(5‐methylisoxazol‐3‐yl)sulfamoyl)phenyl)carbamoyl)phenyl acetate], but hydrophobic forces played a major role in the binding process of BSA and 4‐((4‐(N‐(6‐chloropyridazin‐3‐yl)sulfamoyl)phenyl) carbamoyl)phenyl acetate. In addition, the effect of SAD on the conformation of BSA was investigated using synchronous fluorescence spectroscopy and circular dichroism spectra. Molecular modeling results showed that SAD was situated in subdomain IIA of BSA. Copyright © 2014 John Wiley & Sons, Ltd.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Photocontrol of protein folding: the interaction of photosensitive surfactants with bovine serum albumin

The photoresponsive interaction of light-sensitive azobenzene surfactants with bovine serum albumin (BSA) at neutral pH has been investigated as a means to control protein folding with light irradiation. The cationic azobenzene surfactant undergoes a reversible photoisomerization upon exposure to the appropriate wavelength of light, with the visible-light (trans) form of the surfactant being more hydrophobic than the UV-light (cis) form. As a consequence, the trans form exhibits enhanced interaction with the protein compared to the cis form of the surfactant, allowing photoreversible control of the protein folding/unfolding phenomena. Small-angle neutron-scattering (SANS) measurements are used to provide detailed information on the protein conformation in solution. A fitting of the protein shape to a low-resolution triaxial ellipsoid model indicates that three discrete forms of the protein exist in solution depending on the surfactant concentration, with lengths of approximately 90, 150, and 250 A, respectively, consistent with additional dynamic light-scattering measurements. In addition, shape-reconstruction methods are applied to the SANS data to obtain relatively high-resolution conformation information. The results confirm that BSA adopts a heart-shaped structure in solution at low surfactant concentration, similar to the well-known X-ray crystallographic structure. At intermediate surfactant concentrations, protein elongation results as a consequence of the C-terminal portion separating from the rest of the molecule. Further increases in the surfactant concentration eventually lead to a highly elongated protein that nonetheless still exhibits some degree of folding that is consistent with the literature observations of a relatively high helical content in denatured BSA. The results clearly demonstrate that the visible-light form of the surfactant causes a greater degree of protein unfolding than the UV-light form, providing a means to control protein folding with light that, within the resolution of SANS, appears to be completely reversible.     

Probing the interaction of cephalosporin with bovine serum albumin: A structural and comparative perspective

Cephalosporins belong the largest class of antibiotics used in the treatment of a wide range of infectious diseases caused by susceptible organisms. In the present study, we chose two typical antibiotics cefalexin/cefixime based on their structure, and investigated the interaction of cephalexin/cefixime with bovine serum albumin (BSA) using UV–vis absorption spectra, fluorescence spectroscopy, circular dichroism (CD) spectroscopy and molecular modeling approaches. Spectroscopic experiments revealed the formation of a BSA ? cefalexin/cefixime complex. The binding parameters calculated using a modified Stern ? Volmer method and the Scatchard method reached 10³–10⁴ L·mol^?1. Thermodynamic parameter studies revealed that binding characteristics by negative enthalpy and positive entropy changes, and electrostatic interactions play a major role. Site marker competitive displacement experiments and molecular modeling approaches demonstrated that cefalexin and cefixime bind with appropriate affinity to site I (subdomain IIA) of BSA. Furthermore, synchronous fluorescence spectra, CD spectra and molecular modeling results indicated that the secondary structure of BSA was changed in the presence of cefalexin and cefixime. Additionally, the effects of metal ions on the BSA ? cefalexin/cefixime system were also assessed.     

Phosphatidyl choline interaction with bovine serum albumin: effect of the physical state of the lipid on protein-lipid complex formation.

Radioactively labeled [¹⁴C]phosphatidyl choline dispersed on Celite was equilibrated with bovine serum albumin solutions buffered at pH 8.0. Phosphatidyl choline was rapidly solubilized in the presence of serum albumin, and formed stable protein-lipid complexes which were isolated by gel-filtration through a Sepharose 4B column. Under similar conditions, equilibration of the protein with phosphatidyl choline liposome dispersions in buffer did not result in complex formation. The altered physical state of phosphatidyl choline on the weakly adsorbing Celite surface appears to be essential for binding by native bovine serum albumin. This work reports the first observation of phosphatidyl choline binding to native serum albumin in bulk phase and suggests the possibility of exposing monodisperse lipids, under controlled conditions, to proteins having lipid binding properties.     

Studies on the interaction between tetraphenylporphyrin compounds and bovine serum albumin.

The interaction of three porphyrin compounds with bovine serum albumin (BSA) was examined by fluorescence emission spectra at the excitation wavelength 280 nm and in UV-Vis absorption spectra. Through fluorescence quenching experiments, it was confirmed that the combination of three porphyrin compounds with BSA was a single static quenching process. The binding constant K(A), the thermodynamic parameters enthalpy change (DeltaH(0)), Gibbs free energy change (DeltaG(0)) and entropy change (DeltaS(0)) were obtained. It was found that hydrophobic interaction played a main role in tetraphenylporphyrin (TPP) or tetraparacholophenylporphyrin (TClPP) binding to BSA, while tetraparamethoxyphenylporphyrin (TMEOPP) mainly based on van der Waals' force. According to F?ster energy transfer, the separate distance r, the energy transfer efficiency E and F?ster radium R(0) were calculated. The results obtained from the above experiments showed that three porphyrin compounds were tightly bound to BSA.     

The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Characterization of the interaction between reserpine and bovine serum albumin: spectroscopic approaches

The characteristics of the interaction between reserpine and bovine serum albumin (BSA) were studied by fluorescence, UV-vis absorption and Fourier transform infrared (FT-IR) spectroscopy. Spectroscopic analysis revealed that fluorescence quenching of BSA by reserpine was through a static quenching procedure. The binding constant K(A) of reserpine with BSA at 293, 301 and 309 K was 1.63, 1.78 and 2.35 x 10(5) moL(-1) L respectively, which indicated degree of binding force between reserpine and BSA. There was one binding site between reserpine and BSA. The entropy and enthalpy changes were positive, indicating that interaction of reserpine and BSA was driven mainly by hydrophobic forces. The average binding distance between the donor (BSA) and the acceptor (reserpine) was about 3.84 nm based on the Forster non-radiation energy transfer theory. Results of synchronous fluorescence and FT-IR spectra indicated that the conformation and microenvironment of BSA were changed by the binding of reserpine. The results may provide important insights into the physiological activity of reserpine.