Mutagenicity in lung of Big Blue mice and induction of tandem-base substitutions in Salmonella by the air pollutant peroxyacetyl nitrate (PAN): predicted formation of intrastrand cross-links

Peroxyacetyl nitrate (PAN) is a ubiquitous air pollutant formed from NO₂ reacting with acetoxy radicals generated from ambient aldehydes in the presence of sunlight and ozone. It contributes to eye irritation associated with photochemical smog and is present in most urban air. PAN was generated in a chamber containing open petri dishes of Salmonella TA100 (gas-phase exposure). After subtraction of the background mutation spectrum, the spectrum of PAN-induced mutants selected at 3.1-fold above the background mutant yield was 59% GC→TA, 29% GC→AT, 2% GC→CG, and 10% multiple mutations — primarily GG→TT tandem-base substitutions. Using computational molecular modeling methods, a mechanism was developed for producing this unusual tandem-base substitution. The mechanism depends on the protonation of PAN near the polyanionic DNA to release NO₂⁺ resulting in intrastrand dimer formation. Insertion of AA opposite the dimerized GG would account for the tandem GG→TT transversions. Nose-only exposure of Big Blue^® mice to PAN at 78 ppm (near the MTD) was mutagenic at the lacI gene in the lung (mutant frequency ±S.E. of 6.16±0.58/10⁵ for controls versus 8.24±0.30/10⁵ for PAN, P=0.016). No tandem-base mutations were detected among the 40 lacI mutants sequenced. Dosimetry with ³H-PAN showed that 24 h after exposure, 3.9% of the radiolabel was in the nasal tissue, and only 0.3% was in the lung. However, based on the molecular modeling considerations, the labeled portion of the molecule would not have been expected to have been bound covalently to DNA. Our results indicate that PAN is weakly mutagenic in the lungs of mice and in Salmonella and that PAN produces a unique signature mutation (a tandem GG→TT transversion) in Salmonella that is likely due to a GG intrastrand cross-link. Thus, PAN may pose a mutagenic and possible carcinogenic risk to humans, especially at the high concentrations at which it is present in some urban environments.     

A physiological and morphological study on the injury caused by exposure to the air pollutant,peroxyacetyl nitrate (PAN), based on the quantitative assessment of the injury

A method for the numerical assessment of the foliar injury caused by the photochemical oxidant, peroxyacetyl nitrate (PAN), was devised, using three injury indices: fresh weight (FW) loss, decreased photosynthetic pigment content, and increased ion leakage, which can be measured using the same leaves. The injury indices clearly indicated a larger number of PAN-sensitive leaves and a more severe level of injury in the PAN-sensitive variety of Petunia hybrida, White Champion (WHITE), compared to the PAN-tolerant variety, Blue Champion (BLUE). FW and photosynthetic pigment content decreased correlatively in both varieties, but ion leakage increased only in WHITE. Morphological observations revealed that ion leakage started concurrently with the start of plasmolysis-like symptoms at the mesophyll cells of injured WHITE leaves, whereas FW loss corresponded to the shrinkage of cells without loss of their round shape in BLUE leaves. PAN injuries measured by the injury indices were markedly increased in the presence of light, and the morphological changes following PAN exposure were similar to those caused by the superoxide-generating chemical, paraquat. The results suggested that PAN injuries indicated by the three injury indices are all light-dependent, but are caused through several independent mechanisms.     

Cytogenetic analyses of the in vitro and in vivo responses of murine cells to peroxyacetyl nitrate (PAN)

Peroxyacetyl nitrate (PAN) is one of a class of common air pollutant formed by the action of sunlight on volatile organic compounds and nitrogen oxides. PAN has been shown to be a bacterial mutagen. To determine if PAN can cause DNA damage in mammalian cells, we exposed murine peripheral blood lymphocytes (PBLs) to various volumes of PAN in vitro and analyzed the cells for chromosome aberrations (CAs), sister chromatid exchanges (SCEs), and DNA damage using the single cell gel (SCG) assay. At in vitro concentrations of PAN that were cytotoxic (inhibited cell division), an increase in DNA damage was noted in the SCG assay. At lower exposure levels that permitted cell division, no increases in SCEs, CAs, or DNA damage were evident. For in vivo studies, male mice were exposed nose-only by inhalation for 1 h to 0, 15, 39 or 78 ppm PAN, and their lung cells removed and cultured for the scoring of SCEs and CAs. In addition, PBLs and lung cells were analyzed by the SCG assay. No dose-related effects were found in any of the assays. These data indicate that PAN does not appear to be a potent clastogen or DNA damaging agent in mammalian cells in vivo or in vitro.     

