共查询到20条相似文献,搜索用时 62 毫秒
1.
2.
José Carlos Quintela Francisco García-del Portillo Ernst Pittenauer Günter Allmaier Miguel A. de Pedro 《Journal of bacteriology》1999,181(1):334-337
Peptidoglycan from Deinococcus radiodurans was analyzed by high-performance liquid chromatography and mass spectrometry. The monomeric subunit was: N-acetylglucosamine–N-acetylmuramic acid–l-Ala–d-Glu-(γ)–l-Orn-[(δ)Gly-Gly]–d-Ala–d-Ala. Cross-linkage was mediated by (Gly)2 bridges, and glycan strands were terminated in (1→6)anhydro-muramic acid residues. Structural relations with the phylogenetically close Thermus thermophilus are discussed.The gram-positive bacterium Deinococcus radiodurans is remarkable because of its extreme resistance to ionizing radiation (14). Phylogenetically the closest relatives of Deinococcus are the extreme thermophiles of the genus Thermus (4, 11). In 16S rRNA phylogenetic trees, the genera Thermus and Deinococcus group together as one of the older branches in bacterial evolution (11). Both microorganisms have complex cell envelopes with outer membranes, S-layers, and ornithine-Gly-containing mureins (7, 12, 19, 20, 22, 23). However, Deinococcus and Thermus differ in their response to the Gram reaction, having positive and negative reactions, respectively (4, 14). The murein structure for Thermus thermophilus HB8 has been recently elucidated (19). Here we report the murein structure of Deinococcus radiodurans with similar detail.D. radiodurans Sark (23) was used in the present study. Cultures were grown in Luria-Bertani medium (13) at 30°C with aeration. Murein was purified and subjected to amino acid and high-performance liquid chromatography (HPLC) analyses as previously described (6, 9, 10, 19). For further analysis muropeptides were purified, lyophilized, and desalted as reported elsewhere (6, 19). Purified muropeptides were subjected to plasma desorption linear time-of-flight mass spectrometry (PDMS) as described previously (1, 5, 16, 19). Positive and negative ion mass spectra were obtained on a short linear 252californium time-of-flight instrument (BioIon AB, Uppsala, Sweden). The acceleration voltage was between 17 and 19 kV, and spectra were accumulated for 1 to 10 million fission events. Calibration of the mass spectra was done in the positive ion mode with H+ and Na+ ions and in the negative ion mode with H− and CN− ions. Calculated m/z values are based on average masses.Amino acid analysis of muramidase (Cellosyl; Hoechst, Frankfurt am Main, Germany)-digested sacculi (50 μg) revealed Glu, Orn, Ala, and Gly as the only amino acids in the muramidase-solubilized material. Less than 3% of the total Orn remained in the muramidase-insoluble fraction, indicating an essentially complete solubilization of murein.Muramidase-digested murein samples (200 μg) were analyzed by HPLC as described in reference 19. The muropeptide pattern (Fig. (Fig.1)1) was relatively simple, with five dominating components (DR5 and DR10 to DR13 [Fig. 1]). The muropeptides resolved by HPLC were collected, desalted, and subjected to PDMS. The results are presented in Table Table11 compared with the m/z values calculated for best-matching muropeptides made up of N-acetylglucosamine (GlucNAc), N-acetylmuramic acid (MurNAc), and the amino acids detected in the murein. The more likely structures are shown in Fig. Fig.1.1. According to the m/z values, muropeptides DR1 to DR7 and DR9 were monomers; DR8, DR10, and DR11 were dimers; and DR12 and DR13 were trimers. The best-fitting structures for DR3 to DR8, DR11, and DR13 coincided with muropeptides previously characterized in T. thermophilus HB8 (19) and had identical retention times in comparative HPLC runs. The minor muropeptide DR7 (Fig. (Fig.1)1) was the only one detected with a d-Ala–d-Ala dipeptide and most likely represents the basic monomeric subunit. The composition of the major cross-linked species DR11 and DR13 confirmed that cross-linking is mediated by (Gly)2 bridges, as proposed previously (20). Open in a separate windowFIG. 1HPLC muropeptide elution patterns of murein purified from D. radiodurans. Muramidase-digested murein samples were subjected to HPLC analysis, and the A204 of the eluate was recorded. The most likely structures for each muroeptide as deduced by PDMS are shown. The position of residues in brackets is the most likely one as deduced from the structures of other muropeptides but could not be formally demonstrated. R = GlucNac–MurNac–l-Ala–d-Glu-(γ)→.
Open in a separate windowaDR5 and DR10 to DR13 were analyzed in both the positive and negative ion modes. Muropeptides DR1 to DR4 and DR6 to DR9 were analyzed in the positive mode only due to the small amounts of sample available. bMass difference between measured and calculated quasimolecular ion values. c[(Measured mass−calculated mass)/calculated mass] × 100. dN-Acetylglucosamine. eN-Acetylmuramitol. f(1→6)Anhydro-N-acetylmuramic acid. Structural assignments of muropeptides DR1, DR2, DR8 to DR10, and DR12 deserve special comments. The low m/z value measured for DR1 (700.1) fitted very well with the value calculated for GlucNAc–MurNAc–l-Ala–d-Glu (699.69). Even smaller was the mass deduced for DR9 from the m/z value of the molecular ion of the sodium adduct (702.1) (Fig. (Fig.2).2). The mass difference between DR1 and DR9 (19.9 mass units) was very close indeed to the calculated difference between N-acetylmuramitol and the (1→6)anhydro form of MurNAc (20.04 mass units). Therefore, DR9 was identified as GlucNAc–(1→6)anhydro-MurNAc–l-Ala–d-Glu (Fig. (Fig.1).1). Muropeptides with (1→6)anhydro muramic acid have been identified in mureins from diverse origins (10, 15, 17, 19), indicating that it might be a common feature among peptidoglycan-containing microorganisms. Open in a separate windowFIG. 2Positive-ion linear PDMS of muropeptide DR9. Muropeptide DR9 was purified, desalted by HPLC, and subjected to PDMS to determine the molecular mass. The masses for the dominant molecular ions are indicated.The measured m/z value for the [M+Na]+ ion of DR8 was 1,521.6, very close to the mass calculated for a cross-linked dimer without one disaccharide moiety (1,520.53) (Fig. (Fig.1;1; Table Table1).1). Such muropeptides, also identified in T. thermophilus HB8 and other bacteria (18, 19), are most likely generated by the enzymatic clevage of MurNAc–l-Ala amide bonds in murein by an N-acetylmuramyl–l-alanine amidase (21). In particular, DR8 could derive from DR11. The difference between measured m/z values for DR8 and DR11 was 478.7, which fits with the mass contribution of a disaccharide moiety (480.5) within the mass accuracy of the instrument.The m/z values for muropeptides DR2, DR10, and DR12 supported the argument for structures in which the two d-Ala residues from the d-Ala–d-Ala C-terminal dipeptide were lost, leaving Orn as the C-terminal amino acid.The position of one Gly residue in muropeptides DR2, DR8, and DR10 to DR13 could not be formally demonstrated. One of the Gly residues could be at either the N- or the C-terminal positions. However, the N-terminal position seems more likely. The structure of the basic muropeptide (DR7), with a (Gly)2 acylating the δ-NH2 group of Orn, suggests that major muropeptides should present a (Gly)2 dipeptide. The scarcity of DR3 and DR6, which unambiguously have Gly as the C-terminal amino acid (Fig. (Fig.1),1), supports our assumption.Molar proportions for each muropeptide were calculated as proposed by Glauner et al. (10) and are shown in Table Table1.1. For calculations the structures of DR10 to DR13 were assumed to be those shown in Fig. Fig.1.1. The degree of cross-linkage calculated was 47.2%. Trimeric muropeptides were rather abundant (8 mol%) and made a substantial contribution to total cross-linkage. However, higher-order oligomers were not detected, in contrast with other gram-positive bacteria, such as Staphylococcus aureus, which is rich in such oligomers (8). The proportion of muropeptides with (1→6)anhydro-muramic acid (5 mol%) corresponded to a mean glycan strand length of 20 disaccharide units, which is in the range of values published for other bacteria (10, 17).The results of our study indicate that mureins from D. radiodurans and T. thermophilus HB8 (19) are certainly related in their basic structures but have distinct muropeptide compositions. In accordance with the phylogenetic proximity of Thermus and Deinococcus (11), both mureins are built up from the same basic monomeric subunit (DR7 in Fig. Fig.1),1), are cross-linked by (Gly)2 bridges, and have (1→6)anhydro-muramic acid at the termini of glycan strands. Most interestingly, Deinococcus and Thermus are the only microorganisms identified at present with the murein chemotype A3β as defined by Schleifer and Kandler (20). Nevertheless, the differences in muropeptide composition were substantial. Murein from D. radiodurans was poor in d-Ala–d-Ala- and d-Ala–Gly-terminated muropeptides (2.2 and 2.4 mol%, respectively) but abundant in Orn-terminated muropeptides (23.8 mol%) and in muropeptides with a peptide chain reduced to the dipeptide l-Ala–d-Glu (18 mol%). In contrast, neither Orn- nor Glu-terminated muropeptides have been detected in T. thermophilus HB8 murein, which is highly enriched in muropeptides with d-Ala–d-Ala and d-Ala–Gly (19). Furthermore, no traces of phenyl acetate-containing muropeptides, a landmark for T. thermophilus HB8 murein (19), were found in D. radiodurans. Cross-linkage was definitely higher in D. radiodurans than in T. thermophilus HB8 (47.4 and 27%, respectively), largely due to the higher proportion of trimers in the former.The similarity in murein basic structure suggests that the difference between D. radiodurans and T. thermophilus HB8 with respect to the Gram reaction may simply be a consequence of the difference in the thickness of cell walls (2, 3, 23). Interestingly, D. radiodurans murein turned out to be relatively simple for a gram-positive organism, possibly reflecting the primitive nature of this genus as deduced from phylogenetic trees (11). Our results illustrate the phylogenetic proximity between Deinococcus and Thermus at the cell wall level but also point out the structural divergences originated by the evolutionary history of each genus. 相似文献
TABLE 1
Calculated and measured m/z values for the molecular ions of the major muropeptides from D. radioduransMuropeptidea | Ion | m/z
| Δmb | Error (%)c | Muropeptide composition
| Muropeptide abundance (mol%) | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Calculated | Measured | NAGd | NAMe | Glu | Orn | Ala | Gly | |||||
DR1 | [M+H]+ | 699.69 | 700.1 | 0.41 | 0.06 | 1 | 1 | 1 | 0 | 1 | 0 | 12.0 |
DR2 | [M+H]+ | 927.94 | 928.3 | 0.36 | 0.04 | 1 | 1 | 1 | 1 | 1 | 2 | 5.7 |
DR3 | [M+Na]+ | 1,006.97 | 1,007.5 | 0.53 | 0.05 | 1 | 1 | 1 | 1 | 1 | 3 | 3.0 |
DR4 | [M+Na]+ | 963.95 | 964.6 | 0.65 | 0.07 | 1 | 1 | 1 | 1 | 2 | 1 | 2.5 |
DR5 | [M+H]+ | 999.02 | 999.8 | 0.78 | 0.08 | 1 | 1 | 1 | 1 | 2 | 2 | 27.7 |
[M−H]− | 997.00 | 997.3 | 0.30 | 0.03 | ||||||||
DR6 | [M+Na]+ | 1,078.5 | 1,078.8 | 0.75 | 0.07 | 1 | 1 | 1 | 1 | 2 | 3 | 2.4 |
DR7 | [M+H]+ | 1,070.09 | 1,071.0 | 0.90 | 0.08 | 1 | 1 | 1 | 1 | 3 | 2 | 2.2 |
DR8 | [M+Na]+ | 1,520.53 | 1,521.6 | 1.08 | 0.07 | 1 | 1 | 2 | 2 | 4 | 4 | 2.2 |
DR9 | [M+Na]+ | 701.64 | 702.1 | 0.46 | 0.03 | 1 | 1f | 1 | 0 | 1 | 0 | 5.0 |
DR10 | [M+H]+ | 1,907.94 | 1,907.8 | 0.14 | 0.01 | 2 | 2 | 2 | 2 | 3 | 4 | 10.1 |
[M−H]− | 1,905.92 | 1,906.6 | 0.68 | 0.04 | ||||||||
DR11 | [M+H]+ | 1,979.01 | 1,979.1 | 0.09 | 0.01 | 2 | 2 | 2 | 2 | 4 | 4 | 19.1 |
[M−H]− | 1,977.00 | 1,977.3 | 0.30 | 0.02 | ||||||||
DR12 | [M+H]+ | 2,887.93 | 2,886.5 | −1.43 | −0.05 | 3 | 3 | 3 | 3 | 5 | 6 | 4.4 |
[M−H]− | 2,885.91 | 2,885.8 | −0.11 | −0.01 | ||||||||
DR13 | [M+H]+ | 2,959.00 | 2,957.8 | −1.20 | −0.04 | 3 | 3 | 3 | 3 | 6 | 6 | 3.6 |
[M−H]− | 2,956.99 | 2,955.9 | −1.09 | −0.04 |
3.
