共查询到20条相似文献,搜索用时 31 毫秒
1.
All of the 2,6-dideoxy sugars contained within the structure of chromomycin A3 are derived from d-glucose. Enzyme assays were used to confirm the presence of hexokinase, phosphoglucomutase, UDPG pyrophosphorylase (UDPGP), and UDPG oxidoreductase (UDPGO), all of which are involved in the pathway of glucose activation and conversion into 2,6-dideoxyhexoses during chromomycin biosynthesis. Levels of the four enzymes in Streptomyces spp. cell extracts were correlated with the production of chromomycins. The pathway of sugar activation in Streptomyces spp. involves glucose 6-phosphorylation by hexokinase, isomerization to G-1-P catalyzed by phosphoglucomutase, synthesis of UDPG catalyzed by UDPGP, and formation of UDP-4-keto-6-deoxyglucose by UDPGO.Dideoxy sugars occur commonly in the structures of cardiac glycosides from plants, in antibiotics like chromomycin A3 (Fig. (Fig.1),1), and in macrolides produced by microorganisms. On the basis of stable isotope-labeling experiments, biosynthetic studies conducted in Rosazza’s laboratory have indicated that all the deoxy sugars of chromomycin A3 are derived from d-glucose (21). While the assembly of the polyketide aglycone is reasonably well understood, relatively little is known of the details of 2,6-dideoxy sugar biogenesis in streptomycetes. Earlier studies with Streptomyces rimosus indicated that TDP-mycarose is synthesized from TDP-d-glucose (TDPG) and S-adenosyl-l-methionine (10, 23). The reaction requires NADPH as a cofactor, and TDP-4-keto-6-deoxy-d-glucose is an intermediate. Formation of TDP-4-keto-6-deoxy-d-glucose was catalyzed by the enzyme TDPG oxidoreductase (TDPG-4,6-dehydratase; EC 4.2.1.46). Similar 4-keto sugar nucleotides are intermediates for the biosynthesis of polyene macrolide antibiotic amino sugars (18). Similar pathways have been elaborated for the formation of 2,6-dideoxy-d-threo-4-hexulose of granaticin in Escherichia coli (6, 25) and 2,6-dideoxy-d-arabino-hexose of chlorothricin (12). The initial 6-deoxygenation of glucose during 3,6-dideoxy sugar formation involves a similar mechanism (32). In all of these processes, glucose is first activated by conversion into a sugar nucleotide such as UDPG followed by NAD+ oxidation of the 4 position to the corresponding 4-oxo derivative. Position 6 deoxygenation involves a general tautomerization, dehydration, and NADH,H+-catalyzed reduction process (6, 12, 25). A similar tautomerization and dehydration followed by reduction may produce C-3-deoxygenated products, such as CDP-3,6-dideoxyglucose (27). The pathway for formation of 3,6-dideoxyhexoses from CDPG in Yersinia pseudotuberculosis was clearly elucidated by Liu and Thorson (14). However, none of this elegant work was focused on the earlier steps of hexose nucleotide formation. Open in a separate windowFIG. 1Structures of chromomycins A2 and A3.On the basis of previous work (7), it is reasonable to postulate that the biosynthesis of 2,6-dideoxyglucose in Streptomyces griseus involves phosphorylation to glucose-6-phosphate by hexokinase (HK; E.C.2.7.7.1), as in glycolysis; conversion to glucose-1-phosphate by phosphoglucomutase (PGM; EC 2.7.5.1); reaction with UTP to form UDPG in a reaction catalyzed by UDPG pyrophosphorylase (UDPGP) (glucose-1-phosphate uridylyltransferase; EC 2.7.7.9), and C-6 deoxygenation catalyzed by UDP-d-glucose-4,6-dehydratase with NAD+ as a cofactor (Fig. (Fig.2).2). UDPG and GDPG have been detected in cell extracts of S. griseus and Streptomyces sp. strain MRS202, suggesting that these compounds are active sugar nucleotides involved in the formation of dideoxyhexoses (15). UDPGP genes from several bacteria have been cloned and sequenced (1, 3, 4, 11, 29, 30). Although nucleotidyl diphosphohexose-4,6-dehydratases (NDP-hexose-4,6-dehydratases) have been purified and characterized from several sources (5, 8, 9, 13, 19, 25, 26, 31, 33), the occurrence of the glucose-activating enzymes HK, PGM, UDPGP, and UDPG oxidoreductase (UDPGO) involved in 2,6-dideoxyhexose formation has not been established in streptomycetes. This work provides evidence for the presence of these enzymes involved in the biosynthetic activation of glucose to the 2,6-dideoxyhexoses in chromomycin A3.Open in a separate windowFIG. 2Proposed pathway for the formation of 2,6-dideoxy sugars in streptomycetes involving HK, PGM, UDPGP, and UDPGO. 相似文献
2.
3.
4.
5.