Micronuclei and gene mutations in transgenic big Blue((R)) mouse and rat fibroblasts after exposure to the epoxide metabolites of 1, 3-butadiene

1,3-Butadiene (BD) is a commodity compound and by-product in the manufacture of synthetic rubber that elicits a differential carcinogenic response in rodents after chronic exposure. Mice are up to approximately 1000-fold more sensitive to the tumorigenicity of inhaled BD than rats, thereby confounding human risk assessment analyses. Rodent transgenic in vivo and in vitro models have been recently utilized for generating genetic toxicology data in support of risk assessment studies. However, studies have not been extended to investigate multiple endpoints of genetic damage using in vitro transgenic models. The goal of this study was to evaluate possible differences in the production of genetic damage in transgenic Big Blue((R)) mouse (BBM1) and rat (BBR1) fibroblasts exposed to three predominant epoxide metabolites of BD. Analyses of cytotoxicity, micronucleus (MN) formation, cII mutant frequency (MF) and apoptosis were assessed after in vitro exposure of BBM1 and BBR1 cells exposed to various concentrations of butadiene monoepoxide (BMO), diepoxybutane (DEB) and butadiene diolepoxide (BDE). Both BMO and DEB reduced cell survival in BBM1 and BBR1 cells. However, BDE decreased cell survival only in BBM1 cells at the concentrations evaluated. Concentration-dependent increases in the formation of MN was observed in both BBM1 and BBR1 cells, with DEB being the most potent followed by BDE and then BMO. The dose-response for mutations induced at the cII locus was essentially equal after DEB exposure of BBM1 and BBR1 fibroblasts. In contrast, the cII MF was significantly increased only in BBM1 cells after exposure to either BMO or BDE. These data demonstrate a differential genetic response for gene mutations but not for MN formation in transgenic BBM1 and BBR1 fibroblasts and suggest a rodent species-specific difference in the persistence of DNA damage that results in gene mutations. In addition, apoptosis was observed in BBR1 cells but not in BBM1 cells when treated with any of the three BD epoxide metabolites. This response may partially explain the differential response to mutations induced by BMO and BDE. These data offer insight into specific differences in mouse and rat cells with respect to their response to BD epoxide metabolites. Such data may help to explain the different tumorigenicity results observed in rodent BD carcinogenicity studies.     

Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.     

Genetic regulation of UDP-glucuronosyltransferase induction by polycyclic aromatic compounds in mice. Co-segregation with aryl hydrocarbon (benzo(alpha)pyrene) hydroxylase induction.

Induction of hepatic 4-methylumbelliferone UDP-glucuronosyltransferase (EC 2.4.1.17) by polycyclic aromatic compounds, such as 3-methylcholanthrene or beta-naphthoflavone, occurs in C57BL/6N, A/J, PL/J, C3HeB/FeJ, and BALB/cJ but not in DBA/2N, AU/SsJ, AKR/J, or RF/J inbred strains of mice. This pattern of five responsive and five nonresponsive mouse strains parallels that of the Ah locus, which controls the induction of aryl hydrocarbon (benzo[alpha]pyrene) hydroxylase (EC 1.14.14.2). Induction of the transferase is maximal in C57BL/6N mice with 200 mg of 3-methylcholanthrene/kg body weight; no induction occurs in nonresponsive DBA/2N mice even at a dose of 400 mg/kg. The rise of inducible transferase activity lags 1 or more days behind the rise of inducible hydroxylase activity and peaks 5 days after a single dose of 3-methylcholanthrene. In offspring from the appropriate backcrosses and intercross between C57BL/6N and DBA/2N parent strains, the genetic expression of 3-methylcholanthrene-inducible transferase activity is inherited as an additive (co-dominant) trait. This expression differs distinctly from that of the inducible hydroxylase activity, which is inherited almost exclusively as a single autosomal dominant trait in these same animals. The more potent inducer 2,3,7,8-tetrachlorodibenzo-p-dioxin induces the transferase more than 3-fold in C57BL/6N mice and less than 2-fold in DBA/2N mice, whereas the hydroxylase is induced equally (about 8-fold) in both strains. A dose of 3-methylcholanthrene given 3 days after 2,3,7,8-tetrachlorodibenzo-p-dioxin, at a time when hydroxylase induction in both strains is very high, does not enhance the rise in inducible transferase activity seen in C57BL/6N or DBA/2N mice which have received 2,3,7,8-tetrachlorodibenzo-p-dioxin alone. These data indicate that (a) the inducibility of two metabolically coordinated membrane-bound enzyme activities may be regulated by a single genetic locus, and (b) although the hydroxylase can be fully induced in the nonresponsive DBA/2N strain by 2,3,7,8-tetrachlorodibenzo-p-dioxin prior to 3-methylcholanthrene treatment, metabolites of the 3-methylcholanthrene treatment, metabolites of the 3-methylcholanthrene treatment, metabolites of the 3-methylcholanthrene, presumably present in the liver, are incapable of inducing further the transferase activity. The difference in sensitivity between 3-methylcholanthrene and the more potent inducer 2,3,7,8-tetrachlorodibenzo-p-dioxin for both the hydroxylase and the transferase activities suggests the possibility of a common receptor in regulating both enzyme induction processes.     