4.
Lichenysins are surface-active lipopeptides with antibiotic properties produced nonribosomally by several strains of Bacillus licheniformis. Here, we report the cloning and sequencing of an entire 26.6-kb lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Three large open reading frames coding for peptide synthetases, designated licA, licB (three modules each), and licC (one module), could be detected, followed by a gene, licTE, coding for a thioesterase-like protein. The domain structure of the seven identified modules, which resembles that of the surfactin synthetases SrfA-A to -C, showed two epimerization domains attached to the third and sixth modules. The substrate specificity of the first, fifth, and seventh recombinant adenylation domains of LicA to -C (cloned and expressed in Escherichia coli) was determined to be Gln, Asp, and Ile (with minor Val and Leu substitutions), respectively. Therefore, we suppose that the identified biosynthesis operon is responsible for the production of a lichenysin variant with the primary amino acid sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile, with minor Leu and Val substitutions at the seventh position.Many strains of Bacillus are known to produce lipopeptides with remarkable surface-active properties (11). The most prominent of these powerful lipopeptides is surfactin from Bacillus subtilis (1). Surfactin is an acylated cyclic heptapeptide that reduces the surface tension of water from 72 to 27 mN m−1 even in a concentration below 0.05% and shows some antibacterial and antifungal activities (1). Some B. subtilis strains are also known to produce other, structurally related lipoheptapeptides (Table (Table1),1), like iturin (32, 34) and bacillomycin (3, 27, 30), or the lipodecapeptides fengycin (50) and plipastatin (29).
Open in a separate windowaFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of the C-terminal amino acid. bFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of Asp5. cFA, β-amino fatty acid. The β-amino group forms a peptide bond with the carboxy group of the C-terminal amino acid. dOnly the following combinations of amino acid 1 and 5 are allowed: Gln-Asp or Glu-Asn. eWhere an alternative amino acid may be present in a structure, the alternative is also presented. In addition to B. subtilis, several strains of Bacillus licheniformis have been described as producing the lipopeptide lichenysin (14, 17, 23, 26, 51). Lichenysins can be grouped under the general sequence l-Glx–l-Leu–d-Leu–l-Val–l-Asx–d-Leu–l-Ile/Leu/Val (Table (Table1).1). The first amino acid is connected to a β-hydroxyl fatty acid, and the carboxy-terminal amino acid forms a lactone ring to the β-OH group of the lipophilic part of the molecule. In contrast to the lipopeptide surfactin, lichenysins seem to be synthesized during growth under aerobic and anaerobic conditions (16, 51). The isolation of lichenysins from cells growing on liquid mineral salt medium on glucose or sucrose basic has been studied intensively. Antimicrobial properties and the ability to reduce the surface tension of water have also been described (14, 17, 26, 51). The structural elucidation of the compounds revealed slight differences, depending on the producer strain. Various distributions of branched and linear fatty acid moieties of diverse lengths and amino acid variations in three defined positions have been identified (Table (Table11).In contrast to the well-defined methods for isolation and structural characterization of lichenysins, little is known about the biosynthetic mechanisms of lichenysin production. The structural similarity of lichenysins and surfactin suggests that the peptide moiety is produced nonribosomally by multifunctional peptide synthetases (7, 13, 25, 49, 53). Peptide synthetases from bacterial and fungal sources describe an alternative route in peptide bond formation in addition to the ubiquitous ribosomal pathway. Here, large multienzyme complexes affect the ordered recognition, activation, and linking of amino acids by utilizing the thiotemplate mechanism (19, 24, 25). According to this model, peptide synthetases activate their substrate amino acids as aminoacyl adenylates by ATP hydrolysis. These unstable intermediates are subsequently transferred to a covalently enzyme-bound 4′-phosphopantetheinyl cofactor as thioesters. The thioesterified amino acids are then integrated into the peptide product through a stepwise elongation by a series of transpeptidations directed from the amino terminals to the carboxy terminals. Peptide synthetases have not only awakened interest because of their mechanistic features; many of the nonribosomally processed peptide products also possess important biological and medical properties.In this report we describe the identification and characterization of a putative lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Cloning and sequencing of the entire lic operon (26.6 kb) revealed three genes, licA, licB, and licC, with structural patterns common to peptide synthetases and a gene designated licTE, which codes for a putative thioesterase. The modular organization of the sequenced genes resembles the requirements for the biosynthesis of the heptapeptide lichenysin. Based on the arrangement of the seven identified modules and the tested substrate specificities, we propose that the identified genes are involved in the nonribosomal synthesis of the portion of the lichenysin peptide with the primary sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile (with minor Val and Leu substitutions). 相似文献
TABLE 1
Lipoheptapeptide antibiotics of Bacillus spp.Lipopeptide | Organism | Structure | Reference |
---|---|---|---|
Lichenysin A | B. licheniformis | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asn-D-Leu-L-Ile | 51, 52 |
Lichenysin B | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu | 23, 26 | |
Lichenysin C | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile | 17 | |
Lichenysin D | FAa-L-Gln-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile | This work | |
Surfactant 86 | B. licheniformis | FAa-L-Glxd-L-Leu-D-Leu-L-Val-L-Asxd-D-Leu-L-Ilee | 14, 15 |
L-Val | |||
Surfactin | B. subtilis | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu | 1, 7, 49 |
Esperin | B. subtilis | FAb-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leue | 45 |
L-Val | |||
Iturin A | B. subtilis | FAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Ser | 32 |
Iturin C | FAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asne-L-Asne | 34 | |
D-Ser-L-Thr | |||
Bacillomycin L | B. subtilis | FAc-L-Asp-D-Tyr-D-Asn-L-Ser-L-Gln-D-Proe-L-Thr | 3 |
D-Ser- | |||
Bacillomycin D | FAc-L-Asp-D-Tyr-D-Asn-L-Pro-L-Glu-D-Ser-L-Thr | 30, 31 | |
Bacillomycin F | FAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Thr | 27 |
5.
Mervyn L. de Souza Jennifer Seffernick Betsy Martinez Michael J. Sadowsky Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined.
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation. 相似文献
Atrazine-catabolizing bacteria used in this study.
Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).TABLE 1
Recently isolated atrazine-catabolizing bacteriaGenus | Strain | Location where isolated | Yr reported (reference) |
---|---|---|---|
Pseudomonasa | ADP | Agricultural-chemical dealership site, Little Falls, Minn. | 1995 (35) |
Ralstoniaa | M91-3 | Agricultural soil, Ohio | 1995 (46, 55) |
Mixed culture | Basel, Switzerland | 1995 (57) | |
Clavibacter | Agricultural soil, Riverside, Calif. | 1996 (13) | |
Agrobacterium | J14a | Agricultural soil, Nebraska | 1996 (39) |
NDb | 38/38 | Atrazine-contaminated soil, Indiana | 1996 (3) |
Alcaligenesa | SG1 | Industrial settling pond, San Gabriel, La. | 1997 (7) |
Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.
Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.
DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.TABLE 2
Sequence identities of atzABC homologs from different atrazine-degrading bacteriaStrain | % DNA sequence identitya
| ||
---|---|---|---|
atzA | atzB | atzC | |
Pseudomonas ADP | 100 | 100 | 100 |
Alcaligenes SG1 | 99.2 | 100 | 100 |
Ralstonia M91-3 | 99.0 | 100 | 100 |
Agrobacterium J14a | 99.1 | 100 | 100 |
Isolate 38/38 | 99.3 | 100 | 99.8 |
TABLE 3
Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compoundsGene | Enzyme | Average % protein sequence identitya (no. of pairwise comparisons) | References |
---|---|---|---|
dhlA, dhaA | Haloalkane dehalogenase | 25.0 (1) | 23, 31 |
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII | 2-Haloacid dehalogenase | 36.6 ± 3.9 (36) | 5, 25, 28, 29, 42, 43, 50, 59 |
tfdA | 2,4-Dichlorophenoxyacetate monooxygenase | 43.2 ± 4.6 (21)b | 34, 37, 38, 56, 58 |
dcmA | Dichloromethane dehalogenase | 56.0 (1) | 4, 32 |
atzA | Atrazine chlorohydrolase | 98.6 ± 0.12 (15)c | This study |
atzB | Hydroxyatrazine ethylaminohydrolase | 100 (10)c | This study |
atzC | N-Isopropylammelide isopropylaminohydrolase | 99.0 ± 0.43 (10)c | This study |
6.
7.
