Primary and secondary structure of U8 small nuclear RNA

U8 small nuclear RNA is a new, capped, 140 nucleotides long RNA species found in Novikoff hepatoma cells. Its sequence is: m3GpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCC UCCUUUCGGA GGGCAGAUAG AAAAUGAUGA UUGGAGCUUG CAUGAUCUGC UGAUUAUAGC AUUUCCGUGU AAUCAGGACC UGACAACAUC CUGAUUGCUU CUAUCUGAUUOH. This RNA is present in approximately 25,000 copies/cell, and it is enriched in nucleolar preparations. Like U1, U2, U4/U6, and U5 RNAs, U8 RNA was also present as a ribonucleoprotein associated with the Sm antigen. The rat U8 RNA was highly homologous (greater than 90%) to a recently characterized 5.4 S RNA from mouse cells infected with spleen focus-forming virus (Kato, N., and Harada, F. (1984) Biochim. Biophys. Acta, 782, 127-131). In addition to the U8 RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells. Each of these contained a m3GpppAm cap structure; their apparent chain lengths were 60, 130, and 65 nucleotides. These U small nuclear RNAs are designated U7, U9, and U10 RNAs, respectively.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

Mouse DNA sequences complementary to small nuclear RNA U1.

A mouse genomic library was screened for sequences complementary to U1 nuclear RNA. Out of the eight clones tested, none contained more than one copy of U1. Six of them were identical and one of those (clone 0U1-XIII) was further analyzed. This latter clone contained no other gene for discrete species of small size RNA in the 8 Kb EcoRI fragment encoding U1. A 248 bp Bg1II fragment from 0U1-XIII encompassing the full length of U1 as well as flanking regions on both sides has been subcloned and sequenced in M13 phage. Although the coding region was 96.5% homologous to rat U1a RNA, there is no direct evidence that this clone is a true gene. 3' and 5' flanking sequences of this as well as other published clones have been searched for homologies and the results of this search are discussed.     

Nucleotide sequence of nuclear 5.4 S RNA of mouse cells

The nucleotide sequence of nuclear 5.4 S RNA, a new species of small nuclear RNA (snRNA) of mouse cells, was determined. The 5.4 S RNA consists of 138 nucleotide residues containing 1 mol each of 2,2,7- trimethylguanosine (m3(2,2,7) G), 2'-O-methyladenosine (Am), 2'-O-methyluridine (Um) and pseudouridine as modified nucleosides. This RNA has a cap structure, m3(2,2,7) ++GpppAm -, at its 5'-terminus and sequences complementary to the terminal consensus sequences of introns. The sequence complementary to the 5'-splice junction, A-U-C-C-psi-U-A-C-C-U-G, is very similar to the 5'-terminal sequence of U1 RNA.     

Interstrand duplexes in Friend erythroleukemia nuclear RNA. The interaction of non-polyadenylated nuclear RNA with polyadenylated nuclear RNA and with small nuclear RNAs

Intermolecular duplexes among large nuclear RNAs, and between small nuclear RNA and heterogeneous nuclear RNA, were studied after isolation by a procedure that yielded protein-free RNA without the use of phenol or high salt. The bulk of the pulse-labeled RNA had a sedimentation coefficient greater than 45 S. After heating in 50% (v/v) formamide, it sedimented between the 18 S and 28 S regions of the sucrose gradient. Proof of the existence of interstrand duplexes prior to deproteinization was obtained by the introduction of interstrand cross-links using 4'-aminomethyl-4,5',8-trimethylpsoralen and u.v. irradiation. Thermal denaturation did not reduce the sedimentation coefficient of pulse-labeled RNA obtained from nuclei treated with this reagent and u.v. irradiated. Interstrand duplexes were observed among the non-polyadenylated RNA species as well as between polyadenylated and non-polyadenylated RNAs. beta-Globin mRNA but not beta-globin pre-mRNA also contained interstrand duplex regions. In this study, we were able to identify two distinct classes of polyadenylated nuclear RNA, which were differentiated with respect to whether or not they were associated with other RNA molecules. The first class was composed of poly(A)+ molecules that were free of interactions with other RNAs. beta-Globin pre-mRNA belongs to this class. The second class included poly(A)+ molecules that contained interstrand duplexes. beta-Globin mRNA is involved in this kind of interaction. In addition, hybrids between small nuclear RNAs and heterogeneous nuclear RNA were isolated. These hybrids were formed with all the U-rich species, 4.5 S, 4.5 SI and a novel species designated W. Approximately equal numbers of hybrids were formed by species U1a, U1b, U2, U6 and W; however, species U4 and U5 were significantly under-represented. Most of these hybrids were found to be associated stably with non-polyadenylated RNA. These observations demonstrated for the first time that small nuclear RNA-heterogeneous nuclear RNA hybrids can be isolated without crosslinking, and that proteins are not necessary to stabilize the complexes. However, not all molecules of a given small nuclear RNA species are involved in the formation of these hybrids. The distribution of a given small nuclear RNA species between the free and bound state does not reflect the stability of the complex in vitro but rather the abundance of complementary sequences in the heterogeneous nuclear RNA.(ABSTRACT TRUNCATED AT 400 WORDS)     

Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial characterization

Nuclei, isolated from a number of plant species by either of two independent, newly developed methods, regularly contained a common set of low-molecular-mass RNAs. Partial characterization of these RNAs, based on cell fractionation, polyacrylamide gel electrophoretic and chemical sequencing techniques, as well as comparison with literature data, revealed that, in addition to tRNA, 5S RNA and 5.8S RNA, plant nuclei contain two families of low-molecular-mass RNAs, that are counterparts of vertebrate U1 and U5 RNAs respectively, and three individual low-molecular-mass RNA species. One of these may be related to vertebrate U6 RNA. The two others are true eukaryotic U2 and U3 RNAs, respectively, on the basis of the following lines of evidence obtained from analyses of broad bean nuclear RNAs. The 3'-end portion (121 nucleotides sequenced) of broad bean U2 RNA shows a nearly perfect sequence homology with that of authentic pea U2 RNA. Broad bean U3 RNA is localized in the nucleolus and its 3'-end portion (164 nucleotides sequenced) (a) shows sequence homology with that of both rat U3 RNA (48%) and Dictyostelium D2 RNA (39%), (b) has a secondary structure which fits perfectly that proposed for both rat U3 RNA and Dictyostelium D2 RNA, and (c) contains the specific sequence which, in a model based on the primary structure of rat U3 RNA, is supposed to be involved in the processing of eukaryotic 32S pre-ribosomal RNA. This is the first report on the occurrence in plants of nucleolar U3 RNA.     

Isolation and characterization of Drosophila melanogaster U2 small nuclear RNA genes

We describe here the organization of DNA sequences complementary to Drosophila melanogaster U2 small nuclear (sn) RNA. From a genomic library we isolated two recombinants containing two genes each. Genomic reconstruction experiments and Southern analysis revealed that D. melanogaster possesses only four to five U2 snRNA genes or very closely related sequences. The nucleotide sequence of one of the clones analysed shows 77% homology with rat U2 snRNA. A stretch of 12 nucleotides that has been implicated in heterogeneous nuclear RNA splicing is conserved between rat and Drosophila. The genomic organization of these genes is very similar in different melanogaster strains but diverges highly in different Drosophila species.     

Human DNA sequences complementary to the small nuclear RNA U2.

Clones containing sequences complementary to the small nuclear RNA U2 were isolated from a human DNA library (1). Three clones, designated U2/4, U2/6 and U2/7 were purified and characterized by restriction enzyme cleavage, hybridization and heteroduplex analysis. Hybridization showed that the three clones each contained one single region which is complementary to U2 RNA. Restriction enzyme cleavage revealed furthermore that the inserted fragments in the three recombinants are different. Heteroduplex analysis identified a 240-380 bp long duplex region in each heteroduplex which includes sequences complementary to U2 RNA. Heteroduplexes between clones U2/4 and U2/7 as well as between U2/4 and U2/6 revealed two additional approximately 200 bp long homologies. The remainder of the inserts were found to lack measurable sequence homology. Two fragments from clone U2/4 were subcloned in the pBR322 vector and the subclones were used to determine the nucleotide sequence of a region in clone U2/4 which is complementary to U2 RNA. A comparison between the established sequence and the sequence for rat U2 RNA (2) reveals several discrepancies.     

