Covalent attachment of oligonucleotides to solid supports.

Coupling efficiencies for the covalent attachment of oligonucleotides (17-29 bases in length) to solid supports derivatized with alkyl-amino and -carboxylic functionalities have been determined. Attachment efficiencies of 60-80% were obtained for coated long-chain alkylamino controlled pore glass (CPG) supports. Similar efficiencies of immobilization were observed for carboxyl-bearing supports, which additionally exhibited lower levels of non-covalent binding. The extent of terminally linked oligonucleotide was determined to be 50-55% of the overall attachment in the carbodiimide-mediated coupling reaction of a 5'-aminohexyl phosphoramidate derivative of a 29-mer to Sephacryl carboxyl support. While lower overall efficiencies of attachment were obtained in the reaction with Sephacryl N-hydroxysuccinimide-activated carboxyl support, greater than 80% of this coupling results in end-attached oligonucleotides.     

Microwaves synthesis of solid supports for the synthesis of 3'-aminoalkyl oligodeoxynucleotides

Phthalimido-alkyl alcohol solid supports were rapidly prepared from solid supported phthalic anhydride and amino alcohol condensation induced by microwaves. These supports were used to synthesize 13-aminoalkyl oligodeoxynucleotides allowing a two step deprotection necessary to avoid aminolink alkylation.     

Reagents for the selective immobilization of oligonucleotides on solid supports

New reagents (CPGs and phosphoramidites) for automatic solid phase synthesis of modified oligonucleotides were designed. Three oligonucleotides carrying fluorescent label at the 5'-terminus and an anchor group at the 3'-terminus were prepared and their immobilization in orthogonal conditions on solid supports was studied.     

A new general approach for the simultaneous chemical synthesis of large numbers of oligonucleotides: segmental solid supports.

A new approach is described which will allow the simultaneous synthesis of large numbers of pre-defined oligonucleotide chains. No machine aid is needed. The simultaneous syntheses can be performed by one person and do not require much more time than is currently needed for the synthesis of just one oligonucleotide in existing strategies. The general idea is the following: One uses noninterchangeable polymeric entities from each of which enough OD units can be isolated after completion of the syntheses. Whenever growing chains on different entities have to be elongated with the same building block these entities are gathered in the same reaction vessel. After such a common reaction cycle the entities are separated and now combined according to the next common building blocks etc. The practicability of this approach is demonstrated by the synthesis of d(T-A-A-T-A-T-T-A) and d(T-A-G-T-A-C-T-A) on cellulose filter disks following the phosphotriester approach.     

Oxidiazole synthesis on solid supports.

Substituted 1,2,4-oxadiazoles were synthesized in good yields on solid supports under basic conditions at room temperature.     

Synthesis of achiral linker reagents for direct labelling of oligonucleotides on solid supports

Full experimental procedures for the synthesis of a series of new functional linker reagents (14-16) and solid supports (11-13) are reported. The achiral linker reagents and supports can be used for high yield incorporation of free amino groups, fluorescein or biotin into DNA oligomers.     

Phosphoramidite reagents and solid-phase supports based on hydroxyprolinol for the synthesis of modified oligonucleotides

The synthesis of phosphoramidite reagents and solid-phase supports based on hydroxyprolinol for the introduction of the residues of biotin, lipoic acid, amino groups, and terminal acetylene groups at different positions of the oligonucleotide chain has been described. The efficiency of the reagents and supports has been confirmed by the synthesis of the corresponding modified oligonucleotides.     

An improved CPG support for the synthesis of 3'-amine-tailed oligonucleotides.

A new controlled-pore glass (CPG) support is described that allows for the direct synthesis of oligonucleotides bearing a 3'-aminohexyl tail. This solid support (AH-CPG) exhibits superior performance as compared to a commercially available 3'-amine CPG. The AH-CPG is prepared from 6-aminohexan-1-ol with a unique protecting group for the amine that also functions as the site of attachment to the CPG. A 3'-amine-tailed oligodeoxynucleotide (ODN) was prepared from this support using standard phosphoramidite coupling and deprotection conditions. The 3'-amine-tailed ODN was subsequently modified with an acridinylpropionic acid tetrafluorophenyl ester. Facile synthesis of the AH-CPG and the stability of the deprotected product makes this functionalized solid support especially useful for preparation of oligonucleotides bearing 3'-amine tails and other modifications.     

Versatile solid supports for oligonucleotide synthesis that incorporate urea bridge

The universal solid support, USIII, representing a new and improved version of commercial USII, as well as 2 '-deoxynucleoside and 2 '-deoxy-2 '-fluoronucleoside bound supports, incorporating a labile phenoxyacetyl fragment, was synthesized by an aminomethyl polystyrene carbamoylation with corresponding azides in the presence of aqueous triethylammonium bicarbonate. All three solid phases incorporate a stable urea tether, thus bridging the polymer and functional linker. These new matrices proved to be potent solid phases for the synthesis of DNA, RNA, or modified oligonucleotides as well as randomized mixed 2 '-ribo/2 '-deoxy-2 '-fluoro-RNA libraries and/or DNA libraries, randomized with trinucleotides (codons).     

Incorporation of terminal phosphorothioates into oligonucleotides.

Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described.     

A protected biotin containing deoxycytidine building block for solid phase synthesis of biotinylated oligonucleotides.