Mutagenicity of benzo(a)pyrene in uninduced tissues from BALB/c mice and Sprague-Dawley rats as an index of possible health risks using the Salmonella mutagenicity assay

The mutagenicity of benzo(a)pyrene [B(a)P] in uninduced tissues from Sprague-Dawley rats and BALB/c mice resulted in no age, sex or tissue-related differences when S9 preparations from lung, kidney and spleen were used in the Salmonella mutagenicity assay. Liver S9 fractions from both species resulted in a significantly greater number of His+ revertants (TA98) per plate than observed on the control plates (spontaneous reversion rate). Liver homogenates from adult Sprague-Dawley rats showed a significantly lower potential to activate B(a)P than homogenates from adult BALB/c mice. In both species, male liver microsomal enzymes had a greater potential to activate B(a)P than female microsomal enzymes. These data indicated that in uninduced tissues B(a)P may not be a very powerful mutagenic agent. More detailed in vitro and in vivo studies are needed to assess the precise health risks associated with this environmental pollutant.     

Isolation and characterization of a chlorate-resistant mutant (Clo- R) of the symbiotic cyanobacterium Nostoc ANTH: heterocyst formation and N(2)-fixation in the presence of nitrate,and evidence for separate nitrate and nitrite transport systems

Nostoc ANTH is a filamentous, heterocystous cyanobacterium capable of N₂-fixation in the absence of combined nitrogen. A chlorate-resistant mutant (Clo-R) of Nostoc ANTH was isolated that differentiates heterocysts and fixes N₂ in the presence of nitrate, but not in the presence of nitrite or ammonium. The mutant lacks nitrate uptake and thereby also lacks induction of nitrate reductase activity by nitrate. However, this mutant is able to transport and assimilate nitrite, indicating that there is a transport system for nitrite that is distinct from that for the nitrate. The lack of inhibitory effect of nitrate on N₂-fixation was owing to lack of nitrate uptake and not to lack of enzymes for its assimilation (nitrate reductase and glutamine synthetase) or the lack of an ammonium transport system for retention of ammonia. The mutant has potential for use as a biofertilizer supplementing chemical nitrate fertilizer in rice fields, without N₂-fixation being adversely affected. Received: 16 October 2001 / Accepted: 26 November 2001     

Expression of enhanced green fluorescent protein (EGFP) and neomycin resistant (Neo(R)) genes in porcine embryos following nuclear transfer with porcine fetal fibroblasts transfected by retrovirus vector

In this study, we demonstrated expression of enhanced green fluorescent protein (EGFP) and neomycin resistant (Neo(R)) genes in porcine embryos following nuclear transfer from porcine fetal fibroblasts (PFFs) transduced with the EGFP and Neo(R) genes by retrovirus-mediated infection. Nuclear transfer of the nonstarved transfected PFF into enucleated oocytes was accomplished by cell to cell fusion. Out of 188 porcine eggs reconstructed by nuclear transfer, 116 (61.7%) eggs cleaved and 25 (13.3%) developed to morula and blastocyst stages. Of these 25 morulae and blastocysts, 25 (100%) embryos emitted green fluorescence. Expression of the both EGFP and Neo(R) genes was detected as early as the 2-cell stage. As determined by EGFP gene expression, mosaicism was not observed in any embryo. These results suggest that porcine oocytes reconstructed by nuclear transfer with transfected PFFs can successfully develop to the blastocyst stage. In addition, this approach might be applicable to the production of transgenic pigs with complex genetic modifications.     

Lack of ecotropic virus involvement in induction of lymphomas in DBA/2J mice by 7,12-dimethylbenz(a)anthracene.