The site-specific recombinase IntI1 found in class 1 integrons catalyzes the excision and integration of mobile gene cassettes, especially antibiotic resistance gene cassettes, with a site-specific recombination system. The integron integrase belongs to the tyrosine recombinase (phage integrase) family. The members of this family, exemplified by the lambda integrase, do not share extensive amino acid identities, but three invariant residues are found within two regions, designated box I and box II. Two conserved residues are arginines, one located in box I and one in box II, while the other conserved residue is a tyrosine located at the C terminus of box II. We have analyzed the properties of IntI1 variants carrying point mutations at the three conserved residues of the family in in vivo recombination and in vitro substrate binding. We have made four proteins with mutations of the conserved box I arginine (R146) and three mutants with changes of the box II arginine (R280); of these, MBP-IntI1(R146K) and MBP-IntI1(R280K) bind to the attI1 site in vitro, but only MBP-IntI1(R280K) is able to excise cassettes in vivo. However, the efficiency of recombination and DNA binding for MBP-IntI1(R280K) is lower than that obtained with the wild-type MBP-IntI1. We have also made two proteins with mutations of the tyrosine residue (Y312), and both mutant proteins are similar to the wild-type fusion protein in their DNA-binding capacity but are unable to catalyze in vivo recombination.Integrons are DNA elements that capture genes, especially antibiotic resistance genes, by a site-specific recombination system (32). The recombination system consists of a DNA integrase (Int) and two types of recombination sites, attI and attC (59-base element). The integrase gene (int) is located in the 5′ conserved segment of the integron structure (Fig. (Fig.1)1) and is a member of the tyrosine recombinase family (1, 4, 13, 23, 24). Three types of integrases, sharing around 50% identity among themselves, have been identified; they define integron classes 1, 2, and 3 (30). The 5′ conserved segment found in class 1 integrons also contains a promoter region responsible for the expression of inserted cassettes (11, 21) and the recombination site attI1 (31). The 3′ conserved segment of the class 1 integrons includes an ethidium bromide resistance determinant (qacEΔ1), a sulfonamide resistance gene (sulI), an open reading frame (ORF5) of unknown function, and further sequences that differ from one integron to another (5, 6, 28). The 3′ conserved segment of class 2 integrons includes transposition genes (20) while that of class 3 integrons has not yet been studied (2). The variable region, located between the two conserved segments, usually contains antibiotic resistance genes; In0 contains no inserted genes while In21 possesses eight cassettes with ten genes (or ORFs) in this region (5, 16). These genes are part of mobile cassettes which include a recombination site, attC, that differs from one gene to another (18, 33). Incoming genes must be associated with an attC to be recognized by the integron integrase and are preferentially inserted at the recombination site attI1 (11). Cassettes are excised as circular intermediates and integrated at core sites by the action of the integrase (8–10). The core site, defined as GTTRRRY, makes up the 3′ end of attI1 and attC, with the crossover taking place between the G and the first T (19). Antibiotic selection pressure can reveal cassette rearrangements in which a given resistance is nearest the promoter and thus most strongly expressed (10). Open in a separate windowFIG. 1General structure of class 1 integrons. Cassettes are inserted in the integron variable region by a site-specific recombination mechanism. The attI1 site is shown by a black circle, core sites are represented by ovals, the attC site is indicated by a black rectangle, and promoters are denoted by P. intIl, integrase gene; qacEΔ1, antiseptic resistance gene; sulI, sulfonamide resistance gene; orf5, gene of unknown function.Site-specific recombination, unlike homologous recombination, is characterized by relatively short, specific DNA sequences and requires only limited homology of the recombining partners (12). Site-specific recombination is an entirely conservative process since all DNA strands that are broken (two per exchange site) are rejoined in a process that involves neither ATP nor DNA synthesis. Homology alignments of site-specific recombinases assign them to two families: the resolvase family, named after the TnpR proteins encoded by the transposons γδ and Tn3, and the integrase family. The integrase family includes over 140 members to date, but they are highly diversified proteins (13, 23). Members of this family, which include the well-studied λ integrase, recombine DNA duplexes by executing two consecutive strand breakage and rejoining steps and a topoisomerization of the reactants. The first pair of exchanges form a four-way Holliday junction and the second pair resolve the junction to complete the recombination. The integrase nucleophile is a conserved tyrosine that becomes associated with a phosphate group on DNA. The cleavage sites on each DNA duplex are separated by 6 to 8 bp with a 5′ stagger, and the tyrosine joins to the 3′ phosphate (17).The initial definition of the integrase family was based on comparisons of seven sequences, and three invariant residues were identified: an HXXR cluster and a Y residue (4). Alignment of 28 sequences identified a fourth invariant position, occupied by an arginine residue (1). These four conserved residues are found in two boxes located in the second half of the protein. A recent analysis has shown that the conserved histidine is present in 136 of the 147 members (93%); this residue is then not conserved in all members of the family (13). Another recent analysis has identified three patches of residues located around box I, which seem to be important in the secondary structure of these proteins (23). In this study, we analyzed the properties of several mutants of the conserved residues R146, R280, and Y312 of the integron integrase IntI1 in in vivo recombination and in vitro substrate binding.
Open in a separate windowaAkr, Apr, and Cmr, resistance to amikacin, ampicillin, and chloramphenicol. Open in a separate windowFIG. 3Electrophoresis of PCR products obtained with the pACYC184 primer pair and 100 ng of DNA preparations from overexpressed cultures on a 1% agarose gel. Lane 1, 1-kb DNA ladder (Gibco BRL); lane 2, DNA preparation of pLQ428-pLQ377 (R146E); lane 3, pLQ428-pLQ378 (R146I); lane 4, pLQ428-pLQ376 (R146K); lane 5, pLQ428-pLQ379 (R146V); lane 6, pLQ428-pLQ390 (R280E); lane 7, pLQ428-pLQ388 (R280G); lane 8, pLQ428-pLQ391 (R280K); lane 9, pLQ428-pLQ394 (Y312F); lane 10, pLQ428-pLQ393 (Y312S); lane 11, pLQ428-pLQ369 (wild type); lane 12, pLQ428-pMAL-c2 (MBP).The 2,499-bp PCR product was not obtained in the reaction containing the wild-type MBP-IntI1-expressing clone pLQ369 (Fig. (Fig.3,3, lane 11), indicating that there were no remaining full-length pLQ428 molecules. This shows that the wild-type fusion protein is very efficient in site-specific recombination and that all pLQ428 clones have undergone an excision of one or both cassettes. In this PCR, we observed two major bands of 1,341 and 889 bp. The 1,341-bp PCR product was digested with restriction enzymes to show that it represents a pLQ428 clone which has lost the aacA1-ORFG cassette (data not shown). The 889-bp band was also digested with restriction enzymes to show that it represents a pLQ428 clone which has lost both aacA1-ORFG and ORFH cassettes (data not shown). These two PCR products are also observed in the reaction containing the mutant clone pLQ391, which expresses the MBP-IntI1(R280K) fusion protein. This mutant protein is, however, less efficient than the wild-type protein, as seen by the intensity of the PCR products (Fig. (Fig.3,3, lane 8). We were not able to detect a PCR product of 2,047 bp, corresponding to the excision of the ORFH cassette alone; this is not surprising since this event has been shown in another study to be rare (16). It is possible to observe another band in pLQ428-pLQ391 (R280K) and pLQ428-pLQ369 (wild type) PCRs (Fig. (Fig.3,3, lanes 8 and 11); this PCR product is 1,100 bp long and probably represents a recombination event at a secondary site. Restriction enzyme digestions were done on this product, but we were unable to identify its origin. This product results from an event mediated by the integron integrase since it is seen only in reactions containing active proteins. An 1,800-bp PCR band is also present in the negative control and in all PCRs containing a mutant clone. This product appears to be nonspecific, and the fact that it is not seen in the PCR containing the pLQ428-pLQ369 (wild-type) clones probably results from the PCR being more favorable to smaller PCR products.
Open in a separate windowaLess efficient than the wild-type protein. bND, not determined. We have also made proteins with mutations at position 280; these were MBP-IntI1(R280E), MBP-IntI1(R280G), and MBP-IntI1(R280K). We found that the MBP-IntI1(R280K) mutant protein binds the attI1 site and excises integron cassettes with a lower efficiency than the wild-type MBP-IntI1, while MBP-IntI1(R280E) and MBP-IntI1(R280G) have completely lost both phenotypes. The Flp(R308K) mutant protein has been shown to bind DNA as well as the wild-type protein, but it recombines DNA with a lower efficiency than wild-type Flp (27). Another mutant protein of Flp [Flp(R308G)] has also been shown to bind DNA as well as the wild-type protein, but it was unable to catalyze in vivo or in vitro recombination (27). These results show that Flp(R308K) and MBP-IntI1(R280K) act similarly but that the other Flp mutant [Flp(R308G)] can bind DNA while the MBP-IntI1 mutant [MBP-IntI1(R280G)] cannot (Table (Table2).2). We also think that the positive charge of this residue is important for the binding of the recombinase to DNA, but Arg-280 does not seem to be implicated in the positioning of the tyrosine residue, since the MBP-IntI1(R280K) mutant protein can perform recombination.We found that MBP-IntI1(Y312S) and MBP-IntI1(Y312F) mutant proteins bind the attI1 site with the same efficiency as the wild-type protein but are not able to catalyze in vivo recombination. As expected, these results are the same as those obtained with the lambda integrase [λ(Y342F)], the XerC and XerD recombinases [XerC(Y275F) and XerD(Y279F)], and the Flp recombinases [Flp(Y343S) and Flp(Y343F)] (Table (Table2)2) (3, 22, 26, 29). The loss of the catalytic activity of the MBP-IntI1(Y312F) mutant protein is not surprising, since the hydroxyl group of the tyrosine, which is responsible for the nucleophilic attack of the DNA at the recombination site, is not present on the phenylalanine residue. The phenotype of MBP-IntI1(Y312S) indicates that the conformation of the tyrosine residue is important for the good activity of the recombinase, because even if the serine residue has a hydroxyl group, it is not able to catalyze recombination. These results indicate that the integron integrase IntI1 uses the hydroxyl group of the conserved tyrosine (Y312) to catalyze site-specific recombination, like other members of the family. However, in vitro recombination using this mutant protein needs to be done to confirm this.These results of point mutations show that mutations of the conserved arginines by nonpositively charged residues abolish substrate recognition, unlike the corresponding mutants of other members of the family. However, further mutational analysis, such as of residues around and in patch III, would be interesting, since only integron integrases contain more residues in this region than other members of the family (23). In vitro recombination assays with purified mutant proteins also need to be done in order to study thoroughly the mechanism of site-specific recombination in integrons. 相似文献
Construction of plasmids overexpressing mutant MBP-IntI1 fusion proteins.
The plasmids encoding various mutants of MBP-IntI1 were constructed by PCR using pLQ369 (50 ng) as a template (15). Two primer pairs, designed with the OLIGO software package (version 4.1; National Biosciences, Plymouth, Minn.), were used to construct each set of mutants. The R146 mutants were constructed with an XcmI-BamHI primer pair [IntI1(R146)-XcmI, 5′-TTCACCAGCTTCTGTATGGAACGGGCATG(A/G)(A/T)AATCAG-3′; IntI1(R146)-BamHI, 5′-CCGGATCCCTACCTCTCACT-3′], the R280 mutants were constructed with an NruI-XmnI primer pair [IntI1(R280)-NruI, 5′-AGCCGTCGCGAACGAGTGC(C/T)(C/T)GAGGG-3′; IntI1(R280)-XmnI, 5′-ACCCCTAATGAAGTGGTTCGTATCC-3′], and the Y312 mutants were constructed with a AatII-ScaI primer pair [IntI1(Y312)-AatII, 5′-ATTCCGACGTCTCTACTACGATGATTT(C/T)CACGC-3′; pLQ369-ScaI, 5′-ATGCTTTTCTGTGACTGGTG-3′] (restriction sites within primer sequences are underlined). PCR conditions were 10 min at 94°C, three cycles consisting of 45 s at 94°C, 45 s at 47°C, and 90 s at 72°C, 30 cycles consisting of 45 s at 94°C, 45 s at 60°C (50°C for Y312 mutants), and 90 s at 72°C, and a final elongation step of 10 min at 72°C. The XcmI, NruI, and AatII primers were degenerate in one or two positions, so that a single primer could give all mutants. Mutant PCR fragments were digested and cloned directly into pLQ369 digested with the same enzymes, except for the R146 mutant fragments that were subcloned into pLQ364 at first. New mutant PCR fragments were then amplified on these subclones, using IntI1(R146)-BamHI and IntI1(R280)-XmnI primers. These mutant PCR fragments were cleaved with BamHI and XmnI, and the resulting fragments were cloned into pLQ369. This avoids the necessity of partial digestion of pLQ369 with XcmI. Mutant clones were digested with restriction endonucleases and sequenced to determine the mutation.In vivo recombination.