l-Methionine γ-lyase (EC 4.4.1.11) was purified to homogeneity from Brevibacterium linens BL2, a coryneform bacterium which has been used successfully as an adjunct bacterium to improve the flavor of Cheddar cheese. The enzyme catalyzes the α,γ elimination of methionine to produce methanethiol, α-ketobutyrate, and ammonia. It is a pyridoxal phosphate-dependent enzyme, with a native molecular mass of approximately 170 kDa, consisting of four identical subunits of 43 kDa each. The purified enzyme had optimum activity at pH 7.5 and was stable at pHs ranging from 6.0 to 8.0 for 24 h. The pure enzyme had its highest activity at 25°C but was active between 5 and 50°C. Activity was inhibited by carbonyl reagents, completely inactivated by dl-propargylglycine, and unaffected by metal-chelating agents. The pure enzyme had catalytic properties similar to those of l-methionine γ-lyase from Pseudomonas putida. Its Km for the catalysis of methionine was 6.12 mM, and its maximum rate of catalysis was 7.0 μmol min−1 mg−1. The enzyme was active under salt and pH conditions found in ripening Cheddar cheese but susceptible to degradation by intracellular proteases.Methanethiol is associated with desirable Cheddar-type sulfur notes in good-quality Cheddar cheese (2, 27). The mechanism for the production of methanethiol in cheese is unknown, but it is linked to the catabolism of methionine (1, 15). l-Methionine γ-lyase (EC 4.4.1.11; MGL), also known as methionase, l-methionine γ-demethiolase, and l-methionine methanethiollyase (deaminating), is a pyridoxal phosphate (PLP)-dependent enzyme that catalyzes the direct conversion of l-methionine to α-ketobutyrate, methanethiol, and ammonia by an α,γ-elimination reaction (26). It does not catalyze the conversion of d enantiomers (24–26). MGL in Pseudomonas putida is a multifunctional enzyme system since it catalyzes the α,γ- and α,β-elimination reactions of methionine and its derivatives (24). In addition, the enzyme also catalyzes the β-replacement reactions of sulfur amino acids (24). Since its discovery in Escherichia coli and Proteus vulgaris by Onitake (19), this enzyme has been found in various bacteria and is regarded as a key enzyme in the bacterial metabolism of methionine. However, this enzyme has not been purified to homogeneity from any food-grade microorganisms.MGL is widely distributed in bacteria, especially in pseudomonads, and is induced by the addition of l-methionine to the culture medium (9, 28). The enzyme has been purified from Pseudomonas putida (25), Aeromonas sp. (26), Clostridium sporogenes (11), and Trichomonas vaginalis (16) and partially purified from and characterized for Brevibacterium linens NCDO 739 (4).B. linens is a nonmotile, non-spore-forming, non-acid-fast, gram-positive coryneform bacterium normally found on the surfaces of Limburger and other Trappist-type cheeses. This organism tolerates salt concentrations ranging between 8 and 20% and is capable of growing in a broad pH range from 5.5 to 9.5, with an optimum pH of 7.0 (20). In Trappist-type cheeses, brevibacteria depend on Saccharomyces cerevisiae to metabolize lactate, which increases the pH of the curd, as well as to produce growth factors that are important for their growth (20). Interest in B. linens has focused around its ability to produce an extracellular protease, which has recently been isolated (21), and its ability to produce high levels of methanethiol (3, 9, 10, 22).B. linens produces various sulfur compounds, including methanethiol, that are thought to be important in Cheddar-like flavor and aroma (3, 9, 10, 22). Ferchichi et al. (9) suggested that MGL is responsible for the methanethiol-producing capability of B. linens but did not provide definitive evidence. Weimer et al. (28) proposed that B. linens BL2 is responsible for Cheddar-type flavor development in low-fat cheese, but again conclusive evidence was lacking. In this study, MGL was purified to homogeneity from B. linens BL2 and its physical and chemical properties were examined. 相似文献
6.
Sadjia Bekal Jozef Van Beeumen Bart Samyn Dominique Garmyn Samia Henini Charles Diviès Hervé Prévost 《Journal of bacteriology》1998,180(3):647-654
A citrate lyase (EC 4.1.3.6) was purified 25-fold from Leuconostoc mesenteroides and was shown to contain three subunits. The first 42 amino acids of the β subunit were identified, as well as an internal peptide sequence spanning some 20 amino acids into the α subunit. Using degenerated primers from these sequences, we amplified a 1.2-kb DNA fragment by PCR from Leuconostoc mesenteroides subsp. cremoris. This fragment was used as a probe for screening a Leuconostoc genomic bank to identify the structural genes. The 2.7-kb gene cluster encoding citrate lyase of L. mesenteroides is organized in three open reading frames, citD, citE, and citF, encoding, respectively, the three citrate lyase subunits γ (acyl carrier protein [ACP]), β (citryl-S-ACP lyase; EC 4.1.3.34), and α (citrate:acetyl-ACP transferase; EC 2.8.3.10). The gene (citC) encoding the citrate lyase ligase (EC 6.2.1.22) was localized in the region upstream of citD. Protein comparisons show similarities with the citrate lyase ligase and citrate lyase of Klebsiella pneumoniae and Haemophilus influenzae. Downstream of the citrate lyase cluster, a 1.4-kb open reading frame encoding a 52-kDa protein was found. The deduced protein is similar to CitG of the other bacteria, and its function remains unknown. Expression of the citCDEFG gene cluster in Escherichia coli led to the detection of a citrate lyase activity only in the presence of acetyl coenzyme A, which is a structural analog of the prosthetic group. This shows that the acetyl-ACP group of the citrate lyase form in E. coli is not complete or not linked to the protein.Lactic acid bacteria of the genus Leuconostoc play important roles in the dairy industry because of their ability to produce carbon dioxide and C4 aroma compounds through lactose heterofermentation and citrate utilization. The carbon dioxide produced is responsible for eye formation in certain types of cheese. Citrate utilization by these bacteria leads to the production of diacetyl, which is considered a main flavor compound of a range of fermented dairy products such as cultured butter, buttermilk, and cottage cheese.The citrate utilization by lactic acid bacteria requires specifically three enzymes involved in the conversion of citrate to pyruvate: a citrate permease, a citrate lyase, and an oxaloacetate decarboxylase. The energetic role of citrate metabolism in Leuconostoc mesenteroides has been recently described (24, 25). The citrate permease catalyzes an electrogenic exchange of divalent anionic citrate and monovalent lactate, resulting in the generation of a membrane potential (Fig. (Fig.1,1, reaction 1) (24, 25). The intracellular citrate is cleaved by a citrate lyase (EC 4.1.3.6), yielding acetate and oxaloacetate (Fig. (Fig.1,1, reactions 2 and 3). The oxaloacetate is decarboxylated into carbon dioxide and pyruvate in a reaction catalyzed by the enzyme oxaloacetate decarboxylase (Fig. (Fig.1,1, reaction 4). Open in a separate windowFIG. 