共查询到20条相似文献,搜索用时 31 毫秒
1.
Background
Aptamers are oligonucleotides that bind proteins and other targets with high affinity and selectivity. Twenty years ago elements of natural selection were adapted to in vitro selection in order to distinguish aptamers among randomized sequence libraries. The primary bottleneck in traditional aptamer discovery is multiple cycles of in vitro evolution.Methodology/Principal Findings
We show that over-representation of sequences in aptamer libraries and deep sequencing enables acyclic identification of aptamers. We demonstrated this by isolating a known family of aptamers for human α-thrombin. Aptamers were found within a library containing an average of 56,000 copies of each possible randomized 15mer segment. The high affinity sequences were counted many times above the background in 2–6 million reads. Clustering analysis of sequences with more than 10 counts distinguished two sequence motifs with candidates at high abundance. Motif I contained the previously observed consensus 15mer, Thb1 (46,000 counts), and related variants with mostly G/T substitutions; secondary analysis showed that affinity for thrombin correlated with abundance (Kd = 12 nM for Thb1). The signal-to-noise ratio for this experiment was roughly 10,000∶1 for Thb1. Motif II was unrelated to Thb1 with the leading candidate (29,000 counts) being a novel aptamer against hexose sugars in the storage and elution buffers for Concanavilin A (Kd = 0.5 µM for α-methyl-mannoside); ConA was used to immobilize α-thrombin.Conclusions/Significance
Over-representation together with deep sequencing can dramatically shorten the discovery process, distinguish aptamers having a wide range of affinity for the target, allow an exhaustive search of the sequence space within a simplified library, reduce the quantity of the target required, eliminate cycling artifacts, and should allow multiplexing of sequencing experiments and targets. 相似文献2.
Aptamers continue to receive interest as potential therapeutic agents for the treatment of diseases, including cancer. In order to determine whether aptamers might eventually prove to be as useful as other clinical biopolymers, such as antibodies, we selected aptamers against an important clinical target, human epidermal growth factor receptor (hEGFR). The initial selection yielded only a single clone that could bind to hEGFR, but further mutation and optimization yielded a family of tight-binding aptamers. One of the selected aptamers, E07, bound tightly to the wild-type receptor (Kd = 2.4 nM). This aptamer can compete with EGF for binding, binds to a novel epitope on EGFR, and also binds a deletion mutant, EGFRvIII, that is commonly found in breast and lung cancers, and especially in grade IV glioblastoma multiforme, a cancer which has for the most part proved unresponsive to current therapies. The aptamer binds to cells expressing EGFR, blocks receptor autophosphorylation, and prevents proliferation of tumor cells in three-dimensional matrices. In short, the aptamer is a promising candidate for further development as an anti-tumor therapeutic. In addition, Aptamer E07 is readily internalized into EGFR-expressing cells, raising the possibility that it might be used to escort other anti-tumor or contrast agents. 相似文献
3.
S. Malhotra A. K. Pandey Y. S. Rajput R. Sharma 《Journal of molecular recognition : JMR》2014,27(8):493-500
In the present work, aptamers against aflatoxin M1 and aflatoxin B1 were generated and tested for creating proof of principle of recognition of aflatoxin M1 by generated aptamers. The aptamers were selected through the process referred as systematic evolution of ligands by exponential enrichment. A total of 41 different aptamer (36 aptamers for aflatoxin M1 and 5 for aflatoxin B1) sequences were obtained. The determination of dissociation constant (Kd) values revealed that aptamers generated against aflatoxin M1 exhibited Kd values in the range of 35–1515 nM. Selected aptamers were grouped on the basis of the presence of common motifs or G‐quadruplex. We find it interesting that one aptamer with no conserved motif or G‐quadruplex had lowest Kd value (Kd = 35 nM). This structural motif is very distinct from motifs present in other aptamers. The Kd values of selected aptamers for aflatoxin B1 were in the range of 96–221 nM. One aptamer from each group was further tested for its ability to be used in aptasensor. The aptamer recognized aflatoxin M1 as indicated by color change (red to purple or blue) of aptamer‐coated gold nanoparticles in the presence of 250–500 nM aflatoxin M1. The aptamers can be used in developing methods for detection/estimation/separation of aflatoxin or antidote for aflatoxin toxicity. Copyright © 2014 John Wiley & Sons, Ltd. 相似文献
4.