The primary nucleotide sequence of U4 RNA

U4 RNA is one of the "capped" nuclear snRNAs recently found to be precipitable by anti-Sm antibodies as ribonucleoprotein particles. U4 RNA, along with other snRNAs, has been implicated in hnRNA processing, mRNA transport, or both (Lerner, M. R., Boyle, J., Mount, S., Wolin, S., and Steitz, J. A. (1980) Nature 283, 220-224). Since the proteins bound to different snRNAs appear to be the same, the functions of different snRNPs might be dependent on the RNA components. To help understand the function of U4 RNP, the nucleotide sequence of U4 RNA was determined. The sequence is (formula see text) In addition to the modified nucleotides in the "cap," U4 RNA contains Am at position 63 and m6A at position 98. It also exhibited A-C microheterogeneity at position 97.     

Loop I of U1 small nuclear RNA is the only essential RNA sequence for binding of specific U1 small nuclear ribonucleoprotein particle proteins.

The binding of the U1 small nuclear ribonucleoprotein (snRNP)-specific proteins C, A, and 70K to U1 small nuclear RNA (snRNA) was analyzed. Assembly of U1 snRNAs from bean and soybean and a set of mutant Xenopus U1 snRNAs into U1 snRNPs in Xenopus egg extracts was studied. The ability to bind proteins was analyzed by immunoprecipitation with monospecific antibodies and by a protein-sequestering assay. The only sequence essential for binding of the U1-specific proteins was the conserved loop sequence in the 5' hairpin of U1. Further analysis suggested that protein C binds directly to the loop and that the assembly of proteins A and 70K into the RNP requires mainly protein-protein interactions. Protein C apparently recognizes a specific RNA sequence rather than a secondary structural element in the RNA.     

Insect small nuclear RNA gene promoters evolve rapidly yet retain conserved features involved in determining promoter activity and RNA polymerase specificity

In animals, most small nuclear RNAs (snRNAs) are synthesized by RNA polymerase II (Pol II), but U6 snRNA is synthesized by RNA polymerase III (Pol III). In Drosophila melanogaster, the promoters for the Pol II-transcribed snRNA genes consist of approximately 21 bp PSEA and approximately 8 bp PSEB. U6 genes utilize a PSEA but have a TATA box instead of the PSEB. The PSEAs of the two classes of genes bind the same protein complex, DmSNAPc. However, the PSEAs that recruit Pol II and Pol III differ in sequence at a few nucleotide positions that play an important role in determining RNA polymerase specificity. We have now performed a bioinformatic analysis to examine the conservation and divergence of the snRNA gene promoter elements in other species of insects. The 5' half of the PSEA is well-conserved, but the 3' half is divergent. Moreover, within each species positions exist where the PSEAs of the Pol III-transcribed genes differ from those of the Pol II-transcribed genes. Interestingly, the specific positions vary among species. Nevertheless, we speculate that these nucleotide differences within the 3' half of the PSEA act similarly to induce conformational alterations in DNA-bound SNAPc that result in RNA polymerase specificity.     

Evolutionary origin of the U6 small nuclear RNA intron.

U6 is the most conserved of the five small nuclear RNAs known to participate in pre-mRNA splicing. In the fission yeast Schizosaccharomyces pombe, the single-copy gene encoding this RNA is itself interrupted by an intron (T. Tani and Y. Ohshima, Nature (London) 337:87-90, 1989). Here we report analysis of the U6 genes from all four Schizosaccharomyces species, revealing that each is interrupted at an identical position by a homologous intron; in other groups, including ascomycete and basidiomycete fungi, as well as more distantly related organisms, the U6 gene is colinear with the RNA. The most parsimonious interpretation of our data is that the ancestral U6 gene did not contain an intron, but rather, it was acquired via a single relatively recent insertional event.