Mutant MBP-IntI1 clones were introduced into Escherichia coli TB1 {F′ araΔ(lac-proAB) rpsL (Strr) [φ80dlacΔ(lacZ)M15] hsdR(rK−mK−)} containing pLQ428 by transformation (Fig. (Fig.22 and Table Table1).1). E. coli TB1 cells containing pLQ428 and one of the MBP-IntI1 mutants were grown at 37°C for 3 h in Luria-Bertani medium. Excision of the aacA1-ORFG and/or ORFH cassettes was induced by the overexpression of the malE-intI1 gene by using 0.3 mM isopropyl-β-d-thiogalactopyranoside (IPTG; Sigma Chemical Co.) and by incubation at 37°C for another 3 h. Cell culture was done in the presence of 50 μg of ampicillin per ml, 15 μg of amikacin per ml, and 50 μg of chloramphenicol per ml. Plasmid DNA was then prepared from 5-ml cultures with the Perfect Prep DNA extraction kit (Mandel Corporation). In order to determine the capacity of mutant MBP-IntI1 proteins to excise aacA1-ORFG and/or ORFH cassettes of In21, we used PCR primers pACYC184-5′ (5′-TGTAGCACCTGAAGTCAGCC-3′) and pACYC184-3′ (5′-ATACCCACGCCGAAACAAG-3′) (Fig. (Fig.2,2, primers 1 and 2) to detect the reduction of pLQ428 length. PCR conditions were 10 min at 94°C, 30 cycles consisting of 1 min at 94°C, 1 min at 60°C, and 5 min at 72°C, and a final elongation step of 10 min at 72°C. A major PCR fragment can be seen in each lane containing a DNA preparation from a mutant clone (Fig. (Fig.3,3, lanes 2 to 9). This band is 2,499 bp long and, as determined by restriction enzyme digestions, represents the pLQ428 clone without any cassette excision (data not shown). This band is also observed in the negative control, which is the pMAL-c2 vector without any gene fused to malE (Fig. (Fig.3,3, lane 12). Open in a separate windowFIG. 2Representation of plasmids used in this study. The positions of the three invariant residues of the integrase family are indicated, along with restriction sites used to construct mutant proteins. Core sites are represented by black circles, and attCs are shown by white boxes. The numbered arrows represent the PCR primers used to detect excision events, pACYC184-5′ (1) and pACYC184-3′ (2). bla, gene encoding β-lactamase; cat, gene encoding chloramphenicol acetyltransferase; intIl, gene encoding the integron integrase (IntI1); malE, gene encoding the maltose binding protein (MBP); ori, origin of replication; Ptac, tac promoter; Ptet, tetracycline promoter. Only relevant restriction sites are indicated.TABLE 1
Plasmids used in this studyPlasmid | Characteristic(s)a | Reference or source |
---|---|---|
pLQ363 | 2,190-bp EcoRI-HincII fragment of pLQ161 cloned in pLQ402 (Apr) | 16 |
pLQ364 | 1,027-bp NcoI-BamHI PCR fragment amplified on pLQ860 and cloned in pET-3d (Apr) | This study |
pLQ369 | 1,019-bp NdeI-BamHI PCR fragment modified to create a blunt-end 5′-ATG and cloned in pMAL-c2 cut with XmnI-BamHI (Apr) | 15 |
pLQ376 | pLQ369 MBP-IntI1(R146K) (Apr) | This study |
pLQ377 | pLQ369 MBP-IntI1(R146E) (Apr) | This study |
pLQ378 | pLQ369 MBP-IntI1(R146I) (Apr) | This study |
pLQ379 | pLQ369 MBP-IntI1(R146V) (Apr) | This study |
pLQ388 | pLQ369 MBP-IntI1(R280G) (Apr) | This study |
pLQ390 | pLQ369 MBP-IntI1(R280E) (Apr) | This study |
pLQ391 | pLQ369 MBP-IntI1(R280K) (Apr) | This study |
pLQ393 | pLQ369 MBP-IntI1(Y312S) (Apr) | This study |
pLQ394 | pLQ369 MBP-IntI1(Y312F) (Apr) | This study |
pLQ428 | 2,133-bp EcoRI (filled in)-BglII fragment of pLQ363 cloned in pACYC184 cut with EcoRV-BamHI (Akr Cmr) | This study |
pLQ860 | 2,900-bp BamHI fragment of pVS1 cloned in pTZ19R (Apr Sulr) | 5 |
In vitro substrate binding.
The experiments described above demonstrate that only one of our mutants of IntI1 protein is able to catalyze in vivo recombination. Can all mutant proteins recognize and bind to the IntI1 recombination site in a manner similar to the wild-type protein? To investigate this question, we used purified fusion proteins and a gel retardation assay with the complete attI1 site (5′ site) of the integron. MBP-IntI1 fusion proteins were purified as suggested by New England Biolabs. The concentration of the purified fusion protein was determined by using the Bradford protein assay (Bio-Rad). The protein solution was then made 20% in glycerol and stored at −80°C. The purity of MBP-IntI1 was evaluated as >90% by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (data not shown). Binding reactions were done with labeled 5′-site DNA fragments (20,000 cpm, 0.25 pmol), incubated with different concentrations of MBP-IntI1 in a 10-μl volume containing 10 mM HEPES (K+, pH 8.0), 60 mM KCl, 4 mM MgCl2, 100 μM EDTA (pH 8.0), 100 μg of bovine serum albumin per ml, 250 μM dithiothreitol, 100 ng of poly(dI-dC), and 10% glycerol. Reaction mixtures were incubated at room temperature for 15 min prior to electrophoresis through 4 or 5% prerun, nondenaturing polyacrylamide gels buffered with 0.5× Tris-borate-EDTA. Dried gels were subjected to autoradiography. The wild-type fusion protein and native IntI1 were shown to lead to the same four distinct complexes (I, II, III, and IV) with this DNA substrate (Fig. (Fig.4)4) (15). These complexes represent the binding of four IntI1 molecules to four different sites in the attI1 site (15). Figure Figure44 shows results obtained with nine mutants of the MBP-IntI1 fusion protein. We observed that MBP-IntI1(R146E), MBP-IntI1(R146I), and MBP-IntI1(R146V) lost their ability to bind to the attI1 site, as no complexes are seen in the gel retardation experiment (Fig. (Fig.4A).4A). However, MBP-IntI1(R146K) formed four IntI1-DNA complexes with the 5′ site DNA fragment. The band pattern and the intensity observed with this mutant protein are similar to those observed with the wild-type protein, suggesting that MBP-IntI1(R146K) and MBP-IntI1 bind DNA with similar affinities. Open in a separate windowFIG. 4Binding of mutant MBP-IntI1 fusion proteins purified from E. coli TB1 to the 5′-site DNA fragment containing the complete attI1 site of the In2 integron (from nucleotide −96 to nucleotide +71, relative to the G residue of the core site as position 0). (A) MBP-IntI1(R146) mutants; (B) MBP-IntI1(R280) mutants; (C) MBP-IntI1(Y312) mutants. A purified labeled fragment was incubated with different concentrations of mutant fusion proteins. Free DNA (F) and protein-DNA complexes (I, II, III, and IV) were separated on 4 or 5% polyacrylamide gels and are indicated by arrows. Lanes 1, free DNA; lanes 2 through 7, purified fusion protein at 250, 375, 500, 12.5, 37.5, and 62.5 nM, respectively. The wild-type (WT) lanes in panel C were from a separate gel.Competition with a specific fragment with a 30-fold excess of unlabeled DNA competed away all four complexes, while a 100-fold excess of a nonspecific unlabeled DNA fragment did not compete away any complexes, indicating their specificity (data not shown) (15). We observed that MBP-IntI1(R280G) and MBP-IntI1(R280E) lost their ability to bind the 5′-site DNA fragment, while the MBP-IntI1(R280K) could still bind the attI1 site (Fig. (Fig.4B).4B). However, the band pattern obtained with this mutant protein is weaker than that obtained with the wild-type integrase. For example, at a protein concentration of 250 nM MBP-IntI1(R280K) (lane 2), we observed the formation of complexes I, II, and III, with a stronger intensity for the fastest-migrating complexes, while the intensity of the fourth complex was very weak. At the same concentration of the wild-type protein, we observed the formation of all four complexes, with a stronger intensity for the slowest-migrating complexes and no unbound DNA. These results show that MBP-IntI1(R280K) binds the attI1 site with a lower affinity than the wild-type fusion protein. As shown in Fig. Fig.4C,4C, both MBP-IntI1(Y312F) and MBP-IntI1(Y312S) lead to the formation of four complexes that migrate similarity to those obtained with wild-type MBP-IntI1, as judged by the gel migration of these complexes. The band pattern observed shows that the binding affinity of these mutant proteins is the same as or even better than that of the wild-type protein.Relationships with other members of the family.
We found that MBP-IntI1 recombinase in which Arg-146 has been changed to lysine [MBP-IntI1(R146K)] by PCR mutagenesis cannot excise cassettes but can bind to the attI1 site with the same efficiency as the wild-type fusion protein. However, MBP-IntI1(R146I), MBP-IntI1(R146E), and MBP-IntI1(R146V) mutant proteins have completely lost both phenotypes. These findings are different from those for other members of the family. The only mutant protein of the lambda integrase at this residue [λ(R212Q)] binds the core site partially and is not able to catalyze in vivo or in vitro recombination (22). Mutants of the Cre recombinase with a change at this residue [Cre(R173K)] bind DNA as well as the wild-type protein but cannot catalyze in vivo or in vitro recombination (1). Mutants of Flp [Flp(R191K) and Flp(R191E)] bind FRT recombination sites as well as the wild-type protein but cannot carry out in vivo or in vitro recombination, except for the Flp(R191K) protein, which has shown slight activity in in vivo recombination (Table (Table2)2) (7, 14, 25). Therefore, the Cre(R173K) and Flp(R146K) mutants have the same phenotype as the MBP-IntI1(R146K) protein. However, the Flp(R191E) mutant protein shows efficient DNA binding while MBP-IntI1(R146E) does not bind to the attI1 site. We interpret these results according to the charge of the Arg-146 residue. The positively charged side chain of this residue makes contact with the DNA, which is negatively charged. This contact is probably important for the good conformation of the protein molecule in positioning the tyrosine residue to perform recombination. When this residue is exchanged for a lysine, DNA contacts are still able to take place because of the charge of the residue, but the side chain is smaller and the lysine is probably not able to position the tyrosine to catalyze recombination. We think that the charge of this residue is very important in the formation of DNA-protein complexes in the integron system, since all other MBP-IntI1 mutants tested are unable to bind DNA. This observation differs from those for Flp, because even when the wild-type residue was replaced by a negatively charged one, it could still bind DNA as well as the wild-type protein (Table (Table2).2).TABLE 2
Mutational analysis of IntI1 and corresponding residues of other recombinases from the Int familyRecombinase | Mutation | DNA binding | Recombination | Reference(s) |
---|---|---|---|---|
λInt | R212Q | Yesa | No | 22 |
λInt | Y342F | Yes | No | 22, 26 |
Flp | R191E | Yes | No | 7 |
Flp | R191K | Yes | Yes | 7, 14 |
Flp | R308G | Yes | No | 27 |
Flp | R308K | Yes | Yesa | 27 |
Flp | Y343F | Yes | No | 29 |
Flp | Y343S | Yes | No | 29 |
Cre | R173K | Yes | No | 1 |
P2 | R272K | NDb | No | 23 |
XerC | Y275F | Yes | No | 3 |
XerD | Y279F | Yes | No | 3 |
IntI1 | R146E | No | No | This study |
IntI1 | R146I | No | No | This study |
IntI1 | R146K | Yes | No | This study |
IntI1 | R146V | No | No | This study |
IntI1 | R280E | No | No | This study |
IntI1 | R280G | No | No | This study |
IntI1 | R280K | Yes | Yesa | This study |
IntI1 | Y312F | Yes | No | This study |
IntI1 | Y312S | Yes | No | This study |
8.