O. S. Kolovskaya T. N. Zamay A. S. Zamay Y. E. Glazyrin E. A. Spivak O. A. Zubkova A. V. Kadkina E. N. Erkaev G. S. Zamay A. G. Savitskaya L. V. Trufanova L. L. Petrova M. V. Berezovski 《Biochemistry (Moscow) Supplemental Series A: Membrane and Cell Biology》2014,8(1):60-72
New prospects for the applications of single-stranded DNA and RNA as therapeutic agents have been discovered in the recent years. Aptamers are the oligonucleotides that bind to their targets with high affinity and specificity due to the well-defined tertiary structures and spatial charge distribution. Aptamers can be selected for any molecules, virus particles, bacteria, cells, and tissues. They have a wide range of applications from target identification to drug delivery. Aptamers themselves can affect various cell functions by affecting certain proteins and receptors. Here, we present the technique for selecting aptamers with antitumor activity in cancer cell cultures and identifying their target proteins by mass spectrometry analysis. The evolved aptamers showed the following antitumor properties: AS-14 (K d = 3.8 nM) induced apoptosis (phosphatidylserine translocation determined with Annexin V Alexa Fluor 488) and AS-9 (K d = 0.75 nM) stopped proliferation (as determined with CellTrace? Far Red DDAO-SE) in the culture of Ehrlich ascites adenocarcinoma cells. Using high performance liquid chromatography and high resolution tandem mass spectrometry, we have identified the proteins affected by the AS-14 and AS-9 aptamers. One of the most likely targets for AS-14 was filamin A, which is involved in metastasis formation, tumor development, and cell proliferation. According to mass spectrometry data, the AS-9 aptamer influences the α-subunit of mitochondrial ATP synthase, the key component of mitochondrial oxidative phosphorylation, stimulation of which leads to tumor growth suppression. Thus, mass spectrometry data confirmed the results of the experiments on cell cultures showing that the aptamer binding to specific protein targets causes apoptosis and stops proliferation of cancer cells. However, the mechanisms of action of aptamers in vitro and in vivo are not clear enough and still need to be determined. Our study opens up new possibilities for creation of non-toxic drugs based on DNA aptamers for targeted anticancer therapy. 相似文献
5.
R Pardoux S Sauge-Merle D Lemaire P Delangle L Guilloreau JM Adriano C Berthomieu 《PloS one》2012,7(8):e41922
To improve our understanding of uranium toxicity, the determinants of uranyl affinity in proteins must be better characterized. In this work, we analyzed the contribution of a phosphoryl group on uranium binding affinity in a protein binding site, using the site 1 EF-hand motif of calmodulin. The recombinant domain 1 of calmodulin from A. thaliana was engineered to impair metal binding at site 2 and was used as a structured template. Threonine at position 9 of the loop was phosphorylated in vitro, using the recombinant catalytic subunit of protein kinase CK2. Hence, the T9TKE12 sequence was substituted by the CK2 recognition sequence TAAE. A tyrosine was introduced at position 7, so that uranyl and calcium binding affinities could be determined by following tyrosine fluorescence. Phosphorylation was characterized by ESI-MS spectrometry, and the phosphorylated peptide was purified to homogeneity using ion-exchange chromatography. The binding constants for uranyl were determined by competition experiments with iminodiacetate. At pH 6, phosphorylation increased the affinity for uranyl by a factor of ∼5, from Kd = 25±6 nM to Kd = 5±1 nM. The phosphorylated peptide exhibited a much larger affinity at pH 7, with a dissociation constant in the subnanomolar range (Kd = 0.25±0.06 nM). FTIR analyses showed that the phosphothreonine side chain is partly protonated at pH 6, while it is fully deprotonated at pH 7. Moreover, formation of the uranyl-peptide complex at pH 7 resulted in significant frequency shifts of the νas(P-O) and νs(P-O) IR modes of phosphothreonine, supporting its direct interaction with uranyl. Accordingly, a bathochromic shift in νas(UO2)2+ vibration (from 923 cm−1 to 908 cm−1) was observed upon uranyl coordination to the phosphorylated peptide. Together, our data demonstrate that the phosphoryl group plays a determining role in uranyl binding affinity to proteins at physiological pH. 相似文献
6.