1Citrate fermentation pathway in L. mesenteroides and role of the different subunits in the reaction catalyzed by citrate lyase (EC 4.1.3.6). The proteins involved are citrate permease (1), citrate lyase α subunit citrate:acetyl-ACP transferase (EC 2.8.3.10) (2), citrate lyase β subunit citryl–S-ACP lyase (EC 4.1.3.34) (3) oxaloacetate decarboxylase (4), acetate:SH-CL ligase (EC 6.2.1.22) (5), and lactate dehydrogenase (6). ACP, γ subunit of ACP; R, prosthetic group. Acetic anhydride is used for chemical specific acetylation of the prosthetic group. Acetic anhydride is an analog of the mixed anhydride of citric and acetic acids which corresponds probably to an intermediate analog in the acyl-exchange reaction (7a, 14a).Understanding of the molecular genetics of these lactic acid bacteria is not far advanced, and the genes encoding the enzymes citrate lyase and oxaloacetate decarboxylase are unknown.On the basis of previous studies (22, 33), the citrate lyase of Lactococcus lactis subsp. lactis biovar diacetylactis and Leuconostoc can be considered a functional complex (Mr, 585,000) composed of three proteins: α, β, and γ subunits in a stoichiometric relationship of 6:6:6. The structure and the mechanism of action are similar to those of the citrate lyase of Klebsiella pneumoniae, which has been extensively studied (1, 15, 16, 34, 36). The citrate lyase is active only if the thioester residue of the prosthetic group linked to its acyl carrier protein (ACP) (γ subunit) is acetylated. This activation is catalyzed by an acetate:SH-citrate lyase ligase (CL ligase) (EC 6.2.1.22), which converts HS-ACP with ATP and acetate into the acetyl-S-ACP (Fig. (Fig.1,1, reaction 5) (32). The α subunit replaces the acyl group with a citryl group to form the citryl-S-ACP (Fig. (Fig.1,1, reaction 2) (16). At last, the β subunit cleaves citryl-S-ACP into oxaloacetate and regenerates the acyl-S-ACP (Fig. (Fig.1,1, reaction 3) (16).Different mechanisms of regulation of citrate lyase have been reported, such as configurational changes, reversible covalent modification by acetylation-deacetylation, and phosphorylation-dephosphorylation (1, 2). In microorganisms like Klebsiella, in which the reactions of the tricarboxylic acid cycle are operative and therefore contain citrate synthase, a strict regulation of citrate lyase activity is necessary to avoid a futile cycle between citrate fermentation and the l-glutamate biosynthetic pathway. After citrate depletion from the growth medium or upon transfer from an anaerobic citrate medium to an aerobic glucose medium, the synthesis of l-glutamate from oxaloacetate and acetyl coenzyme A (CoA) via citrate can be ensured only if the citrate fermentation pathway is turned off. The intracellular l-glutamate concentration controls these pathways by modulating the activity of the citrate lyase complex (1, 2).An induction of citrate lyase activity has been observed in Leuconostoc but never in all Lactococcus strains tested (21, 26). In L. mesenteroides, the citrate lyase activity is induced by citrate and rapidly repressed after the citrate consumption in the medium. However, the regulation mechanisms remain unknown. In this paper, we report the purification of L. mesenteroides citrate lyase and an approach based on reverse genetics that yielded the full-length sequence of CL ligase and citrate lyase genes encoding the α, β, and γ subunits. The citrate lyase and CL ligase genes were sequenced and expressed in Escherichia coli. 相似文献
7.
James Shorter 《Molecular biology of the cell》2016,27(10):1556-1560
Therapeutic agents are urgently required to cure several common and fatal neurodegenerative disorders caused by protein misfolding and aggregation, including amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), and Alzheimer’s disease (AD). Protein disaggregases that reverse protein misfolding and restore proteins to native structure, function, and localization could mitigate neurodegeneration by simultaneously reversing 1) any toxic gain of function of the misfolded form and 2) any loss of function due to misfolding. Potentiated variants of Hsp104, a hexameric AAA+ ATPase and protein disaggregase from yeast, have been engineered to robustly disaggregate misfolded proteins connected with ALS (e.g., TDP-43 and FUS) and PD (e.g., α-synuclein). However, Hsp104 has no metazoan homologue. Metazoa possess protein disaggregase systems distinct from Hsp104, including Hsp110, Hsp70, and Hsp40, as well as HtrA1, which might be harnessed to reverse deleterious protein misfolding. Nevertheless, vicissitudes of aging, environment, or genetics conspire to negate these disaggregase systems in neurodegenerative disease. Thus, engineering potentiated human protein disaggregases or isolating small-molecule enhancers of their activity could yield transformative therapeutics for ALS, PD, and AD.We urgently need to pioneer game-changing solutions to remedy a number of increasingly prevalent and fatal neurodegenerative disorders, including amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), and Alzheimer’s disease (AD; Cushman et al., 2010 ; Jackrel and Shorter, 2015 ). These disorders relentlessly erode our morale and economic resources. Aging is the major risk factor for all of these diseases, which threaten public health on a global scale and represent a severe impediment to living longer lives. A number of promising drugs have emerged to treat cancer and heart disease, but, distressingly, this is not the case for these and other neurodegenerative diseases, for which drug pipelines lie dormant and empty. This situation is unacceptable, and an impending healthcare crisis looms worldwide as population demographics inexorably shift toward older age groups.ALS, PD, AD, and related neurodegenerative disorders are unified by a common underlying theme: the misfolding and aggregation of specific proteins (characteristic for each disease) in the CNS (Cushman et al., 2010 ; Eisele et al., 2015 ). Thus, in ALS, typically an RNA-binding protein with a prion-like domain, TDP-43, mislocalizes from the nucleus to cytoplasmic inclusions in degenerating motor neurons (Neumann et al., 2006 ; Gitler and Shorter, 2011 ; King et al., 2012 ; Robberecht and Philips, 2013 ; March et al., 2016 ). In PD, α-synuclein forms toxic soluble oligomers and cytoplasmic aggregates, termed Lewy bodies, in degenerating dopaminergic neurons (Dehay et al., 2015 ). By contrast, in AD, amyloid-β (Aβ) peptides form extracellular plaques and the microtubule-binding protein, tau, forms cytoplasmic neurofibrillary tangles in afflicted brain regions (Jucker and Walker, 2011 ). Typically, these disorders are categorized into ∼80–90% sporadic cases and ∼10–20% familial cases. Familial forms of disease often have clear genetic causes, which might one day be amenable to gene editing via clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 therapeutics if critical safety and ethical concerns can be successfully addressed and respected (Doudna and Charpentier, 2014 ; Baltimore et al., 2015 ; Rahdar et al., 2015 ; Callaway, 2016 ). However, the more common sporadic forms of disease often have no clear underlying genetics, and wild-type proteins misfold (Cushman et al., 2010 ; Jucker and Walker, 2011 ; Robberecht and Philips, 2013 ; Dehay et al., 2015 ). Consequently, therapeutic agents that directly target and safely reverse deleterious protein misfolding are likely to have broad utility (Eisele et al., 2015 ).There are no treatments that directly target the reversal of the protein-misfolding phenomena that underlie these disorders (Jackrel and Shorter, 2015 ). Strategies that directly reverse protein misfolding and restore proteins to native form and function could, in principle, eradicate any severely damaging loss-of-function or toxic gain-of-function phenotypes caused by misfolded conformers (Figure 1; Jackrel and Shorter, 2015 ). Moreover, therapeutic disaggregases would dismantle self-templating amyloid or prion structures, which spread pathology and nucleate formation of neurotoxic, soluble oligomers (Figure 1; Cushman et al., 2010 ; Cohen et al., 2013 ; Guo and Lee, 2014 ; Jackrel and Shorter, 2015 ). My group has endeavored to engineer and evolve Hsp104, a hexameric AAA+ ATPase and protein disaggregase from yeast (DeSantis and Shorter, 2012 ; Sweeny and Shorter, 2015 ), to more effectively disaggregate misfolded proteins connected with various neurodegenerative disorders, including ALS (e.g., TDP-43 and FUS) and PD (e.g., α-synuclein). Although wild-type Hsp104 can disaggregate diverse amyloid and prion conformers, as well as toxic soluble oligomers (Lo Bianco et al., 2008 ; DeSantis et al., 2012 ), its activity against human neurodegenerative disease proteins is suboptimal. Is it even possible to improve on existing Hsp104 disaggregase activity, which has been wrought over the course of millions of years of evolution?Open in a separate windowFIGURE 1:Therapeutic protein disaggregases. Two malicious problems are commonly associated with protein misfolding into disordered aggregates, toxic oligomers, and cross–β amyloid or prion fibrils: 1) a toxic gain of function of the protein in various misfolded states; and 2) a loss of function of the protein in the various misfolded states. These problems can contribute to the etiology of diverse neurodegenerative diseases in a combinatorial or mutually exclusive manner. A therapeutic protein disaggregase would reverse protein misfolding and recover natively folded functional proteins from disordered aggregates, toxic oligomers, and cross–β amyloid or prion fibrils. In this way, any toxic gain of function or toxic loss of function caused by protein misfolding would be simultaneously reversed. Ideally, all toxic misfolded conformers would be purged. Therapeutic protein disaggregases could thus have broad utility for various fatal neurodegenerative diseases.Remarkably, the answer to this question is yes! We used nimble yeast models of neurodegenerative proteinopathies (Outeiro and Lindquist, 2003 ; Gitler, 2008 ; Johnson et al., 2008 ; Sun et al., 2011 ; Khurana et al., 2015 ) as a platform to isolate enhanced disaggregases from large libraries of Hsp104 variants generated by error-prone PCR (Jackrel et al., 2014b ). In this way, we reprogrammed Hsp104 to yield the first disaggregases that reverse TDP-43, FUS (another RNA-binding protein with a prion-like domain connected to ALS), and α-synuclein (connected to PD) aggregation and proteotoxicity (Jackrel et al., 2014a , 2015 ; Jackrel and Shorter, 2015 ; Torrente et al., 2016 ). Remarkably, a therapeutic gain of Hsp104 function could be elicited by a single missense mutation (Jackrel et al., 2014a , 2015 ; Jackrel and Shorter, 2015 ). Under conditions in which Hsp104 was ineffective, potentiated Hsp104 variants dissolved protein inclusions, restored protein localization (e.g., TDP-43 returned to the nucleus from cytoplasmic inclusions), suppressed proteotoxicity, and attenuated dopaminergic neurodegeneration in a Caenorhabditis elegans PD model (Jackrel et al., 2014a ; Jackrel and Shorter, 2015 ). Remarkably, these therapeutic modalities originated from degenerate loss of amino acid identity at select positions of Hsp104 rather than specific mutation (Jackrel et al., 2014a ; Jackrel and Shorter, 2015 ). Some of these changes were remarkably small (Jackrel et al., 2014a , 2015 ; Jackrel and Shorter, 2015 ). Thus, potentiated Hsp104 variants could be generated by removal of a methyl group from a single side chain or addition or removal of a single methylene bridge from a single side chain (Jackrel et al., 2014a , 2015 ; Jackrel and Shorter, 2015 ). Thus, small molecules that bind in accessible regions of Hsp104 rich in potentiating mutations might also be able to enhance activity. However, a small-scale screen for small-molecule modulators of Hsp104 revealed only inhibitors (Torrente et al., 2014 ). Nonetheless, our work has established that disease-associated aggregates and amyloid are tractable targets and that enhanced artificial disaggregases can restore proteostasis and mitigate neurodegeneration (Jackrel and Shorter, 2015 ).One surprising aspect of this work is just how many Hsp104 variants we could isolate with potentiated activity. We now have hundreds (Jackrel et al., 2014a ; Jackrel et al., 2015 ). Typically, potentiated Hsp104 variants displayed enhanced activity against several neurodegenerative disease proteins. For example, Hsp104A503S rescued the