9.
10.
11.
12.
13.
Yoshiaki Okada Eri Abe Katsutoshi Komuro Toshiaki Mizuochi 《Journal of virology》1998,72(3):2541-2543
Heterosexual transmission of a murine leukemia virus mixture named LP-BM5 MuLV, which is known as the murine AIDS virus, was investigated. Our results indicated that the heterosexual transmission of LP-BM5 MuLV occurs in both directions with high frequency and that the frequencies of virus transmission in the cervix and penis are higher than those in other genital organs. The results suggested that infection by LP-BM5 MuLV via heterosexual transmission may initially take place at particular retrovirus-sensitive sites (cells) in the genital organs.Human immunodeficiency virus (HIV) infection is now pandemic. In many countries, HIV has been spread mainly by heterosexual transmission (3, 5). For the prevention of HIV infection, as well as for the development of vaccines against HIV, it is of a great importance to understand the mechanisms of the heterosexual transmission of retroviruses. Since it is difficult to investigate the mechanisms of heterosexual transmission of HIV in humans experimentally, an animal model with a retrovirus which induces an acquired immunodeficiency syndrome like human AIDS would be useful. A murine leukemia virus mixture called LP-BM5 MuLV induces a severe acquired immunodeficiency syndrome termed murine AIDS (MAIDS) in susceptible strains of mice (10). The mixture includes a replication-competent ecotropic virus, mink cell focus-inducing virus, and a replication-defective virus which has been considered to be involved in the pathogenesis of MAIDS (4). With many similarities to human AIDS patients, mice infected with the LP-BM5 MuLV mixture develop splenomegaly, systemic lymphadenopathy, and severe immunodeficiency (4, 11). We previously reported that maternal transmission of LP-BM5 MuLV occurs via mother’s milk with high frequency (12). In the present study, we demonstrate that the heterosexual transmission of LP-BM5 MuLV also occurs with high frequency via genital organs.C57BL/10 (B10) mice were purchased from Japan SLC Inc., Shizuoka, Japan. All mice were specific-pathogen free and were housed in an air-conditioned room. They were given autoclaved water and sterilized pelleted feed. An SC-1 clone chronically infected with LP-BM5 MuLV, the G6 cell line, was kindly supplied by H. C. Morse III, National Institutes of Health, Bethesda, Md. Virus was prepared from the supernatant of G6 cells as previously described (12). The virus preparation was stored at −70°C until use. B10 mice were inoculated by the intraperitoneal route with 0.3 ml of the LP-BM5 MuLV preparation. To increase the frequency of sexual contacts and to avoid pregnancy in the female mice, all male mice were sterilized by vasectomy under anesthesia with pentobarbital (Nembutal). The vasectomized male mice were mated with female mice at least 4 weeks postoperation, since sperm are usually kept alive for 2 to 3 weeks in spermiducts. Excised genital organs were crushed with plastic sticks in 1 ml of lysis buffer containing 10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5% sodium dodecyl sulfate, and proteinase K (0.5 mg/ml). Spleen cells were lysed after hemolysis with 0.83% NH4Cl. Lysed samples were incubated at 50°C for 3 h. DNA was extracted three times with phenol-chloroform, precipitated with cold ethanol, treated with RNase and proteinase K, and dissolved in 0.1 ml of H2O. LP-BM5 MuLV defective virus genome was detected by Southern blot hybridization combined with PCR as described previously (12). In brief, template DNAs (1 μg per tube) were added to a cocktail adjusted to final concentrations of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 200 μM deoxynucleoside triphosphate, 100 pmol of each primer (5′-CCTCTTCCTTTATCGACACT-3′ [sense] and 5′-ATTAGGGGGGGAATAGCTCG-3′ [antisense]), and 2 U of Taq DNA polymerase (Boehringer Mannheim) in a total volume of 100 μl and were subjected to 32 cycles of amplification. In each cycle of PCR, the mixture was denatured at 95°C for 1 min (5 min for the first cycle), annealed at 55°C for 3 min, and extended at 72°C for 1 min. The PCR-amplified products were subjected to gel electrophoresis (1.5% agarose) and transferred to a Hybond N+ membrane (Amersham) by the alkaline blotting method. Hybridization was achieved with a 5′ 32P-labeled probe (5′-TGTCAAAGGGACCAGTTAAG-3′) at 45°C overnight in 6× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)–0.5% sodium dodecyl sulfate–100 μg of salmon sperm DNA per ml. Hybridized membranes were washed twice in 2× SSC at 37°C for 10 min and then in 0.5× SSC at 45°C for 30 min. DNA derived from uterine cervices of uninfected mice was used as a negative control. The limit of sensitivity was approximately 10 copies per tube, as assessed by Southern blot analysis with plasmid DNAs (1/10 of the PCR product).Concanavalin A (ConA) was obtained from Pharmacia Fine Chemicals, Uppsala, Sweden. Responder spleen cells (2 × 105) were cultured with ConA (5 μg/ml) in 96-well flat-bottomed microculture plates in 0.2 ml of culture medium at 37°C in 7.5% CO2. The culture medium consisted of RPMI 1640 supplemented with 10% fetal calf serum, penicillin (5,000 IU/100 ml), streptomycin (5,000 μg/100 ml), nonessential amino acids, sodium pyruvate (11.0 mg/100 ml), 2-mercaptoethanol (5 × 10−5 M), and l-glutamine (29.2 mg/100 ml). On day 2, cultures were pulsed with 1 μCi of [3H]thymidine and incubated for an additional 12 to 18 h. Incorporation of [3H]thymidine into responder spleen cells was quantitated by liquid scintillation counting. Determinations were performed in triplicate; standard errors of the means were generally <5% and therefore have not been indicated.As illustrated in Fig. Fig.1,1, in order to investigate the heterosexual transmission of LP-BM5 MuLV from male to female mice, normal male mice were inoculated with LP-BM5 MuLV and vasectomized 1 week later. At 5 weeks after virus inoculation, they were mated with uninfected female mice. After 8 weeks of breeding, female mice were sacrificed and their vaginae, cervices uteri, corpora uteri, inguinal lymph nodes, and spleens were removed and stored at −70°C until use. In the opposite direction, to investigate virus transmission from female to male, normal female mice were inoculated with LP-BM5 MuLV and then mated with uninfected, vasectomized male mice as described above. After 8 weeks of breeding, male mice were sacrificed and their penes, prepuces, inguinal lymph nodes and spleens were removed and stored at −70°C until use. Figure Figure22 shows the detection by PCR of the LP-BM5 defective virus genome in genital organs and spleens that were taken from mice mated with their virus-infected counterparts. It was demonstrated that although the defective virus genome was detected in both spleens and genital organs in some male mice (2 of 17 [see Table Table1]),1]), as shown in Fig. Fig.2,2, lanes 3 and 4, the defective virus genome was detected only in the genital organs, not the spleens (Fig. (Fig.2,2, lanes 5 and 6), from most of the male mice. In contrast, all of the female mice were positive for defective virus genome only in the genital organs (Fig. (Fig.2,2, lanes 1 and 2). None of the mice examined were positive for the virus genome only in the spleens (this issue is discussed below). It should be noted here that the efficacy of PCR amplification, which was measured by experiments using the mixture of genomic DNA and plasmid DNA containing the defective virus, did not differ among the genital organs and spleens. By using the above strategy, the heterosexual transmission of LP-BM5 MuLV was investigated according to the protocol shown in Fig. Fig.1.1. Open in a separate windowFIG. 1Experimental design for examination of heterosexual transmission of the MAIDS virus in B10 mice. i.p., intraperitoneal.Open in a separate windowFIG. 2Detection of the LP-BM5 MuLV defective virus genome by PCR in genital organs and spleens. The template DNAs (1 μg) derived from female or male mice which were bred with LP-BM5 MuLV-infected mice were amplified by PCR. Samples were prepared from either female (lanes 1 and 2) or male (lanes 3 to 6) mice. Lanes 1, 3, and 5, spleen; lane 2, uterine cervix; lanes 4 and 6, penis (from two representative male mice). The PCR products (5 μl) were applied to a 1.5% agarose gel and analyzed by Southern blotting with a probe for the defective virus (12).
Open in a separate windowaND, not done. Twenty-five female mice that were mated with the virus-infected male mice were analyzed for the presence of LP-BM5 defective genome in their genital organs, lymph nodes, and spleens. As summarized in Table Table1,1, the defective virus genome was detected with high frequency in cervices (9 of 25). However, the defective virus genome was not detected in spleens at all (0 of 25). The female genital organs are divided into three parts, namely, the vagina, cervix of uterus, and corpus of uterus. As also shown in Table Table1,1, the cervix appears to be more sensitive to virus infection than the other organs. Since MAIDS virus was not detected in castrated female mice, which were kept with virus-infected male mice in the same cage, the virus infection occurred via heterosexual transmission rather than by nonheterosexual horizontal transmission (data not shown). In 17 male mice mated with the virus-infected female mice (Table (Table1),1), the defective virus genome was detected in penes with high frequency (11 of 17). The defective virus genome was detected in DNA prepared from spleens with much lower frequency (2 of 17). In male mice, the penis seems to be much more sensitive to virus infection than are the prepuce and spleen (Table (Table1).1). In experiments 1 and 3, we also examined the inguinal lymph nodes from 16 female mice and 8 male mice. The defective virus genome was detected in some of the male mice (3 of 8) but not at all in the female mice examined. These results suggest that the LP-BM5 MuLV mixture initially infects the cervix or penis and then spreads over the whole body, including the lymph nodes and spleen.To determine whether mice infected with LP-BM5 MuLV by heterosexual transmission in fact develop MAIDS, we examined both spleen weights and mitogen (ConA) responses of female mice at 10 months after mating. As shown in Table Table2,2, female mice which were infected with LP-BM5 MuLV by heterosexual transmission (i.e., the defective virus genome was detected in the cervix) developed MAIDS as assessed by splenomegaly and decreased mitogen response, although the symptoms were less severe than of mice directly infected with LP-BM5 MuLV via the intraperitoneal route. Therefore, the cells in the genital organs were not only infected by the MAIDS virus but also able to replicate and spread the virus.