DBA/2 mice carry a single endogenous ecotropic murine leukemia provirus, Emv-3, that is replication defective because of a single nucleotide substitution in codon 3 of p15gag. However, when weanling DBA/2 mice are treated percutaneously with 7,12-dimethylbenz(a)anthracene (DMBA), ecotropic virus replication is induced in almost all of the treated mice. Previous studies have shown that this induction results from DMBA-induced reverse mutations in codon 3 that allow efficient virus replication. In addition to ecotropic virus replication, DMBA also induces lymphomas in 100% of the treated mice. These results have raised the possibility that ecotropic virus replication is causally associated with the development of lymphomas in DBA/2 mice, perhaps via the insertional activation or mutation of cellular proto-oncogenes. To test this possibility, we compared lymphoma incidence after percutaneous DMBA treatment in DBA/2J-dv/dv mice, which carry two copies of Emv-3, with lymphoma incidence in DBA/2J-d+18J/d+18J mice, which lost both copies of Emv-3 by homologous recombination involving the long terminal repeat sequences. The results of this study conclusively demonstrated that Emv-3 is not causally associated with the development of DMBA-induced lymphomas in DBA/2J mice. Interestingly, histopathological and molecular analyses of the lymphomas indicated that the majority of the lymphomas in both strains of mice were of the B-cell lineage. This was unanticipated, since the majority of chemically induced lymphomas in other inbred strains are thymic lymphomas, presumably of the T-cell lineage. Thus, DBA/2 mice appear to present a unique model system for the investigation of chemically induced B-cell lymphomas in mice.     

Long-term activation of TLR3 by Poly(I:C) induces inflammation and impairs lung function in mice

Background

The immune mechanisms associated with infection-induced disease exacerbations in asthma and COPD are not fully understood. Toll-like receptor (TLR) 3 has an important role in recognition of double-stranded viral RNA, which leads to the production of various inflammatory mediators. Thus, an understanding of TLR3 activation should provide insight into the mechanisms underlying virus-induced exacerbations of pulmonary diseases.

Methods

TLR3 knock-out (KO) mice and C57B6 (WT) mice were intranasally administered repeated doses of the synthetic double stranded RNA analog poly(I:C).

Results

There was a significant increase in total cells, especially neutrophils, in BALF samples from poly(I:C)-treated mice. In addition, IL-6, CXCL10, JE, KC, mGCSF, CCL3, CCL5, and TNFα were up regulated. Histological analyses of the lungs revealed a cellular infiltrate in the interstitium and epithelial cell hypertrophy in small bronchioles. Associated with the pro-inflammatory effects of poly(I:C), the mice exhibited significant impairment of lung function both at baseline and in response to methacholine challenge as measured by whole body plethysmography and an invasive measure of airway resistance. Importantly, TLR3 KO mice were protected from poly(I:C)-induced changes in lung function at baseline, which correlated with milder inflammation in the lung, and significantly reduced epithelial cell hypertrophy.

Conclusion

These findings demonstrate that TLR3 activation by poly(I:C) modulates the local inflammatory response in the lung and suggest a critical role of TLR3 activation in driving lung function impairment. Thus, TLR3 activation may be one mechanism through which viral infections contribute toward exacerbation of respiratory disease.     

Stereoselective formation of benzo(c)phenanthrene (+)-(3S,4R) and (+)-(5S,6R)-oxides by cytochrome P450c in a highly purified and reconstituted system

The principal oxidative metabolites formed from benzo(c)phenanthrene (B(c)Ph) by the cytochromes P450 in liver microsomes from control and treated rats are the 3,4- and 5,6-arene oxides. A procedure is described which allows determination of the enantiomer composition and absolute configuration of these arene oxides based on HPLC separation of isomeric thiolate adducts formed with N-acetyl-L-cysteine in base. Incubation of [3H]-B(c)Ph with highly purified cytochrome P450c in a reconstituted monooxygenase system followed by trapping of the metabolically formed arene oxides as above indicated that the 3,4-oxide was predominantly the (+)-(3S,4R)-enantiomer (90%) and that the 5,6-oxide consisted mainly of the (+)-(5S,6R)-enantiomer (76%). The results are discussed in terms of their implications about the catalytic binding site of cytochrome P450c.     

Amelioration of insulin resistance in diabetic ob/ob mice by a new type of orally active insulin-mimetic vanadyl complex: bis(1-oxy-2-pyridinethiolato)oxovanadium(IV) with VO(S(2)O(2)) coordination mode.