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (Kd [kanamycin] = 78.8 nM, Kd [kanamycin B] = 84.5 nM, and Kd [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. 相似文献
7.
Nuo Duan Xiaoying DingShijia Wu Yu XiaXiaoyuan Ma Zhouping WangJie Chen 《Journal of microbiological methods》2013
To identify DNA aptamers demonstrating binding specificity for Shigella dysenteriae, a whole-bacterium Systemic Evolution of Ligands by Exponential enrichment (SELEX) method was applied to a combinatorial library of single-stranded DNA (ssDNA) molecules. After several rounds of selection using S. dysenteriae as the target, the highly enriched oligonucleotide pool was sequenced and then grouped into different families based on primary sequence homologies and similarities in the secondary structures. Aptamer S 1, which showed particularly high binding affinity in preliminary studies, was chosen for further characterisation. This aptamer displayed a dissociation constant (Kd value) of 23.47 ± 2.48 nM. Binding assays to assess the specificity of aptamer S 1 showed high binding affinity for S. dysenteriae and low apparent binding affinity for other bacteria. The ssDNA aptamers generated may serve as a new type of molecular probe for microbial pathogens, as it has the potential to overcome the tedious isolation and purification requirements for complex targets. 相似文献
8.
This study describes the development of aptamers as a therapy against influenza virus infection. Aptamers are oligonucleotides (like ssDNA or RNA) that are capable of binding to a variety of molecular targets with high affinity and specificity. We have studied the ssDNA aptamer BV02, which was designed to inhibit influenza infection by targeting the hemagglutinin viral protein, a protein that facilitates the first stage of the virus’ infection. While testing other aptamers and during lead optimization, we realized that the dominant characteristics that determine the aptamer’s binding to the influenza virus may not necessarily be sequence-specific, as with other known aptamers, but rather depend on general 2D structural motifs. We adopted QSAR (quantitative structure activity relationship) tool and developed computational algorithm that correlate six calculated structural and physicochemical properties to the aptamers’ binding affinity to the virus. The QSAR study provided us with a predictive tool of the binding potential of an aptamer to the influenza virus. The correlation between the calculated and actual binding was R2 = 0.702 for the training set, and R2 = 0.66 for the independent test set. Moreover, in the test set the model’s sensitivity was 89%, and the specificity was 87%, in selecting aptamers with enhanced viral binding. The most important properties that positively correlated with the aptamer’s binding were the aptamer length, 2D-loops and repeating sequences of C nucleotides. Based on the structure-activity study, we have managed to produce aptamers having viral affinity that was more than 20 times higher than that of the original BV02 aptamer. Further testing of influenza infection in cell culture and animal models yielded aptamers with 10 to 15 times greater anti-viral activity than the BV02 aptamer. Our insights concerning the mechanism of action and the structural and physicochemical properties that govern the interaction with the influenza virus are discussed. 相似文献
9.
Two DNA aptamers against a tumor marker protein, human vascular endothelial growth factor (VEGF165) were identified. In the screening process, another protein was used as the competitor to isolate those aptamers that have
high specificity for the target. In addition, we evaluated the affinities of the enriched library by means of aptamer blotting.
The isolated aptamers bound to VEGF165 with a K
d value in the range of a few hundred nanomoles, and did not bind to the competitor. This selection method enabled us to efficiently
select the specific aptamers against the target protein. These specific aptamers would be useful sensor elements for cancer
diagnosis. 相似文献
10.