Open in a separate windowThe main route of HIV infection is heterosexual transmission (3, 5). However, the mechanisms of heterosexual transmission of retroviruses have been ill defined. HIV infection has been thought to occur during sexual contacts through slight injuries in the genital organs and to subsequently spread over the whole body. Among the genital organs of females, the parts of direct contact with male genital organs and semen are the vagina and cervix of uterus. The vagina is covered by a thick stratified squamous epithelium, while the cervix is covered by a monolayer columnar epithelium in addition to a squamous epithelium (2, 7). Histological examination (13) showed the presence of HIV-infected cells in the cervices derived from HIV carrier females (those infected with HIV by drug injections rather than by heterosexual transmission). Furthermore, a previous study utilizing female chimpanzees demonstrated that transmission of HIV could occur by insertion of cotton containing HIV into the vagina (8). These results suggested the presence of retrovirus-sensitive cells in genital organs. In our study, the cervix and penis are shown to be sensitive sites for virus infection (Table (Table1).1). Our assumption that there might be retrovirus-sensitive cells in a particular genital organ is currently under investigation by using in situ hybridization and immunohistochemical analyses.The heterosexual LP-BM5 MuLV infection rate for females to males appeared to be higher than that for males to females (Table (Table1).1). The mating frequency of normal male mice with infected female mice is supposed to be higher than that of normal female mice with infected male mice, since normal female mice fall into false pregnancy after mating and therefore reject male mice for a few weeks. This difference may also be attributed to the longer retention of genital secretions containing LP-BM5 MuLV in the male genital organs because of their phimoses (9). In fact, the defective virus genome was detected in vaginal secretions (both in secreted fluid and cells) by PCR (data not shown). Alternatively, the penis might be a highly sensitive site for retrovirus infection. In this regard, it is interesting that the defective virus genome was detected with very low frequency (1 of 17 male mice) in the prepuce even though it is constantly in contact with the penis. It is worth mentioning that contamination by retroviruses in the seminal fluid may happen at the prostate, seminal vesicle, vas deferens, Cowper’s glands, or penile urethra, since the sterilized (vasectomized) mice were still capable of transmitting the viruses to female mice (1, 6).The animal model for heterosexual transmission of retroviruses presented here has practical advantages, including (i) the high frequency of virus transmission and (ii) the possibility of rapid and cost-effective screening for antiretroviral agents (drugs and vaccines, etc.). This model may provide valuable information relating to heterosexual transmission of retroviruses including HIV and may further contribute to the prevention of HIV infection and the development of a remedy for AIDS. 相似文献
TABLE 1
Heterosexual transmission of LP-BM5 MuLVExpt | Clinical condition
| Detection of LP-BM5 MuLV (no. positive/total [%])
| |||||||
---|---|---|---|---|---|---|---|---|---|
Male | Female | Spleen | Inguinal lymph node | Cervix | Corpus | Vagina | Penis | Prepuce | |
1 | MAIDS | Normal | 0/25 (0) | 0/16 (0) | 9/25 (36) | NDa | ND | ||
2 | MAIDS | Normal | 0/11 (0) | ND | 3/11 (27) | 0/11 (0) | 1/11 (9) | ||
3 | Normal | MAIDS | 1/8 (12) | 3/8 (38) | 6/8 (75) | 0/8 (0) | |||
4 | Normal | MAIDS | 1/9 (11) | ND | 5/9 (56) | 1/9 (11) |
TABLE 2
Development of MAIDS in heterosexually infected B10 miceClinical condition
| Spleen wt (mg) | Mitogen response (cpm) | Detection of LP-BM5 MuLV
| ||
---|---|---|---|---|---|
Male | Female | Spleen | Cervix | ||
Normal | Normal | 105 | 39,981 | − | − |
92 | 19,317 | − | − | ||
MAIDS | Normal | 136 | 10,346 | + | + |
186 | 7,799 | + | + | ||
245 | 4,911 | + | + |
14.
15.
Evidence for Interspecies Gene Transfer in the Evolution of 2,4-Dichlorophenoxyacetic Acid Degraders
Catherine McGowan Roberta Fulthorpe Alice Wright J. M. Tiedje 《Applied and environmental microbiology》1998,64(10):4089-4092
Small-subunit ribosomal DNA (SSU rDNA) from 20 phenotypically distinct strains of 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacteria was partially sequenced, yielding 18 unique strains belonging to members of the alpha, beta, and gamma subgroups of the class Proteobacteria. To understand the origin of 2,4-D degradation in this diverse collection, the first gene in the 2,4-D pathway, tfdA, was sequenced. The sequences fell into three unique classes found in various members of the beta and gamma subgroups of Proteobacteria. None of the α-Proteobacteria yielded tfdA PCR products. A comparison of the dendrogram of the tfdA genes with that of the SSU rDNA genes demonstrated incongruency in phylogenies, and hence 2,4-D degradation must have originated from gene transfer between species. Only those strains with tfdA sequences highly similar to the tfdA sequence of strain JMP134 (tfdA class I) transferred all the 2,4-D genes and conferred the 2,4-D degradation phenotype to a Burkholderia cepacia recipient.Bacteria capable of mineralizing 2,4-dichlorophenoxyacetic acid (2,4-D), a commonly used herbicide, are found in many different phylogenetic groups (2, 3, 7, 11, 22, 23). Evidence suggests that numerous variants of 2,4-D catabolic genes exist and that catabolic operons consist of a near-random mixing of these variants (7). Interspecies gene transfer is a well-documented phenomenon (13), and horizontal gene transfer of the 2,4-D-degrading plasmid pJP4 has been shown (3, 5). However, not all 2,4-D catabolic operons are found on plasmids (10, 11, 16, 20). The extent to which other 2,4-D genes have been exchanged in nature is unknown. The aim of this research was to assess the role of horizontal gene transfer in the evolution of 2,4-D-degrading strains. This article summarizes the results of two aspects of this work—the study of the transfer of the entire 2,4-D pathway by using standard mating experiments and a phylogenetic study of the tfdA gene. The tfdA gene codes for an α-ketoglutarate-dependent 2,4-D dioxygenase which converts 2,4-D into 2,4-dichlorophenol and glyoxylate (6). This 861-bp gene was first sequenced from Ralstonia eutropha JMP134 (19). Two more tfdA genes were cloned from chromosomal locations in Burkholderia strain RASC and Burkholderia strain TFD6 (16, 20). These proved to be identical to each other and 78.5% similar to the original. An alignment of the two variants allowed conserved areas to be identified and primers to be designed for the amplification of tfdA-like genes from other sources (24). Sequence analysis of putative tfdA fragments and the small-subunit ribosomal DNA (SSU rDNA) of the strains carrying them allowed us to construct phylogenies of the genes and their hosts and to look for congruency between them.
Open in a separate windowaThe generus and/or species most similar to the strain is given based on similarities of SSU rDNA sequences. bSymbols: +, able to transfer 2,4-D degradation to B. cepacia D5; (+), able to transfer at very low frequency; −, no transfer detected. cND, not determined. d—, no amplificate was obtained. The disappearance of 2,4-D from the culture medium was monitored by high-performance liquid chromatography. Cells were removed by centrifugation, and the supernatant was filtered through 0.2-μm-pore-size filters. These samples were then analyzed on a Lichrosorb Rp-18 column (Anspec Co., Ann Arbor, Mich.) with 60% methanol–40% 0.1% H3PO4 as the eluant. 2,4-D was detected by measuring light absorption at 230 nm. The presence of tfd genes was detected by hybridizing colony blots with a DNA probe derived from the entire pJP4 plasmid. The identity of the colonies was confirmed by probing with the nptII gene of Tn5 (found in B. cepacia D5). Probes were labeled with random hexanucleotides incorporating [32P]dCTP (3,000 Ci/mmol; New England Nuclear, Boston, Mass.). Hybridizations were done under high-stringency conditions by using 50% formamide and Denhardt’s solution (18) at 42°C. Of the 15 unique strains tested, 9 transferred 2,4-D degradation abilities to D5. This transfer was confirmed by hybridization with pJP4 for eight of these strains. B. cepacia RASC could transfer degradative abilities, but neither it nor the transconjugant hybridized to the pJP4 probe. Work subsequent to this study has confirmed that the genes carried by RASC do not hybridize to those found on pJP4 under high-stringency conditions (7).
Mating experiments.
A collection of 2,4-D degraders containing 15 unique strains as determined by genomic fingerprinting (7) was used as a source of donors in a series of mating experiments (Table (Table1).1). Burkholderia cepacia D5, lacking the ability to grow on 2,4-D and not hybridizing to any tfd genes, was used as a recipient in mating experiments. Strain D5 contains neomycin phosphotransferase genes (nptII) carried on transposon Tn5 and is resistant to 50 μg each of kanamycin, carbenicillin, and bacitracin per ml. All of the 2,4-D strains used were sensitive to these antibiotics. Filter matings were performed with a donor-to-recipient ratio of 1:10. Colonies which grew on selective medium (500 ppm of 2,4-D in mineral salts agar [MMO] [23] including 50 μg of kanamycin, carbenicillin, and bacitracin per ml) were subjected to further tests. Their ability to catabolize 2,4-D was tested in liquid medium (same composition as that described above).TABLE 1
2,4-D-degrading strains, geographic origins, and GenBank accession numbersStrain | GenBank accession no. (SSU rDNA) | Origin | Most similar to genus and/or speciesa | Transferb | tfdA typec | GenBank accession no. (tfdA gene) | Reference or source |
---|---|---|---|---|---|---|---|
JMP134 | AF049542 | Australia | Ralstonia eutropha | + | I | M16730 | 3 |
EML1549 | AF049546 | Oregon | Burkholderia sp. | + | I | 2 | |
TFD39 | AF049539 | Saskatchewan | Burkholderia sp. | + | I | U43197 | 23 |
K712 | AF049543 | Michigan | Burkholderia sp. | + | I | U43276 | 11 |
TFD9 | AF049537 | Saskatchewan | Alcaligenes xylosoxidans | + | I | U43276 | 23 |
TFD41 | AF049541 | Michigan | Ralstonia eutropha | + | I | 23 | |
TFD38 | AF049540 | Michigan | Ralstonia eutropha | + | NDc | 23 | |
TFD23 | AF049536 | Michigan | Rhodoferax fermentans | + | I | U43276 | 23 |
RASC | AF049544 | Oregon | Burkholderia sp. | (+) | II | U25717 | 2 |
TFD6 | AF049546 | Michigan | Burkholderia sp. | − | II | 23 | |
TFD2 | AF049545 | Michigan | Burkholderia sp. | − | II | 23 | |
TFD31 | AF049536 | Saskatchewan | Rhodoferax fermentans | − | III | 23 | |
B6-9 | AF049538 | Ontario | Rhodoferax fermentans | ND | III | U43196 | 9 |
I-18 | U22836 | Oregon | Halomonas sp. | ND | III | U22499 | 15 |
K1443 | AF049531 | Michigan | Sphingomonas sp. | − | —d | 11 | |
2,4-D1 | AF049535 | Montana | Sphingomonas sp. | − | — | R. Sanford | |
B6-5 | AF049533 | Ontario | Sphingomonas sp. | ND | — | 9 | |
B6-10 | AF049534 | Ontario | Sphingomonas sp. | ND | — | 9 | |
EML146 | AF049532 | Oregon | Sphingomonas sp. | − | — | 2 | |
M1 | AF049530 | French Polynesia | Rhodospeudomonas sp. | ND | R. Fulthorpe |
Phylogenetic analyses.
Total genomic DNA was isolated from 20 unique 2,4-D-degrading strains (including all 15 used for mating experiments) grown on 500 ppm of 2,4-D mineral salts medium amended with 50 ppm of yeast extract. SSU rDNA was amplified by using fD1 and rD1 as primers (25). Putative tfdA fragments were amplified by using primers TVU and TVL as previously described (24). PCR products were purified with a Gene Clean kit (Bio 101, La Jolla, Calif.). Sequencing was done with an Applied Biosystems model 373A automatic sequencer (Perkin-Elmer Cetus) by using fluorescently labeled dye termination at the Michigan State University Sequencing Facility. The sequencing primer used for SSU rDNA fragments was 519R (5′ GTA TTA CCG CGG CTG CTG G-3′). For tfdA fragments, the sequencing primers were the same as the amplification primers. GenBank accession numbers for these sequences are given in Table Table11.The SSU rDNA sequences were compared to sequences in GenBank by using the Basic Local Alignment Search Tool (BLAST) (1), and those strains with the highest maximal segment pair scores were retrieved from GenBank and included in the phylogenetic analysis. Sequences were aligned manually with the software SeqEd (Applied Biosystems) and with MacClade (14). Sites where nucleotides were not resolved for all sequences were deleted from the alignment, as were those nucleotides corresponding to the small loop in this region that is absent in the alpha subgroup of the class Proteobacteria. These deletions left 283 unambiguous sites for the construction of the SSU rDNA phylogenies. Phylogenetic trees were constructed by using the neighbor-joining analysis of pairwise Jukes-Cantor distances (4), and the topology was confirmed by using the maximum parsimony method PAUP (21). Desulfomonile tiedjei of the δ-Proteobacteria was used as an outgroup. Bootstrap analysis based on 100 replicates was used to place confidence estimates on the tree. Only bootstrap values of greater than 50 were used.2,4-D degrader diversity.
