共查询到20条相似文献,搜索用时 15 毫秒
1.
Infection of tobacco by tobacco mosaic virus (TMV) induces coordinate expression of genes encoding acidic and basic -1,3-glucanase isoforms. These genes are differentially expressed in response to other treatments. Salicylate treatment induces acidic glucanase mRNA to a higher level than basic glucanase mRNA. Ethylene treatment and wounding strongly induce the basic glucanase genes but have little effect on genes encoding the acidic isoforms. Furthermore, the basic glucanase genes are constitutively expressed in roots and lower leaves of healthy plants, whereas the acidic glucanase genes are not. In order to investigate how these expression patterns are established, we fused promoter regions of an acidic and a basic glucanase gene to the -glucuronidase (GUS) reporter gene and examined expression of these constructs in transgenic tobacco plants.A fragment of 1750 bp and two 5-truncated fragments of 650 bp and 300 bp of the acidic glucanase promoter were tested for induction of GUS gene expression after salicylate treatment and TMV infection. Upstream sequences of 1750 bp and 650 bp were sufficient for induction of the reporter gene by salicylate treatment and TMV infection, but the activity of the 300 bp fragment was strongly reduced. The results suggest that the 1750 bp upstream sequence of the acidic glucanase gene contains multiple regulatory elements.For the basic glucanase promoter it is shown that 1476 bp of upstream sequences were able to drive expression in response to TMV infection and ethylene treatment, but no response was found to incision wounding. Furthermore, high GUS activity was found in lower leaves and roots of healthy transgenic plants, carrying the 1476 bp basic glucanase promoter/GUS construct. When the promoter was truncated up to position –446 all activity was lost, indicating that the region between –1476 and –446 of the basic glucanase promoter is necessary for organ-specific and developmentally regulated expression as well as for induced expression in response to infection and other stress treatments. 相似文献
2.
S. Nakamura S. Asakawa N. Ohmido K. Fukui N. Shimizu S. Kawasaki 《Molecular genetics and genomics : MGG》1997,254(6):611-620
We constructed a rice Bacterial Artificial Chromosome (BAC) library from green leaf protoplasts of the cultivar Shimokita harboring the rice blast resistance gene Pi-ta. The average insert size of 155 kb and the library size of seven genome equivalents make it one of the most comprehensive BAC libraries available, and larger than many plant YAC libraries. The library clones were plated on seven high density membranes of microplate size, enabling efficient colony identification in colony hybridization experiments. Seven percent of clones carried chloroplast DNA. By probing with markers close to the blast resistance genes Pi-ta 2 (closely linked to Pi-ta) and Pi-b, respectively located in the centromeric region of chromosome 12 and near the telomeric end of chromosome 2, on average 2.2?±?1.3 and 8.0?±?2.6 BAC clones/marker were isolated. Differences in chromosomal structures may contribute to this wide variation in yield. A contig of about 800 kb, consisting of 19 clones, was constructed in the Pi-ta 2 region. This region had a high frequency of repetitive sequences. To circumvent this difficulty, we devised a “two-step walking” method. The contig spanned a 300 kb region between markers located at 0 cM and 0.3 cM from Pi-ta 2 . The ratio of physical to genetic distances (>?1,000 kb/cM) was more than three times larger than the average of rice (300 kb/cM). The low recombination rate and high frequency of repetitive sequences may also be related to the near centromeric character of this region. Fluorescent in situ hybridization (FISH) with a BAC clone from the Pi-b region yielded very clear signals on the long arm of chromosome 2, while a clone from the Pi-ta 2 region showed various cross-hybridizing signals near the centromeric regions of all chromosomes. 相似文献
3.
Mapping of four major rice blast resistance genes from ’Lemont’ and ’Teqing’ and evaluation of their combinatorial effect for field resistance 总被引:1,自引:0,他引:1
R. E. Tabien Z. Li A. H. Paterson M. A. Marchetti J. W. Stansel S. R. M. Pinson W. D. Park 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》2000,101(8):1215-1225
A framework linkage map was developed using 284 F10 recombinant inbred lines (RILs) from a ’Lemont’×’Teqing’ rice cultivar cross. Evaluation of a subset of 245 of these RILs
with five races of the rice blast pathogen permitted RFLP mapping of three major resistance genes from Teqing and one major
gene from Lemont. All mapped genes were found to confer resistance to at least two blast races, but none conferred resistance
to all five races evaluated. RFLP mapping showed that the three resistance genes from Teqing, designated Pi-tq5, Pi-tq1 and Pi-tq6, were present on chromosomes 2, 6 and 12, respectively. The resistance gene from Lemont, Pi-lm2, was located on chromosome 11. Pi-tq1 is considered a new gene, based on its reaction to these five races and its unique map location, while the other three genes
may be allelic with previously reported genes. Lines with different gene combinations were evaluated for disease reaction
in field plots. Some gene combinations showed both direct effects and non-linear interaction. The fact that some of the lines
without any of the four tagged genes exhibited useful levels of resistance in the field plots suggests the presence of additional
genes or QTLs affecting the blast reaction segregating in this population.