NADPH-cytochrome P450 oxidoreductase (CPR) plays a central role in chemical
detoxification and insecticide resistance in Anopheles gambiae,
the major vector for malaria. Anopheles gambiae CPR (AgCPR) was
initially expressed in Eschericia coli but failed to bind
2′, 5′-ADP Sepharose. To investigate this unusual trait, we
expressed and purified a truncated histidine-tagged version for side-by-side
comparisons with human CPR. Close functional similarities were found with
respect to the steady state kinetics of cytochrome c reduction,
with rates (k
cat) of 105
s−1 and 88 s−1, respectively, for mosquito
and human CPR. However, the inhibitory effects of 2′,5′-ADP on
activity were different; the IC50 value of AgCPR for 2′,
5′ –ADP was significantly higher (6–10 fold) than human CPR
(hCPR) in both phosphate and phosphate-free buffer, indicative of a decrease in
affinity for 2′, 5′- ADP. This was confirmed by isothermal titration
calorimetry where binding of 2′,5′-ADP to AgCPR
(K
d = 410±18 nM) was
∼10 fold weaker than human CPR
(K
d = 38 nM). Characterisation
of the individual AgFMN binding domain revealed much weaker binding of FMN
(Kd = 83±2.0 nM) than the equivalent
human domain (Kd = 23±0.9 nM).
Furthermore, AgCPR was an order of magnitude more sensitive than hCPR to the
reductase inhibitor diphenyliodonium chloride
(IC50 = 28 µM±2 and 361±31
µM respectively). Taken together, these results reveal unusual biochemical
differences between mosquito CPR and the human form in the binding of small
molecules that may aid the development of ‘smart’ insecticides and
synergists that selectively target mosquito CPR. 相似文献
11.
By using the in vitro selection method SELEX against the complex mixture of GLA proteins and utilizing methods to deconvolute the resulting ligands, we were able to successfully generate 2'-ribo purine, 2'-fluoro pyrimidine aptamers to various individual targets in the GLA protein proteome that ranged in concentration from 10 nM to 1.4 microM in plasma. Perhaps not unexpectedly, the majority of the aptamers isolated following SELEX bind the most abundant protein in the mixture, prothrombin (FII), with high affinity. We show that by deselecting the dominant prothrombin aptamer the selection can be redirected. By using this DeSELEX approach, we were able to shift the selection toward other sequences and to less abundant protein targets and obtained an aptamer to Factor IX (FIX). We also demonstrate that by using an RNA library that is focused around a proteome, purified protein targets can then be used to rapidly generate aptamers to the protein targets that are rare in the initial mixture such as Factor VII (FVII) and Factor X (FX). Moreover, for all four proteins targeted (FII, FVII, FIX, and FX), aptamers were identified that could inhibit the individual protein's activitity in coagulation assays. Thus, by applying the concepts of DeSELEX and focused library selection, aptamers specific for any protein in a particular proteome can theoretically be generated, even when the proteins in the mixture are present at very different concentrations. 相似文献
12.
A growing number of RNA aptamers have been selected experimentally using the SELEX combinatorial approach, and these aptamers
have several advantages over monoclonal protein antibodies or peptides with respect to their applications in medicine and
nanobiotechnology. Relatively few successful selections have been reported for membrane molecular targets, in contrast to
the situation with non-membrane molecular targets. This review compares the procedures and techniques used in selections against
membrane proteins and membrane lipids. In the case of membrane proteins, the selections were performed against soluble protein
fragments, detergent-membrane protein mixed micelles, whole cells, vesicles derived from cellular membranes, and enveloped
viruses. Liposomes were used as an experimental system for the selection of aptamers against membrane lipids. RNA structure-dependent
aptamer binding for rafts in lipid vesicles was reported. Based on the selected aptamers against DOPC and the amino acid tryptophan,
a specific passive membrane transporter composed of RNA was constructed. The determination of the selectivity of aptamers
appears to be a crucial step in a selection, but has rarely been fully investigated. The selections, which use whole cells
or vesicles derived from membranes, can yield aptamers not only against proteins but also against membrane lipids. 相似文献
13.
Deng-Liang Wang Yan-Ling Song Zhi Zhu Xi-Lan Li Yuan Zou Hai-Tao Yang Jiang-Jie Wang Pei-Sen Yao Ru-Jun Pan Chaoyong James Yang De-Zhi Kang 《Biochemical and biophysical research communications》2014
Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. 相似文献
14.
Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr‐activated sepharose‐4B affinity chromatography
下载免费PDF全文
![点击此处可从《Journal of molecular recognition : JMR》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Mojtaba Hedayati Ch Jafar Amani Hamid Sedighian Mohsen Amin Jafar Salimian Raheleh Halabian Abbas Ali Imani Fooladi 《Journal of molecular recognition : JMR》2016,29(9):436-445
Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA‐aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd = 2.3 × 10?11). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. 相似文献
15.
Kazem Mashayekhi Mojtaba Sankian Saeed Mohammadian Haftcheshmeh Ramezan Ali Taheri Kazem Hassanpour Gholamreza Farnoosh 《Biotechnology progress》2021,37(5):e3191
To increase the efficiency of aptamers to their targets, a simple and novel method has been developed based on aptamer oligomerization. To this purpose, previously anti-human TNF-α aptamer named T1–T4 was trimerized through a trimethyl aconitate core for neutralization of in vitro and in vivo of TNF-α. At first, 54 mer T1–T4 aptamers with 5′-NH2 groups were covalently coupled to three ester residues in the trimethyl aconitate. In vitro activity of novel anti-TNF-α aptamer and its dissociation constant (Kd) was done using the L929 cell cytotoxicity assay. In vivo anti-TNF-α activity of new oligomerized aptamer was assessed in a mouse model of cutaneous Shwartzman. Anchoring of three T1–T4 aptamers to trimethyl aconitate substituent results in formation of the 162 mer fragment, which was well revealed by gel electrophoresis. In vitro study indicated that the trimerization of T1–T4 aptamer significantly improved its anti-TNF-α activity compared to non-modified aptamers (P < 0.0001) from 40% to 60%. The determination of Kd showed that trimerization could effectively enhance Kd of aptamer from 67 nM to 36 nM. In vivo study showed that trimer aptamer markedly reduced mean scar size from 15.2 ± 1.2 mm to 1.6 ± 0.1 mm (P < 0.0001), which prevent the formation of skin lesions. In vitro and in vivo studies indicate that trimerization of anti-TNF-α aptamer with a novel approach could improve the anti-TNF-α activity and therapeutic efficacy. According to our findings, a new anti-TNF-α aptamer described here could be considered an appropriate therapeutic agent in treating several inflammatory diseases. 相似文献
16.
There is a consistent demand for new biosensors for the detection of protein targets, and a systematic method for the rapid development of new sensors is needed. Here we present a platform where short unstructured peptides that bind to a desired target are selected using M13 phage display. The selected peptides are then chemically synthesized and immobilized on gold, allowing for detection of the target using electrochemical techniques such as electrochemical impedance spectroscopy (EIS). A quartz crystal microbalance (QCM) is also used as a diagnostic tool during biosensor development. We demonstrate the utility of this approach by creating a novel peptide-based electrochemical biosensor for the enzyme alanine aminotransferase (ALT), a well-known biomarker of hepatotoxicity. Biopanning of the M13 phage display library over immobilized ALT, led to the rapid identification of a new peptide (ALT5-8) with an amino acid sequence of WHWRNPDFWYLK. Phage particles expressing this peptide exhibited nanomolar affinity for immobilized ALT (Kd,app = 85±20 nM). The newly identified ALT5-8 peptide was then chemically synthesized with a C-terminal cysteine for gold immobilization. The performance of the gold-immobilized peptides was studied with cyclic voltammetry (CV), QCM, and EIS. Using QCM, the sensitivity for ALT detection was 8.9±0.9 Hz/(µg/mL) and the limit of detection (LOD) was 60 ng/mL. Using EIS measurements, the sensitivity was 142±12 impedance percentage change %/(µg/mL) and the LOD was 92 ng/mL. In both cases, the LOD was below the typical concentration of ALT in human blood. Although both QCM and EIS produced similar LODs, EIS is preferable due to a larger linear dynamic range. Using QCM, the immobilized peptide exhibited a nanomolar dissociation constant for ALT (Kd = 20.1±0.6 nM). These results demonstrate a simple and rapid platform for developing and assessing the performance of sensitive, peptide-based biosensors for new protein targets. 相似文献
17.