The 2,4-D degraders in this study were distributed throughout the alpha, beta, and gamma subgroups of the Proteobacteria (Fig. (Fig.1).1). The lack of representation of gram-positive bacteria is likely a reflection of isolation methods, not of the lack of gram-positive 2,4-D degraders. The majority of these strains were members of the beta subgroup of Proteobacteria, five of which were most closely related to the genus Burkholderia, having at least 92% sequence similarity with each other. Three were closely related to Rhodoferax fermentans (close to the class Comamonadaceae), three were related to Ralstonia eutropha, and one was related to Alcaligenes xylosoxidans. TFD39 falls outside any clear cluster. One member of the γ-Proteobacteria, strain I-18, a haloalkaliphile, was found to be closely related to the salt-loving genus Halomonas (15). The remaining six strains all clustered in the alpha branch of Proteobacteria (Fig. (Fig.1).1). Of this subgroup, five were most closely related to the genus Sphingomonas. One member of the α-Proteobacteria, strain M1, which is the most oligotrophic and slow growing of all the strains used in this study, is 97% similar to Rhodopseudomonas palustris. The character of strain M1 correlates well with its phylogenetic placement near the slow-growing genus Bradyrhizobium. Open in a separate windowFIG. 1Neighbor-joining dendrogram (Jukes-Cantor distances) of SSU rDNA from 2,4-D-degrading bacteria (indicated in boldface type) and reference strains (indicated in italic type). Class I (•), class II (▴), and class III (■) types of tfdA genes are indicated. Bootstrap confidence limits (percentages) are indicated above each branch. Scale bar represents a Jukes-Cantor distance of 0.01.tfdA gene fragments.
tfdA gene fragments were successfully amplified and sequenced from 10 strains of β-Proteobacteria and 1 strain of γ-Protobacteria. None of the strains from the α-Proteobacteria gave any amplificates with these primers. These 313 contiguous nucleotides were aligned with additional tfdA sequences from JMP134 and from strain RASC (Fig. (Fig.2).2). Three distinct classes of tfdA gene sequences with slight variations in each class were found. Class I included fragments from JMP134, TFD39, TFD23, K712, and TFD9 that differed from each other by 2 bp at the most. Class I tfdA genes are probably plasmid encoded. All strains with a class I tfdA gene examined so far contained broad-host-range, self-transmissible plasmids containing 2,4-D genes (2, 3, 11, 17). All of the strains with a class I tfdA gene were able to transfer the 2,4-D phenotype in the mating studies reported above. The class II tfdA sequences included identical fragments amplified from RASC, TFD6, and TFD2 which were 76% similar to those in class I. Class III included identical fragments from strains TFD31, B6-9, and I-18 which were 77% similar to class I genes and 80% similar to class II genes. Both class II and III tfdA genes differed from each other and from class I genes in the same nine sites corresponding to the third base pair of the codons. The tfdA phylogenetic tree is a simple one, with three distinct branches that are incongruent with the SSU rDNA-derived phylogeny (Fig. (Fig.3).3). Class I tfdA sequences were found in Burkholderia-like strains, in strains related to the Comamonas-Rhodoferax group, and in the Ralstonia-Acaligenes group, all in the β-Proteobacteria. Class II sequences are less widely distributed, found only in Burkholderia-like branches. However, even in this subgroup, this tfdA variant is found in strains that differ by 7% at the SSU rDNA level (RASC and TFD2). However, the class III sequences were most interesting, being found both in the Comamonas-Rhodoferax group and in a strain of the γ-Proteobacteria, I-18, strains that differ by 24% at the SSU rDNA level. Class III genes have since been found in a collection of randomly isolated non-2,4-D degraders, including gram-positive bacilli, as well as in various gram-negative bacteria, even though the gene is not expressed (10). Open in a separate windowFIG. 2Alignment of 313 nucleotides of internal fragments of tfdA genes from representative strains. Nucleotides identical to tfdA from pJP4 are represented by periods.Open in a separate windowFIG. 3Phylogenetic incongruency of tfdA genes and SSU rDNA from diverse 2,4-D-degrading bacteria. Dendrograms for tfdA and SSU rDNA are indicated. Shading indicates the type of tfdA sequence, either class I, II, or III. Note that branch lengths are not drawn to scale.An interesting result was the detection of two different tfdA gene variants in sibling strains. TFD23 and TFD31 are identical at the ribosomal gene level, but one harbors a class I gene and the other harbors a class III gene. Similarly, TFD6 and EML159 are rRNA siblings that carry a class II and class I gene, respectively.None of the α-Proteobacteria yielded a PCR product when amplified with the conserved tfdA primers. This finding complements our observation that none of these bacteria hybridized to the tfdA gene, even under conditions of low stringency, indicating that any tfdA-like genes in the α-Proteobacteria are likely to be more divergent from the ones sequenced here (7, 11). In addition, none of the Sphingomonas strains in the study hybridized with a whole pJP4 probe, and similarly, no Sphingomonas strains scored positive for transfer of 2,4-D-degrading ability to recipient B. cepacia D5. Together these results suggest a reduced gene flow between members of the α- and β- or γ-Proteobacteria or poor gene expression of β- or γ-derived genes by α-Proteobacteria. Although plasmid pJP4 is a broad-host-range plasmid and has been known to transfer to α-Proteobacteria such as Rhizobium and Agrobacterium species and to γ-Proteobacteria such as Pseudomonas putida, Pseudomonas fluorescens, and Pseudomonas aeruginosa, the 2,4-D pathway is not expressed in these strains of the α- or γ-Proteobacteria (3). Phylogenetically limited expression of plasmid-borne 3-chlorobenzoate-degradative genes has also been noted for the pseudomonads (8). Subsequent studies have found divergent but related sequences for the tfdB and tfdC genes in 2,4-D-degrading Sphingomonas strains (7, 12, 24).With the exceptions of the minor differences within the class I pJP4-like tfdA sequences, there were no intermediate tfdA sequences. The most likely explanation of this is that the rate of horizontal transfer of the tfd genes is high relative to the rate at which mutations can accumulate. Examination of sequences of tfdA genes from a greater variety of organisms may turn up more intermediate variation. 相似文献16.
17.
18.
Sabine Kirner Philip E. Hammer D. Steven Hill Annett Altmann Ilona Fischer Laura J. Weislo Mike Lanahan Karl-Heinz van Pée James M. Ligon 《Journal of bacteriology》1998,180(7):1939-1943
Pyrrolnitrin is a secondary metabolite derived from tryptophan and has strong antifungal activity. Recently we described four genes, prnABCD, from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin. In the work presented here, we describe the function of each prn gene product. The four genes encode proteins identical in size and serology to proteins present in wild-type Pseudomonas fluorescens, but absent from a mutant from which the entire prn gene region had been deleted. The prnA gene product catalyzes the chlorination of l-tryptophan to form 7-chloro-l-tryptophan. The prnB gene product catalyzes a ring rearrangement and decarboxylation to convert 7-chloro-l-tryptophan to monodechloroaminopyrrolnitrin. The prnC gene product chlorinates monodechloroaminopyrrolnitrin at the 3 position to form aminopyrrolnitrin. The prnD gene product catalyzes the oxidation of the amino group of aminopyrrolnitrin to a nitro group to form pyrrolnitrin. The organization of the prn genes in the operon is identical to the order of the reactions in the biosynthetic pathway.The antibiotic pyrrolnitrin [3-chloro-4-(2′-nitro-3′-chlorophenyl)pyrrole] (PRN) is produced by many pseudomonads and has broad-spectrum antifungal activity (1, 5, 12–14, 17). PRN has been implicated as an important mechanism of biological control of fungal plant pathogens by several Pseudomonas strains (12–14), including P. fluorescens BL915, from which the prn genes were isolated (10).Tryptophan was identified as the precursor for PRN, based on the feeding of cultures with isotopically labeled and substituted tryptophan (2, 7, 8, 17, 25). Biosynthetic pathways were proposed as early as 1967 (7) and have been refined on the basis of tracer studies and the isolation of intermediates (Fig. (Fig.1)1) (2, 8, 17, 19, 23, 25). Recently, Hammer et al. (9) described the cloning and characterization of a 5.8-kb DNA region which encodes the PRN biosynthetic pathway. This DNA region confers the ability to produce PRN when expressed heterologously in Escherichia coli and contains four genes, prnABCD, each of which is required for PRN production. In the research described here, we used mutants in which each of the four genes was disrupted and strains which overexpress the individual genes to elucidate the function of each gene product in PRN biosynthesis. Open in a separate windowFIG. 1Biosynthetic pathways for PRN as proposed by van Pée et al. (23) (A) and by Chang et al. (2) (B). The reactions catalyzed by the PRN biosynthetic enzymes encoded by the prnABCD genes are indicated above the appropriate reaction arrows.