Received: 16 December 1999 / Accepted: 28 February 2000 相似文献
4.
5.
6.
7.
Steady-state levels of mRNA from individual -amylase genes were measured in the embryo and aleurone tissues of rice (Oryza sativa) and two varieties of barley (Hordeum vulgare L. cv. Himalaya and cv. Klages) during germination. Each member of the -amylase multigene families of rice and barley was differentially expressed in each tissue. In rice, -amylase genes displayed tissue-specific expression in which genes RAmy3B, RAmy3C, and RAmy3E were preferentially expressed in the aleurone layer, genes RAmy1A, RAmy1B and RAmy3D were expressed in both the embryo and aleurone, and genes RAmy3A and RAmy2A were not expressed in either tissue. Whenver two or more genes were expressed in any tissue, the rate of mRNA accumulation from each gene was unique. In contrast to rice, barley -amylase gene expression was not tissue-specific. Messenger RNAs encoding low- and high-pI -amylase isozymes were detectable in both the embryo and aleurone and accumulated at different rates in each tissue. In particular, peak levels of mRNA encoding high-pI -amylases always preceded those encoding low-pI -amylases. Two distinct differences in -amylase gene expression were observed between the two barley varieties. levels of high-pI -amylase mRNA peaked two days earlier in Klages embryos than in Himalaya embryos. Throughout six days of germination, Klages produced three times as much high-pI -amylase mRNA and nearly four times as much low-pI -amylase mRNA than the slower-germinating Himalaya variety. 相似文献
8.
Paul J. Rushton Heather Macdonald Alison K. Huttly Colin M. Lazarus Richard Hooley 《Plant molecular biology》1995,29(4):691-702
The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. 相似文献
9.
The thyroid cancer data of children in the northern regions of the Ukraine after the reactor accident at Chernobyl were combined
with thyroid dose measurements in the same regions and analysed using a two- mutation carcinogenesis model. The best fit was
obtained for radiation acting as an initiating agent, i.e. on the first mutation of the model. The observed relatively high
increase of thyroid cancer incidence after 1990 in children exposed to radiation released after the reactor accident could
be ascribed to the high thyroid doses and the relatively low background thyroid cancer incidence in children. The maximum
annual incidence is predicted to occur fairly soon after the reactor accident, i.e. about 10 years. For adults, the predicted
relative increase of annual thyroid cancers is much lower than for children younger than 20 years. The modelling results are
used to derive risk estimates for radiation-induced thyroid cancer. These risk estimates are dependent on age at exposure,
follow-up time and the background thyroid cancer incidence. The calculated excess absolute risk for a population of all ages
is about one-third of that currently used by ICRP, but for children the calculated absolute risks are about a factor of 3
higher than derived in other epidemiological studies. The model results indicate that the excess absolute radiation risk per
unit dose for children is about the same as or a little lower than that for adults.
Received: 11 May 1999 / Accepted: 30 December 1999 相似文献
10.
11.
Recently, the CRISPR/Cas9 system has been used as a powerful tool for genome editing in many species (Jinek et al., 2012;Cong et al., 2013;Wright et al., 2016;Li et al., 2017;Deng et al., 2018). The CR1SPR/Cas9 system can not only be used as a useful technology to disrupt endogenous genes but also expand numerous other applications, such as precise base editing (Komor et al., 2016;Zong et al., 2017), regulation of gene expression (Gilbert et al., 2013), and gene replacement or insertion (Wang et al., 2017). 相似文献
12.