Background
Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period.Principal Findings
Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM.Conclusion
We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers. 相似文献18.
Multivalent molecular interactions can be exploited to dramatically enhance the performance of an affinity reagent. The enhancement in affinity and specificity achieved with a multivalent construct depends critically on the effectiveness of the scaffold that joins the ligands, as this determines their positions and orientations with respect to the target molecule. Currently, no generalizable design rules exist for construction of an optimal multivalent ligand for targets with known structures, and the design challenge remains an insurmountable obstacle for the large number of proteins whose structures are not known. As an alternative to such design-based strategies, we report here a directed evolution-based method for generating optimal bivalent aptamers. To demonstrate this approach, we fused two thrombin aptamers with a randomized DNA sequence and used a microfluidic in vitro selection strategy to isolate scaffolds with exceptionally high affinities. Within five rounds of selection, we generated a bivalent aptamer that binds thrombin with an apparent dissociation constant (Kd) <10 pM, representing a ∼200-fold improvement in binding affinity over the monomeric aptamers and a ∼15-fold improvement over the best designed bivalent construct. The process described here can be used to produce high-affinity multivalent aptamers and could potentially be adapted to other classes of biomolecules. 相似文献
19.
Agnes Cibiel Nam Nguyen Quang Karine Gombert Benoit Thézé Anikitos Garofalakis Frédéric Ducongé 《PloS one》2014,9(1)
Background
Cell-SELEX is now widely used for the selection of aptamers against cell surface biomarkers. However, despite negative selection steps using mock cells, this method sometimes results in aptamers against undesirable targets that are expressed both on mock and targeted cells. Studying these junk aptamers might be useful for further applications than those originally envisaged.Methodology/Principal Findings
Cell-SELEX was performed to identify aptamers against CHO-K1 cells expressing human Endothelin type B receptor (ETBR). CHO-K1 cells were used for negative selection of aptamers. Several aptamers were identified but no one could discriminate between both cell lines. We decided to study one of these aptamers, named ACE4, and we identified that it binds to the Annexin A2, a protein overexpressed in many cancers. Radioactive binding assays and flow cytometry demonstrated that the aptamer was able to bind several cancer cell lines from different origins, particularly the MCF-7 cells. Fluorescence microscopy revealed it could be completely internalized in cells in 2 hours. Finally, the tumor targeting of the aptamer was evaluated in vivo in nude mice xenograft with MCF-7 cells using fluorescence diffuse optical tomography (fDOT) imaging. Three hours after intravenous injection, the aptamer demonstrated a significantly higher uptake in the tumor compared to a scramble sequence.Conclusions/Significance
Although aptamers could be selected during cell-SELEX against other targets than those initially intended, they represent a potential source of ligands for basic research, diagnoses and therapy. Here, studying such aptamers, we identify one with high affinity for Annexin A2 that could be a promising tool for biomedical application. 相似文献20.
We developed a method for aptamer identification without in vitro selection. We have previously obtained several aptamers, which may fold into the G-quadruplex (G4) structure, against target proteins; therefore, we hypothesized that the G4 structure would be an excellent scaffold for aptamers to recognize the target protein. Moreover, the G4-forming sequence contained in the promoter region of insulin can reportedly bind to insulin. We thus expected that G4 DNAs, which are contained in promoter regions, could act as DNA aptamers against their gene products. We designated this aptamer identification method as “G4 promoter-derived aptamer selection (G4PAS).” Using G4PAS, we identified vascular endothelial growth factor (VEGF)165, platelet-derived growth factor-AA (PDGF)-AA, and RB1 DNA aptamers. Surface plasmon resonance (SPR) analysis revealed that the dissociation constant (K
d) values of VEGF165, PDGF-AA, and RB1 DNA aptamers were 1.7 × 10−7 M, 6.3 × 10−9 M, and 4.4 × 10−7 M, respectively. G4PAS is a simple and rapid method of aptamer identification because it involves only binding analysis of G4 DNAs to the target protein. In the human genome, over 40% of promoters contain one or more potential G4 DNAs. G4PAS could therefore be applied to identify aptamers against target proteins that contain G4 DNAs on their promoters. 相似文献