Open in a separate window
Open in a separate windowa+, PRN detected; −, PRN not detected. Hohaus et al. (11) presented additional evidence of the chlorinating activity of the prnA gene product, specifically, the chlorination of l-tryptophan to form 7-CLT by cell extracts from P. fluorescens strains which expressed the prnA gene, but which did not contain any of the other prn genes. To clarify which isomer was produced, Hohaus et al. (11) extracted 7-CLT from the bacteria and oxidized it to the corresponding indole-3-pyruvic acid with amino acid oxidases. Since the isolated 7-CLT was degraded by l-amino acid oxidase, but not by d-amino acid oxidase (11), it must be in the l configuration. The deduced amino acid sequence for prnA contains a consensus NAD binding site (9), and, indeed, NADH is a required cofactor for the prnA gene product.Cultures of BL915ΔORF2 produced 7-CLT, but 7-chloro-d-tryptophan (11) and other PRN biosynthetic intermediates were not detected (Fig. (Fig.3).3). BL915ΔORF2 produced PRN when supplied with exogenous MDA or APRN, but not when supplied with 7-CT (Table (Table2).2). When prnB was expressed in strain BL915ΔORF1–4, exogenously supplied 7-CT was converted to MDA (Fig. (Fig.4).4). These results indicate that the prnB gene product catalyzes the rearrangement of the indole ring to a phenylpyrrole and the decarboxylation of 7-CLT to convert 7-CLT to MDA. While it is somewhat surprising that a single enzyme carries out both the ring rearrangement and decarboxylation, Chang et al. (2) postulated a mechanism for such a reaction on a single enzyme some 16 years ago. The prnB gene product also catalyzed the production of APP (Fig. (Fig.4),4), presumably by using tryptophan as a substrate. Open in a separate windowFIG. 4In vivo conversion of PRN biosynthetic intermediates by the products of single prn genes. Individual genes were expressed on plasmids in the host strain BL915ΔORF1–4, and biosynthetic intermediates were added to the culture medium as indicated. Culture extracts were separated by TLC on silica plates with toluene as the mobile phase. Metabolites were visualized with van Urk’s reagent. Arrows indicate the positions of APP (dark green), MDA (olive green), APRN (reddish brown), and PRN (purple).MDA accumulated in cultures of BL915ΔORF3, but APP, APRN, and PRN were not detected (Fig. (Fig.3).3). BL915ΔORF3 was able to produce PRN when supplied with APRN in the culture medium, but not when supplied with 7-CT or MDA (Table (Table2).2). Strain BL915ΔORF1–4 expressing prnC converted exogenously supplied MDA to APRN (Fig. (Fig.4).4). These data indicate that the prnC gene product catalyzes the chlorination of MDA to form APRN. Cell extracts of the P. fluorescens strain which overexpresses the prnC gene (but does not contain the other prn genes) can also catalyze the chlorination of MDA to form APRN (11).The prnC gene is homologous to the chl gene from Streptomyces aureofaciens, which encodes a chlorinating enzyme for tetracycline biosynthesis (3, 9). Like prnA, the prnC deduced amino acid sequence contains a consensus NAD binding region (9), and NADH is required for the chlorination of MDA (11). While both prnA and prnC encode halogenating enzymes, they show no homology to previously cloned haloperoxidases (9) or to each other. Furthermore, in contrast to haloperoxidases (16), the two NADH-dependent halogenating enzymes in the PRN biosynthesis pathway are substrate specific (i.e., the tryptophan halogenase does not catalyze the chlorination of MDA and vice versa) (11).APRN accumulated in cultures of BL915ΔORF4 (Fig. (Fig.3),3), and this mutant was not able to produce PRN when supplied with any of the known PRN biosynthetic intermediates. Strain BL915ΔORF1–4 expressing prnD converted exogenously supplied APRN to PRN (Fig. (Fig.4).4). These results indicate that the prnD gene product catalyzes the oxidation of the amino group of APRN to a nitro group forming PRN. In vitro experiments by Kirner and van Pée (15) had suggested that this reaction is catalyzed by a chloroperoxidase; however, gene disruption experiments demonstrated that chloroperoxidases are not involved in PRN biosynthesis in vivo (16). Instead, this oxidation is more likely to be catalyzed by a class IA oxygenase (20), as suggested by the homology of prnD with these enzymes (9).We have shown that each prn gene encodes a protein found in the wild-type BL915 strain and have demonstrated in vivo that these four gene products carry out four biochemical steps which convert l-tryptophan to PRN. None of the conversions were observed in strain BL915ΔORF1–4, from which the entire 5.8-kb prn gene region has been deleted (Fig. (Fig.4).4). The arrangement of the genes in the operon is identical to the sequence of reactions in the biosynthetic pathway proposed by van Pée et al. (23) (Fig. (Fig.11).Chang et al. (2) proposed an alternate biosynthetic scheme (Fig. (Fig.1B)1B) and reported the conversion of exogenously supplied APP to PRN in vivo. Similarly, Zhou et al. (25) reported the conversion of APP to APRN in a cell-free system. These workers concluded that APP is an intermediate in PRN biosynthesis and that ring rearrangement precedes chlorination (Fig. (Fig.1B).1B). In the present study, APP accumulated only in strains which overexpressed the prnB gene. Furthermore, APP was not detected in cultures of BL915ΔORF1, which contains functional prnBCD genes expressed from the native promoter, as would be expected if the ring rearrangement (catalyzed by the prnB gene product) occurs before the first chlorination step (catalyzed by the prnA gene product). Like Hamill et al. (8) and van Pée et al. (23), we demonstrated that exogenously supplied 7-CT is converted to PRN. These results, together with the finding that the gene product of prnA catalyzes the NADH-dependent chlorination of l-tryptophan to 7-CLT (11), support the biosynthetic pathway proposed by van Pée et al. (23) (Fig. (Fig.1A)1A) and suggest that APP is a side product or dead-end metabolite. Purification and kinetic characterization of the prnA and prnB gene products, including investigations of substrate specificity and regioselectivity, will further clarify the roles of 7-CLT and APP in the PRN biosynthetic pathway.If APP is indeed a dead-end metabolite, it would be advantageous to tightly regulate the amount of prnB gene product present in cells, thus minimizing the diversion of substrate into APP. The prnB gene begins with GTG (9), which is a two- to threefold-less-efficient initiation codon than ATG (18); however, the prnB open reading frame is apparently translationally coupled to the prnA open reading frame (9). Coupling increases translational efficiency and is thought to be a mechanism to ensure coordinate expression of the coupled genes (18). In PRN biosynthesis, translational coupling of prnA and prnB may be a mechanism to regulate the level of prnB gene product present in cells and minimize the diversion of tryptophan to APP. 相似文献
Bacterial strains and plasmids.
The bacterial strains and plasmids used in this study are described in Table Table1.1. Pseudomonas strains were cultured in Luria-Bertani medium at 28°C. Antibiotics, when used, were added at the following concentrations: tetracycline, 30 μg/ml; and kanamycin, 50 μg/ml. The expression vector pPEH14 consists of the Ptac promoter and rrnB ribosomal terminator from pKK223-3 (Pharmacia, Uppsala, Sweden) cloned into the BglII site of the broad-host-range plasmid pRK290 (4). Ptac is a strong constitutive promoter in Pseudomonas (unpublished data). The PRN biosynthetic genes are the coding regions described by Hammer et al. (9). Each coding region was cloned from the translation initiation codon to the stop codon by PCR with restriction sites added to the ends to facilitate cloning. For prnB, the native GTG initiation codon was changed to ATG. The clones were sequenced after PCR.TABLE 1
Bacterial strains and plasmids used in this studyP. fluorescens strain or plasmid | Characteristics | Source or reference |
---|---|---|
Strains | ||
BL915 | Wild type | 10 |
BL915ΔORF1 | Deletion in prnA of BL915, Prn−, Kmr | 9 |
BL915ΔORF2 | Deletion in prnB of BL915, Prn−, Kmr | 9 |
BL915ΔORF3 | Deletion in prnC of BL915, Prn−, Kmr | 9 |
BL915ΔORF4 | Deletion in prnD of BL915, Prn−, Kmr | 9 |
BL915ΔORF1–4 | Deletion in prnABCD of BL915, Prn−, Kmr | 9 |
Plasmids | ||
pPEH14(prnA) | pRK290 carrying Ptac functionally fused to the 1.6-kb prnA coding region | This study |
pPEH14(prnB) | pRK290 carrying Ptac functionally fused to the 1.1-kb prnB coding region | This study |
pPEH14(prnC) | pRK290 carrying Ptac functionally fused to the 1.7-kb prnC coding region | This study |
pPEH14(prnD) | pRK290 carrying Ptac functionally fused to the 1.1-kb prnD coding region | This study |
Chemical standards.
7-Cl-d,l-tryptophan (7-CT) was synthesized as described by van Pée et al. (24). Monodechloroaminopyrrolnitrin (MDA) was extracted from cultures of P. aureofaciens and verified as described by van Pée et al. (23). Aminopyrrolnitrin (APRN) was prepared from PRN by reduction with sodium dithionite (22). PRN was synthesized according to the method of Gosteli (6).Western analysis.
To produce antigen, each prn gene was subcloned into a pET3 vector and transformed into E. coli BL21(De3) (Novagen, Inc., Madison, Wis.). Inclusion bodies were purified from induced cultures with protocols from Novagen. Inclusion body protein (100 μg) was run on a preparative Laemmli polyacrylamide electrophoresis gel, blotted to nitrocellulose filters, and stained with Ponceau S. The major band was excised, solubilized in dimethyl sulfoxide, and used by Duncroft, Inc. (Lovettsville, Va.), to immunize goats and produce antiserum against each PRN protein.Cultures of P. fluorescens BL915 were grown for 48 h in Luria-Bertani medium with the appropriate antibiotics. The cells were pelleted and resuspended in a small volume of Tris-EDTA. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western analysis were performed as described by Sambrook et al. (21). The primary antiserum (goat anti-PRN protein) was diluted 1/1,000, and the secondary antibody (rabbit anti-goat immunoglobulin G conjugated to peroxidase; Pierce, Rockford, Ill.) was diluted 1/3,000. Bands were visualized with an enhanced chemiluminescence kit (Amersham, Arlington Heights, Ill.). This Western analysis demonstrated that each antibody recognized a single protein band from wild-type BL915, and these bands were not present in BL915ΔORF1–4 (Fig. (Fig.2).2). The molecular weights of the recognized proteins were consistent with the sizes predicted from the gene sequences. Each prn gene was expressed on a plasmid in BL915ΔORF1–4. In each case, the protein product of the cloned gene reacted only with the expected antibody and was identical in size to the band detected by that antibody in wild-type BL915 (Fig. (Fig.2).2). Open in a separate windowFIG. 2Western blot analysis of the protein products of prn genes cloned from P. fluorescens BL915. Individual genes were expressed on plasmids in the host strain BL915ΔORF1–4. BL915 wild-type and BL915ΔORF1–4 controls are included on each blot. Blots A, B, C, and D were probed with antibodies raised against the products of prnA, prnB, prnC, and prnD, respectively. Arrows indicate the positions of the 60- and 42-kDa molecular mass markers.Intermediate analysis and feeding experiments.
To determine which biosynthetic intermediates were produced by the prn gene deletion mutants, 2-day-old cultures were extracted with an equal volume of ethyl acetate. The organic phase was dried under vacuum, and the residue was dissolved in a small volume of methanol. Thin-layer chromatography (TLC) was performed on silica-coated plates with toluene or hexane-ethyl acetate (2:1) as the mobile phase. PRN, APRN, MDA, and aminophenylpyrrole (APP) were visualized with van Urk’s reagent as described previously (22).To further clarify which biosynthetic step was blocked in each deletion mutant, intermediate feeding experiments were conducted. Cultures (10 ml) were incubated at 28°C for 48 h. Biosynthetic intermediates were dissolved in a small volume of methanol and added to 4 ml of culture at the following final concentrations: 7-CT, 2.5 μg/ml; MDA, 25 μg/ml; APRN, 12.5 μg/ml. The cultures were incubated for an additional 4 h at 28°C and then extracted with ethyl acetate and analyzed by TLC and liquid chromatography-mass spectrometry as described above.MDA, APRN, and PRN were not detected in cultures of BL915ΔORF1 (Fig. (Fig.3),3), indicating that this mutant is blocked at an early step in PRN biosynthesis. BL915ΔORF1 was able to produce PRN when 7-CT, MDA, or APRN was supplied exogenously (Table (Table2).2). When prnA was expressed in the absence of other prn genes (i.e., in BL915ΔORF1–4), 7-chloro-l-tryptophan (7-CLT) accumulated. The identity of 7-CLT was verified by comparison of results of high-performance liquid chromatography and mass spectra with chemically synthesized 7-CT. These results indicate that the prnA gene product catalyzes the chlorination of l-tryptophan. Open in a separate windowFIG. 3Accumulation of PRN biosynthetic intermediates in P. fluorescens BL915 and prn gene deletion mutants derived from it. Extracts from 2-day-old cultures were separated by TLC on silica plates with hexane-ethyl acetate (2:1 [vol/vol]) as the mobile phase. Metabolites were visualized with van Urk’s reagent. Arrows indicate the positions of MDA (olive green), APRN (reddish brown), and PRN (purple).TABLE 2
Production of PRN by deletion mutants when supplied with biosynthetic intermediates in the growth mediumStrain | Result with intermediate added to culturesa
| ||
---|---|---|---|
7-CT | MDA | APRN | |
BL915ΔORF1 | + | + | + |
BL915ΔORF2 | − | + | + |
BL915ΔORF3 | − | − | + |
BL915ΔORF4 | − | − | − |
19.