The synthesis of a modified 2'-deoxycytidine-3'-O-phosphoramidite carrying an N-t-butylbenzoyl protected biotin on a long polar spacer arm attached to the 4-N position is described. The presence of the bulky lipophilic t-butylbenzoyl protecting group enables the direct solid phase synthesis of biotinylated oligoribonucleotides and a variety of analogues in high yield without modification of the biotin moiety. Biotinylated antisense oligonucleotides incorporating this new derivative allow convenient isolation and purification of ribonucleic acid-protein complexes. The kinetics of biotin binding to streptavidin agarose is facilitated by the long polar spacer arm.     

A convenient solid-phase method for synthesis of 3'-conjugates of oligonucleotides.

We present a new procedure for the preparation of 3'-conjugates of oligonucleotides through solid-phase synthesis. A suitable universal solid support was readily prepared using a series of peptide-like coupling reactions to incorporate first a spacer and then an L-homoserine branching unit. The N-alpha-position of the homoserine carries an Fmoc protecting group that is removed by treatment with piperidine to liberate an amino group suitable for attachment of the conjugate (e.g., small organic molecule, fluorescent group, cholesterol, biotin, amino acid, etc.) or for assembly of a short peptide. The side-chain hydroxyl group of the homoserine carries a trityl protecting group. After TFA deprotection, the hydroxyl group acts as the site for oligonucleotide assembly. An additional spacer, such as aminohexanoyl, may be incorporated easily between the conjugate molecule and the oligonucleotide. A number of examples of synthesis of 3'-conjugates of oligonucleotides and their analogues are described that involve standard automated oligonucleotide assembly and use of commercially available materials. The linkage between oligonucleotide and 3'-conjugate is chirally pure and is stable to conventional ammonia treatment used for oligonucleotide deprotection and release from the solid support. The homoserine-functionalized solid support system represents a simple and universal route to 3'-conjugates of oligonucleotides and their derivatives.     

A novel amino-on CPG-support for the synthesis of 3'-aminoalkylated oligonucleotides

The synthesis of a novel amino-ON CPG support and its application in the synthesis of 3'-aminoalkylated oligonucleotides is reported. The release of oligonucleotides with free 3'-amino groups is accomplished by treatment with concentrated ammonia for 2 h at 55 degrees C.     

A new solid-phase synthesis of oligonucleotides 3'-conjugated with peptides

A convenient 'on line' solid-phase synthesis of oligonucleotides conjugated at the 3'-end with peptides by means of a polymeric support linking the first nucleoside via the base has been developed. A 17-mer designed for antisense experiments against HIV-1, linking at the 3'-terminus the tripeptide Gly-Gly-His, was prepared in good yields and characterized by MALDI-TOF mass spectrometry.     

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.     

A general method for the synthesis of 3''-sulfhydryl and phosphate group containing oligonucleotides.

The syntheses are described of polymer supports useful for the synthesis of 3'-partially protected sulfhydryl, free sulfhydryl or phosphate group containing oligonucleotides. The supports are compatible with established phosphoramidite chemistry of oligonucleotide synthesis giving rise to oligonucleotides with terminal 3'-partially protected sulfhydryl, free sulfhydryl or phosphate function during final deprotection. Crosslinking of the thiol group containing oligonucleotide to sulfhydryl group specific fluorescent probes was carried out with high selectivity, in high yields under mild conditions. 3-Aminopropylated Controlled Pore Glass (CPG) was succinylated with succinic anhydride followed by the reaction with S-(2-thio-5-nitropyridyl)-2-mercaptoethanol in the presence of dicyclohexylcarbodiimide (DCC). The resultant polymer support was reacted with 4,4'-dimethoxytrityloxyalkanthiol 5(a - c) to yield the derivatized polymer supports 5(a - c). The support 5a directly leads to oligonucleotide-3'-phosphate on deprotection with ammonical DTT at 55 degrees C while the supports 5b and 5c lead to oligonucleotide-3'-thiols or partially protected 3'-sulfhydryl group containing oligonucleotides during final deprotection.     

Thioacyl esters of nucleotides: synthesis of 3''(2'')-O-thiobenzoyl nucleoside 5''-phosphates.

The synthesis of 3'(2')-O-thiobenzoyl nucleoside 5'-phosphates based on the condensation of N-(thiobenzoyl)-imidazole with nucleside 5'-phosphates was carried out. The UV absorption spectra, CD spectra, PMR spectra and chromatographic and electrophoretic characteristics of synthesized compounds were obtained. By means of PMR it was shown that the 2':3' isomer ratio in water at ambient temperature is about 2:3.     

Synthesis of 3''-phosphates of diribonucleoside monophosphates via phosphotriester intermediates.

Phosphorylation of the easily accessible 3',5'-diesters 1a-d with diphenyl phosphorochloridate, followed by selective 5'-deacylation, affords the phosphotriester derivatives 2a-d in good yields. Alkaline treatment of 2a-d results in the formation of the 2',3'-cyclic phosphates (3a-d). The usefulness of the phosphotriester derivatives 2a-d is also demonstrated in the synthesis of the nucleotidyl-(3'-5')nucleoside 3'-phosphates U-Up (10a), U-Ap (11a), U-Cp (12a) and A-Gp (13a). The fully protected dinucleoside diphosphates 5c-8c, prepared by the phosphotriester method, are deprotected in two ways: (a) by a purely chemical method, affording the dinucleoside diphosphates in a circa one to one mixture of 2'- and 3'- isomers, 10b-13b and 10a-13a, respectively, and (b) by a mixed chemical-enzymatical approach which gives the pure 3'-phosphates (10a-13a).