aggregation and toxicity of TDP-43, FUS, TAF15, and α-synuclein (Jackrel et al., 2014a ; Jackrel and Shorter, 2014 ). By contrast, some potentiated Hsp104 variants rescued only the aggregation and toxicity of a subset of disease proteins. For example, Hsp104D498V rescued only the aggregation and toxicity of FUS and α-synuclein (Jackrel et al., 2014a ). A challenge that lies ahead is to engineer potentiated Hsp104 variants that are highly substrate specific to mitigate any potential off-target effects, should they arise (Jackrel and Shorter, 2015 ).Very small changes in primary sequence yield potentiated Hsp104 variants. However, Hsp104 has no metazoan homologue (Erives and Fassler, 2015 ). Now comes the important point. Neuroprotection could be broadly achieved by making very subtle modifications to existing human chaperones with newly appreciated disaggregase activity—for example, Hsp110, Hsp70, and Hsp40 (Torrente and Shorter, 2013 ) and HtrA1 (Poepsel et al., 2015 ).Whether Metazoa even possess a powerful protein disaggregation and reactivation machinery had been a long-standing enigma (Torrente and Shorter, 2013 ). However, it has recently emerged that two metazoan chaperone systems—1) Hsp110, Hsp70, and Hsp40 (Torrente and Shorter, 2013 ) and 2) HtrA1 (Poepsel et al., 2015 )—possess disaggregase activity that could be therapeutically harnessed or stimulated to reverse deleterious protein misfolding in neurodegenerative disease. I suspect that Metazoa harbor additional disaggregase systems that remain to be identified (Guo et al., 2014 ). Whether due to vicissitudes of aging, environment, or genetic background, these disaggregase systems fail in the context of ALS, PD, and AD. Based on the surprising precedent of our potentiated versions of Hsp104 (Jackrel et al., 2014a ; Jackrel and Shorter, 2015 ), I hypothesize that it is possible to engineer and evolve potentiated variants of these human protein disaggregases to more effectively counter deleterious misfolding events in ALS, PD, and AD (Torrente and Shorter, 2013 ; Mack and Shorter, 2016 ).Using classical biochemical reconstitution, it was discovered that one mammalian protein-disaggregase system comprises three molecular chaperones—Hsp110, Hsp70, and Hsp40—which synergize to dissolve and reactivate model proteins trapped in disordered aggregates and can even depolymerize amyloid fibrils formed by α-synuclein from their ends (Shorter, 2011 ; Duennwald et al., 2012 ; Torrente and Shorter, 2013 ). Hsp110, Hsp70, and Hsp40 isoforms are found in the cytoplasm, nucleus, and endoplasmic reticulum, which suggest that protein disaggregation and reactivation can occur in several compartments (Finka et al., 2015 ). Subsequent studies suggest that this system may be more powerful than initially anticipated (Rampelt et al., 2012 ; Mattoo et al., 2013 ; Gao et al., 2015 ; Nillegoda et al., 2015 ). Nonetheless, this system must become overwhelmed in neurodegenerative disorders. Perhaps selectively vulnerable neurons display particular deficits in this machinery. Hence, potentiating the activity of this system via engineering could be extremely valuable. It is promising that directed evolution studies yielded DnaK (Hsp70 in Escherichia coli) variants with improved ability to refold specific substrates (Aponte et al., 2010 ; Schweizer et al., 2011 ; Mack and Shorter, 2016 ), but whether this can be extended to human Hsp70 and the disaggregation of neurodegenerative disease proteins is uncertain.It is exciting that recent studies have revealed that HtrA1, a homo-oligomeric PDZ serine protease, can dissolve and degrade AD-linked tau and Aβ42 fibrils in an ATP-independent manner (Tennstaedt et al., 2012 ; Poepsel et al., 2015 ). HtrA1 first dissolves tau and Aβ42 fibrils and then degrades them, as protease-defective HtrA1 variants dissolve fibrils without degrading them (Poepsel et al., 2015 ). HtrA1 is found in the cytoplasm (∼30%) but is also secreted (∼70%; Poepsel et al., 2015 ). Indeed, HtrA1 is known to degrade substrates in both the extracellular space and the cytoplasm (Chien et al., 2009 ; Campioni et al., 2010 ; Tiaden and Richards, 2013 ). Thus HtrA1 could dissolve Aβ42 fibrils in the extracellular space and tau fibrils in the cytoplasm and simultaneously destroy the two cardinal features of AD (Poepsel et al., 2015 ). I suspect that this system becomes overwhelmed or is insufficient in AD, and thus potentiating and tailoring HtrA1 disaggregase activity could be a valuable therapeutic strategy. For example, it might be advantageous to simply degrade Aβ42 after disaggregation if the peptide has no beneficial function. Thus HtrA1 variants with enhanced disaggregation and degradation activity against Aβ42 could be extremely useful. However, Aβ42 (and related Aβ peptides) may have physiological functions that are presently underappreciated (Soscia et al., 2010 ; Fedele et al., 2015 ), in which case HtrA1 variants with enhanced disaggregase activity but reduced proteolytic activity could be vital. HtrA1 variants with enhanced disaggregase activity but reduced proteolytic activity may also be particularly important to recover functional tau from neurofibrillary tangles to reverse loss of tau function in AD and various tauopathies (Santacruz et al., 2005 ; Trojanowski and Lee, 2005 ; Dixit et al., 2008 ).I suggest that relatively small changes in primary sequence will yield large increases in disaggregase activity for these systems as they do for Hsp104 (Jackrel et al., 2014a ; Jackrel and Shorter, 2015 ). If true, this would further suggest that small molecules that bind in the appropriate regions of Hsp110, Hsp70, Hsp40, or HtrA1 might also enhance disaggregase activity. Thus, isolating small-molecule enhancers of the Hsp110, Hsp70, and Hsp40 or HtrA1 disaggregase systems could yield important therapeutics. Indeed, I hypothesize that enhancing the activity of the Hsp110, Hsp70, and Hsp40 or HtrA1 disaggregase system with specific small molecules will enable dissolution of toxic oligomeric and amyloid forms of various disease proteins and confer therapeutic benefits in ALS, PD, AD, and potentially other neurodegenerative disorders.It is intriguing that several small molecules are already known to enhance various aspects of Hsp70 chaperone activity (Pratt et al., 2015 ; Shrestha et al., 2016 ). These include MKT-077, JG-98, YM-1, YM-8, and 115-7c (Wisen et al., 2010 ; Pratt et al., 2015 ). It is not known whether any of these stimulates the disaggregase activity of the Hsp110, Hsp70, and Hsp40 