Jia Zhou Chenfei Ma Honglin Xu Kailong Yuan Xin Lu Zhen Zhu Yongning Wu Guowang Xu 《Journal of chromatography. B, Analytical technologies in the biomedical and life sciences》2009,877(8-9):725-732
The cryIAc and sck genes were introduced to the rice for the purpose of improving the insect resistance. Metabolic profiles of wild and transgenic rice were compared to assess the unintended effects related to gene modification. Wild samples with different sowing dates or sites were also examined to determine the environmental effects on metabolites. The polar compounds of grains were extracted, trimethylsilylated and analyzed by gas chromatography-flame ionization detection (GC-FID). Partial least squares-discriminant analysis (PLS-DA) and principal component analysis (PCA) were applied to differentiate transgenic and wild rice grains. The significantly distinguishable metabolites were picked out, and then identified by gas chromatography–mass spectrometry (GC–MS). It was found that both the environment and gene manipulation had remarkable impacts on the contents of glycerol-3-phosphate, citric acid, linoleic acid, oleic acid, hexadecanoic acid, 2,3-dihydroxypropyl ester, sucrose, 9-octadecenoic acid (Z)-, 2,3-dihydroxypropyl ester and so on. Sucrose, mannitol and glutamic acid had a significant increase in transgenic grains in contrast to those in non-genetically modified (GM) rice. 相似文献
13.
14.
15.
Summary Simultaneous production of endoglucanase and -glucosidase by using a synthetic two cistron system inEscherichia coli was attempted as a possible way of reducing production cost. The first cistron in this system we constructed is an endoglucanase gene fused to a tac promoter that provides for efficient expression. The second cistron is a -glucosidase structural gene. A ribosome binding site sequence of 33-base was inserted between the two cistron genes.E. coli cells transformed with the system produced 12.4 units/mg protein of endoglucanase and 327 units/mg protein of -glucosidase, which represent 15% and 22% of total cellular protein, respectively, in L medium within three hours after induction with IPTG. 相似文献
16.
17.
18.
Yutaka Nakachi Itoshi Nikaido Mio Tonouchi Yasushi Okazaki 《Biochemical and biophysical research communications》2008,372(2):362-366
PPARγ (peroxisome proliferator-activated receptor gamma) acts as a key molecule of adipocyte differentiation, and transactivates multiple target genes involved in lipid metabolic pathways. Identification of PPARγ target genes will facilitate to predict the extent to which the drugs can affect and also to understand the molecular basis of lipid metabolism. Here, we have identified five target genes regulated directly by PPARγ during adipocyte differentiation in 3T3-L1 cells using integrated analyses of ChIP-on-chip and expression microarray. We have confirmed the direct PPARγ regulation of five genes by luciferase reporter assay in NIH-3T3 cells. Of these five genes Hp, Tmem143 and 1100001G20Rik are novel PPARγ targets. We have also detected PPREs (PPAR response elements) sequences in the promoter region of the five genes computationally. Unexpectedly, most of the PPREs detected proved to be atypical, suggesting the existence of more atypical PPREs than previously thought in the promoter region of PPARγ regulated genes. 相似文献
19.
Anil Kumar S. B. Katti H. Rosemeyer Frank Seela 《Nucleosides, nucleotides & nucleic acids》2013,32(10):1595-1601
Abstract The results of PMR studies on 3′Deoxyribo nucleosides (1a-d) reveals that the sugar puckering is predominantly in N state with g+ conformation of the 5′-CH2OH group. Except in 1a, nucleobases in other nucleosides favour anti conformation. 相似文献
20.
Three starch synthase (SS) genes, OsSSII-1, OsSSII-2 and OsSSII-3, were identified in rice (Oryza sativa L.) and localized to chromosomes 10, 2 and 6, respectively. The three OsSSII full-length cDNAs were cloned, and the predicted amino acid sequences were found to share 52–73% similarity with other members of the plant SSII family. The SS activity of each OsSSII was confirmed by expression and enzyme activity assay in Escherichia coli. Expression profile analysis revealed that OsSSII-1 was expressed in endosperms, leaves and roots; OsSSII-2 was mainly expressed in leaves, while OsSSII-3 was mainly expressed in endosperms. Similar to the OsSSI proteins, the OsSSII-2 and OsSSII-3 proteins were found in the soluble as well as the starch-granule-bound fractions in rice. The roles of the OsSSII proteins in starch biosynthesis in rice and the evolutionary relationships of the genes encoding monocotyledonous and dicotyledonous class-II SS enzymes are discussed.Abbreviations
CDS
Coding domain sequence
-
EST
Expressed sequence tag
- GB
Granule-bound
- Glc
Glucose
-
SS
Starch synthase 相似文献