Recently, we have shown that a newly synthesized vanadyl complex, bis(1-oxy-2-pyridinethiolato)oxovanadium(IV), VO(opt)(2), is a potent orally active insulin-mimetic in treating streptozotocin-induced diabetes in rats, with long-term action. In the present study, the anti-diabetic effect of VO(opt)(2) and its mechanism in ob/ob mice, an obese non-insulin-dependent diabetes mellitus (NIDDM) animal model, was investigated. In ob/ob mice, 15-day oral treatment with VO(opt)(2) resulted in a dose-dependent decrease in the levels of glucose, insulin and triglyceride in blood. VO(opt)(2) was also effective in ameliorating impaired glucose tolerance in ob/ob mice, when an oral glucose tolerance test was performed after treatment with VO(opt)(2). Tumor necrosis factor-alpha (TNF-alpha) is a key component of obesity-diabetes link, we therefore examined the attenuating effect of VO(opt)(2) on impaired insulin signal transduction induced by TNF-alpha. Elevated expression of TNF-alpha was observed in the epididymal and subcutaneous fat tissues of ob/ob mice. Incubation of 3T3-L1, mouse adipocytes, with TNF-alpha reduced the phosphorylation of insulin receptor substrate-1 (IRS-1), whereas VO(opt)(2) treatment resulted in an enhancement of IRS-1 phosphorylation, irrespective of the presence or absence of TNF-alpha. Overall, the present study demonstrates that VO(opt)(2) exerts an anti-diabetic effect in ob/ob mice by ameliorating impaired glucose tolerance, and furthermore, attenuates the TNF-alpha-induced decrease in IRS-1 phosphorylation in adipocytes. These results suggest that the anti-diabetic action of VO(opt)(2) is derived from an attenuation of a TNF-alpha induced impaired insulin signal transduction via inhibition of protein tyrosine phosphatase, providing a potential clinical utility for VO(opt)(2) in the treatment of NIDDM.     

Both conserved region 1 (CR1) and CR2 of the human papillomavirus type 16 E7 oncogene are required for induction of epidermal hyperplasia and tumor formation in transgenic mice.

High-risk human papillomavirus type 16 (HPV-16) and HPV-18 are associated with the majority of human cervical carcinomas, and two viral genes, HPV E6 and E7, are commonly found to be expressed in these cancers. The presence of HPV-16 E7 is sufficient to induce epidermal hyperplasia and epithelial tumors in transgenic mice. In this study, we have performed experiments in transgenic mice to determine which domains of E7 contribute to these in vivo properties. The human keratin 14 promoter was used to direct expression of mutant E7 genes to stratified squamous epithelia in mice. The E7 mutants chosen had either an in-frame deletion in the conserved region 2 (CR2) domain, which is required for binding of the retinoblastoma tumor suppressor protein (pRb) and pRb-like proteins, or an in-frame deletion in the E7 CR1 domain. The CR1 domain contributes to cellular transformation at a level other than pRb binding. Four lines of animals transgenic for an HPV-16 E7 harboring a CR1 deletion and five lines harboring a CR2 deletion were generated and were observed for overt and histological phenotypes. A detailed time course analysis was performed to monitor acute effects of wild-type versus mutant E7 on the epidermis, a site of high-level expression. In the transgenic mice with the wild-type E7 gene, age-dependent expression of HPV-16 E7 correlated with the severity of epidermal hyperplasia. Similar age-dependent patterns of expression of the mutant E7 genes failed to result in any phenotypes. In addition, the transgenic mice with a mutant E7 gene did not develop tumors. These experiments indicate that binding and inactivation of pRb and pRb-like proteins through the CR2 domain of E7 are necessary for induction of epidermal hyperplasia and carcinogenesis in mouse skin and also suggest a role for the CR1 domain in the induction of these phenotypes through as-yet-uncharacterized mechanisms.     

Increased susceptibility of mice lacking Clara cell 10-kDa protein to lung tumorigenesis by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, a potent carcinogen in cigarette smoke

Ninety percent of all human lung cancers are related to cigarette smoking. Both tobacco smoke and lung tumorigenesis are associated with drastically reduced levels of Clara cell 10-kDa protein (CC10), a multifunctional secreted protein, naturally produced by the airway epithelia of virtually all mammals. We previously reported that the expression of CC10 is markedly reduced in animals exposed to 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, NNK, a potent carcinogen in tobacco smoke. Furthermore, it has been reported that CC10 expression, induced in certain tumor cells, reverses the transformed phenotype. We demonstrate here that NNK exposure of CC10-knock-out (CC10-KO) mice causes a significantly higher incidence of airway epithelial hyperplasia and lung adenomas compared with wild type (WT) littermates (30% CC10-KO versus 5% WT, p = 0.041). We also found that compared with NNK-treated WT mice, CC10-KO mice manifest increased frequency of K-ras mutation, elevated level of Fas ligand (FasL) expression, and increased MAPK/Erk phosphorylation, all of which are considered predisposing events in NNK-induced lung tumorigenesis. We propose that CC10 has a protective role against NNK-induced lung tumorigenesis mediated via down-regulation of the above-mentioned predisposing events.