system. MKT-077, JG-98, YM-1, and YM-8 are rhodocyanines that bind with low micromolar affinity to the nucleotide-binding domain of ADP- but not ATP-bound Hsp70, stabilizing the ADP-bound state (Pratt et al., 2015 ). The ADP-bound state of Hsp70 engages clients with higher affinity, and consequently MKT-077, JG-98, and YM-1 activate binding of Hsp70 to misfolded proteins (Wang et al., 2013 ; Pratt et al., 2015 ). Thus, under some conditions, these small molecules can promote folding of certain Hsp70 clients (Morishima et al., 2011 ; Pratt et al., 2015 ). However, prolonged interaction of clients with Hsp70 promotes their CHIP-dependent ubiquitylation and degradation in vivo (Morishima et al., 2011 ; Wang et al., 2013 ; Pratt et al., 2015 ). Intriguingly, YM-1 promotes clearance of polyglutamine oligomers and aggregates in cells (Wang et al., 2013 ; Pratt et al., 2015 ). MKT-0777, YM-1, JG-98, and YM-8 also promote clearance of tau and confer therapeutic benefit in tauopathy models (Abisambra et al., 2013 ; Miyata et al., 2013 ; Fontaine et al., 2015 ). Of importance, YM-8 is long lived in vivo and crosses the blood–brain barrier (Miyata et al., 2013 ). The dihydropyrimidine 115-7c activates Hsp70 ATPase turnover rate, promotes Hsp70 substrate refolding, and reduces α-synuclein aggregation in cell culture (Wisen et al., 2010 ; Kilpatrick et al., 2013 ). It binds to the IIA subdomain of Hsp70 and promotes the active Hsp70–Hsp40 complex (Wisen et al., 2010 ). Small-molecule enhancers of HtrA1 protease activity have also emerged (Jo et al., 2014 ). Thus it will be important to assess whether these small molecules enhance the activity of their respective disaggregases against various neurodegenerative substrates.Although small molecules that enhance disaggregase activity of endogenous human proteins might be the most immediately translatable, gene-, mRNA-, or protein-based therapies can also be envisioned. For example, adeno-associated viruses expressing enhanced disaggregases might be used to target degenerating neurons (Dong et al., 2005 ; Lo Bianco et al., 2008 ; Deverman et al., 2016 ). Alternatively, if viral vectors are undesirable, modified mRNAs might serve as an alternative to DNA-based gene therapy (Kormann et al., 2011 ). Protein-based therapeutics could also be explored. For example, intraperitoneal injection of human Hsp70 increased lifespan, delayed symptom onset, preserved motor function, and prolonged motor neuron viability in a mouse model of ALS (Gifondorwa et al., 2007 ; Gifondorwa et al., 2012 ). Several other studies suggest that exogenous delivery of Hsp70 can have beneficial, neuroprotective effects in mice (Nagel et al., 2008 ; Bobkova et al., 2014 ; Bobkova et al., 2015 ).Ultimately, if safety and ethical concerns can be overcome in a circumspect, risk-averse manner, CRISPR-Cas9–based therapeutics might even be used to genetically alter the underlying disaggregase to a potentiated form in selectively vulnerable neuronal populations. This approach might be particularly valuable if enhanced disaggregase activity is not detrimental in the long term. Moreover, stem cell–based therapies for replacing lost neurons could also be fortified to express enhanced disaggregase systems. Thus they would be endowed with resistance to potential infection by prion-like conformers that might have accumulated during disease progression (Cushman et al., 2010 ).Enhanced disaggregase activity is likely to be highly advantageous to neurons under circumstances in which protein misfolding has overwhelmed the system (Jackrel et al., 2014a ; Jackrel and Shorter, 2015 ). However, inappropriate hyperactivity of protein disaggregases might also have detrimental, off-target effects under regular conditions in which protein misfolding is not an overwhelming issue (Jackrel et al., 2014a ; Jackrel and Shorter, 2015 ). Thus it may be advantageous to engineer enhanced protein disaggregases to be highly substrate specific. In this way, off-target effects would be readily avoided. There is strong precedent for directed evolution or engineering of specialized chaperone or protein activity from a generalist antecedent (Wang et al., 2002 ; Farrell et al., 2007 ; Smith et al., 2015 ). Thus, engineering specialist disaggregases for each disease substrate could be achieved. Alternatively, transient or intermittent doses of enhanced disaggregases at specific times or places where they are most needed would also minimize potentially toxic side effects. For example, enhanced disaggregase activity might be applied ephemerally to clear existing misfolded conformers and then be withdrawn once the endogenous proteostasis network regains control. Similarly, it is straightforward to envision administration of small-molecule enhancers of disaggregase activity in intermittent protocols that enable facile recovery from potential side effects (Fontaine et al., 2015 ). In this way, any adverse effects of enhanced protein-disaggregase activity under normal physiological conditions would be avoided. Many barriers will need to be safely overcome to implement a successful therapeutic disaggregase, including how to deliver enhanced disaggregase activity to exactly where it is needed. However, these obstacles are not a reason to be pessimistic. On the contrary, the isolation of engineered disaggregases that efficaciously reverse deleterious misfolding of neurodegenerative disease proteins directs our attention to considerably expand the environs in which they should be sought. My closing sentences, therefore, are intended to be provocative.I suspect that neuroprotection could be broadly actualized via precise but subtle alterations to existing protein-disaggregase modalities. The engineering and evolution of protein disaggregases could yield important solutions to avert an imminent plague of neurodegenerative disorders that promises to devastate our society. I strongly suspect that cures for various neurodegenerative disorders will be realized by pioneering as-yet-uncharted regions of disaggregase sequence space or chemical space to elucidate small-molecule enhancers of disaggregase activity. 相似文献
8.
9.
10.
11.
Identification and Function of the pdxY Gene, Which Encodes a Novel Pyridoxal Kinase Involved in the Salvage Pathway of Pyridoxal 5′-Phosphate Biosynthesis in Escherichia coli K-12
下载免费PDF全文
![点击此处可从《Journal of bacteriology》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Yong Yang Ho-Ching Tiffany Tsui Tsz-Kwong Man Malcolm E. Winkler 《Journal of bacteriology》1998,180(7):1814-1821
12.
13.
Kenji Keyamura Yoshito Abe Masahiro Higashi Tadashi Ueda Tsutomu Katayama 《The Journal of biological chemistry》2009,284(37):25038-25050
Chromosomal replication initiation requires the regulated formation of dynamic higher order complexes. Escherichia coli ATP-DnaA forms a specific multimer on oriC, resulting in DNA unwinding and DnaB helicase loading. DiaA, a DnaA-binding protein, directly stimulates the formation of ATP-DnaA multimers on oriC and ensures timely replication initiation. In this study, DnaA Phe-46 was identified as the crucial DiaA-binding site required for DiaA-stimulated ATP-DnaA assembly on oriC. Moreover, we show that DiaA stimulation requires only a subgroup of DnaA molecules binding to oriC, that DnaA Phe-46 is also important in the loading of DnaB helicase onto the oriC-DnaA complexes, and that this process also requires only a subgroup of DnaA molecules. Despite the use of only a DnaA subgroup, DiaA inhibited DnaB loading on oriC-DnaA complexes, suggesting that DiaA and DnaB bind to a common DnaA subgroup. A cellular factor can relieve the DiaA inhibition, allowing DnaB loading. Consistently, DnaA F46A caused retarded initiations in vivo in a DiaA-independent manner. It is therefore likely that DiaA dynamics are crucial in the regulated sequential progress of DnaA assembly and DnaB loading. We accordingly propose a model for dynamic structural changes of initial oriC complexes loading DiaA or DnaB helicase.In many cellular organisms, multiple proteins form dynamic complexes on the chromosomal origin for the initiation of DNA replication. In Escherichia coli, ATP-DnaA forms a specific multimeric complex on the origin (oriC), resulting in an initiation complex that is competent in the replicational initiation (1–3). ATP-DnaA complexes, but not ADP-DnaA complexes, unwind the DNA duplex within the oriC DNA unwinding element (DUE)2 with the aid of superhelicity of oriC DNA and heat energy, resulting in the formation of open complexes (4, 5). At the unwound region, the loading of a DnaB replicative helicase is mediated by a DnaC helicase loader, resulting in the formation of the prepriming complex (6, 7). DnaG primase then complexes with DnaB loaded on the single-stranded (ss) region, which leads to primer synthesis and the loading of DNA polymerase III holoenzyme (8). The cellular ATP-DnaA level fluctuates during the replication cycle with a peak around the time of initiation (9). At the post-initiation stage, DnaA-ATP is hydrolyzed in a manner depending on ADP-Hda protein and the DNA-loaded form of the β-clamp subunit of the polymerase III holoenzyme, yielding inactive ADP-DnaA (10–13). This DnaA inactivation system is called RIDA (regulatory inactivation of DnaA). Hda consists of a short N-terminal region bearing a clamp-binding motif and a C-terminal AAA+ domain. This protein is activated by ADP binding, which allows interaction with ATP-DnaA in a DNA-loaded β-clamp-dependent manner. RIDA decreases the level of cellular ATP-DnaA in a replication-coordinated manner and represses extra initiation events (9–11).The timing of chromosomal replication initiation is strictly regulated and needs to be linked to the regulation of the dynamic conformational changes in the DnaA-oriC complexes, as well as to the cellular ATP-DnaA levels. DiaA is a DnaA-binding protein that stimulates ATP-DnaA assembly on oriC and thus the initiation of replication (14, 15). DiaA mutants show delayed initiation and even asynchronous initiations of multiple origins when cells are rapidly growing and multiple rounds of replication are progressing simultaneously. DiaA is a homotetramer, and each protomer has a DnaA-binding site, which allows the simultaneous binding of multiple DnaA molecules to the homotetramer and the stimulation of cooperative binding of ATP-DnaA molecules on oriC.DnaA consists of four functional domains as follows: the C-terminal domain IV has a DNA-binding helix-turn-helix structure (16) and domain III is an AAA+ domain that contains ATP-interacting motifs, homomultimer formation sites, and specific residues, termed B/H motifs, that can interact with ssDNA of the unwound DUE (17–21). Domain III forms a head-to-tail homomultimer whose overall structure is altered by ATP binding. It is possible that this multimer forms a spiral shape, in which one round of the spiral contains approximately seven protomers, and the resultant central pore carries the B/H motifs on the surface (21, 22). Domain II is a flexible, unstructured linker (23, 24), and domain I has a compactly folded structure, which interacts with several proteins including domain I per se, DiaA, and DnaB helicase (14, 15, 23, 25, 26). Domain I most likely forms homodimers in a head-to-head manner, which would line up the DnaB-interacting sites within this domain, thereby promoting DnaB loading (23).E. coli oriC carries a dozen DnaA-binding sites, including the high affinity 9-mer DnaA boxes (R1 and R4 sites) and ATP-DnaA-preferential low affinity sites (ADLAS), which include the I and τ sites (20, 27). The interaction of ATP-DnaA with ADLAS is specifically important for the activation of DnaA-oriC complexes. DiaA stimulates the cooperative binding of ATP-DnaA on oriC, especially on ADLAS, resulting in the formation of open complexes (15). DnaB helicase stably complexes with DnaC, and the resulting DnaBC complexes can interact with open complexes, loading DnaB onto ssDNA of the unwound DUE. We have previously determined the tertiary structure of the DnaA domain I and found that DnaA Glu-21, within this domain, is a DnaB interaction site, specifically required for DnaB loading onto open complexes (23). The fundamental complex structure, the spatial organization of oriC-DnaA multimers complexed with DiaA, and those involved in the loading of DnaB onto oriC complexes have yet to be revealed.In this study, our first step was the determination of a crucial DiaA-binding site, Phe-46, on DnaA domain I, using NMR and mutant analyses. Next we found that this site is required for DiaA-dependent stimulation of initiation complex formation and that only a subgroup of DnaA molecules, assembled on oriC, is sufficient for DiaA stimulation. Furthermore, we revealed that DnaA Phe-46 is also important for interactions with DnaB helicase. Like the DiaA stimulation, the stimulation of DnaB loading requires only a subgroup of DnaA molecules assembled on oriC. Competition analyses suggested that DiaA and DnaB interact with a common DnaA subgroup on oriC. Only a specific DnaA subgroup in an initiation complex might expose domain I to a position available for the protein loading. Cells might contain a modulator for the inhibition of DnaB loading by DiaA. Thus we infer that DiaA can regulate the initiation of replication both positively and negatively, i.e. it promotes ATP-DnaA assembly and inhibits DnaB loading, thereby ensuring the sequential and regulated progress of initiation reactions. In addition we propose a novel model for the structure of initiation complexes that includes DiaA and suggest possible modes of interactions for DiaA and DnaB on the initial complexes. 相似文献
14.
Inositol monophosphatase (EC 3.1.3.25) plays a pivotal role in the biosynthesis of di-myo-inositol-1,1′-phosphate, an osmolyte found in hyperthermophilic archaea. Given the sequence homology between the MJ109 gene product of Methanococcus jannaschii and human inositol monophosphatase, the MJ109 gene was cloned and expressed in Escherichia coli and examined for inositol monophosphatase activity. The purified MJ109 gene product showed inositol monophosphatase activity with kinetic parameters (Km = 0.091 ± 0.016 mM; Vmax = 9.3 ± 0.45 μmol of Pi min−1 mg of protein−1) comparable to those of mammalian and E. coli enzymes. Its substrate specificity, Mg2+ requirement, Li+ inhibition, subunit association (dimerization), and heat stability were studied and compared to those of other inositol monophosphatases. The lack of inhibition by low concentrations of Li+ and high concentrations of Mg2+ and the high rates of hydrolysis of glucose-1-phosphate and p-nitrophenylphosphate are the most pronounced differences between the archaeal inositol monophosphatase and those from other sources. The possible causes of these kinetic differences are discussed, based on the active site sequence alignment between M. jannaschii and human inositol monophosphatase and the crystal structure of the mammalian enzyme.The sole pathway for myo-inositol biosynthesis is the cyclization of glucose-6-phosphate to inositol-1-phosphate (I-1-P) by I-1-P synthase (EC 5.5.1.4) and the dephosphorylation of I-1-P by inositol monophosphatase (I-1-Pase; EC 3.1.3.25) (7–9, 12, 16, 24). This de novo pathway provides the ultimate source of free inositol for the cell. It is also a key enzyme involved in second-message signal transduction processes in mammalian and plant cells (2, 24, 28, 37). In phosphoinositide signaling (2, 37), I-1-Pase recycles the water-soluble phospholipase C phospholipid degradation products, inositol phosphates, to myo-inositol and helps to maintain a moderate inositol pool. Its inhibition by millimolar concentrations of lithium (19) has made it a putative target of lithium therapy for manic depression (34).Di-myo-inositol-1,1′-phosphate (DIP), a novel inositol phosphate compound found in hyperthermophilic archaea, including Pyrococcus woesei (43), Pyrococcus furiosus (41), Methanococcus igneus (11), and Thermotoga maritima (36), is used for osmotic balance at high growth temperatures. In order to understand what regulates its accumulation in cells, the DIP biosynthetic pathway must be well characterized in vitro. Based on 13C-labeling studies and assays of crude protein extracts from M. igneus (10), a pathway was proposed that converts glucose-6-phosphate to I-1-P (step 1), hydrolyzes some of the I-1-P to myo-inositol (step 2), and activates I-1-P to CDP-inositol (CDP-I) (step 3) for a final reaction (step 4) whereby CDP-I is coupled to myo-inositol, generating DIP and CMP (Fig. (Fig.1).1). Activities for I-1-P synthase, I-1-Pase, and DIP synthase in the DIP biosynthetic pathway have been detected in crude protein extracts of M. igneus (10). Phosphatase activities are ubiquitous in cells, and the observed activity in M. igneus could be due to a specific I-1-Pase activity or a nonspecific phosphatase. For mammalian and plant cells, I-1-Pases are all lithium sensitive and are inhibited at millimolar concentrations of Li+ (14, 15, 19, 30, 42). The partially purified phosphatase in M. igneus exhibited substrate specificity for dl-I-1-P over other sugar phosphates (10). It had an absolute requirement for Mg2+, a characteristic of all specific I-1-Pases studied thus far, and was also partially inhibited by Li+, though at a much higher concentration (160 mM for 50% activity inhibition) than reported for I-1-Pases from other cells. While this was suggestive of a specific I-1-Pase, the same protein fractions demonstrated considerable activity toward p-nitrophenylphosphate (pNPP), a very poor substrate for mammalian enzymes (1, 14). These preliminary characterizations of phosphatase activity suggested that archaeal I-1-Pases might be different from mammalian and plant enzymes. Open in a separate windowFIG. 1Proposed DIP biosynthetic pathway. Glucose-6-phosphate is converted to I-1-P (step 1), some of which is hydrolyzed to myo-inositol (step 2), and I-1-P is activated to CDP-I (step 3) for a final reaction in which CDP-I is coupled to myo-inositol (step 4), generating DIP and CMP.Methanococcus jannaschii was the first archaeon whose complete genomic sequence was determined (6). Of all the archaea with sequenced genomes, it is the closest to M. igneus. MJ109 encodes a 252-amino-acid protein that is highly homologous to both I-1-Pase and extragenic suppressor (the suhB gene product) (6). The latter gene product cloned in E. coli also has I-1-Pase activity (29). The putative identification of the MJ109 gene product as an I-1-Pase prompted us to express the gene product in E. coli and to examine its specific activity toward a variety of phosphate esters. The protein produced in this fashion clearly has I-1-Pase activity and shows several striking differences from plant and mammalian I-1-Pase activities. 相似文献
15.
16.
17.
18.
Mervyn L. de Souza Jennifer Seffernick Betsy Martinez Michael J. Sadowsky Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined.
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation. 相似文献
Atrazine-catabolizing bacteria used in this study.
Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).TABLE 1
Recently isolated atrazine-catabolizing bacteriaGenus | Strain | Location where isolated | Yr reported (reference) |
---|---|---|---|
Pseudomonasa | ADP | Agricultural-chemical dealership site, Little Falls, Minn. | 1995 (35) |
Ralstoniaa | M91-3 | Agricultural soil, Ohio | 1995 (46, 55) |
Mixed culture | Basel, Switzerland | 1995 (57) | |
Clavibacter | Agricultural soil, Riverside, Calif. | 1996 (13) | |
Agrobacterium | J14a | Agricultural soil, Nebraska | 1996 (39) |
NDb | 38/38 | Atrazine-contaminated soil, Indiana | 1996 (3) |
Alcaligenesa | SG1 | Industrial settling pond, San Gabriel, La. | 1997 (7) |
Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.
Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.
DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.TABLE 2
Sequence identities of atzABC homologs from different atrazine-degrading bacteriaStrain | % DNA sequence identitya
| ||
---|---|---|---|
atzA | atzB | atzC | |
Pseudomonas ADP | 100 | 100 | 100 |
Alcaligenes SG1 | 99.2 | 100 | 100 |
Ralstonia M91-3 | 99.0 | 100 | 100 |
Agrobacterium J14a | 99.1 | 100 | 100 |
Isolate 38/38 | 99.3 | 100 | 99.8 |
TABLE 3
Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compoundsGene | Enzyme | Average % protein sequence identitya (no. of pairwise comparisons) | References |
---|---|---|---|
dhlA, dhaA | Haloalkane dehalogenase | 25.0 (1) | 23, 31 |
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII | 2-Haloacid dehalogenase | 36.6 ± 3.9 (36) | 5, 25, 28, 29, 42, 43, 50, 59 |
tfdA | 2,4-Dichlorophenoxyacetate monooxygenase | 43.2 ± 4.6 (21)b | 34, 37, 38, 56, 58 |
dcmA | Dichloromethane dehalogenase | 56.0 (1) | 4, 32 |
atzA | Atrazine chlorohydrolase | 98.6 ± 0.12 (15)c | This study |
atzB | Hydroxyatrazine ethylaminohydrolase | 100 (10)c | This study |
atzC | N-Isopropylammelide isopropylaminohydrolase | 99.0 ± 0.43 (10)c | This study |
19.
Vincent G. H. Eijsink Marianne Skeie P. Hans Middelhoven May Bente Brurberg Ingolf F. Nes 《Applied and environmental microbiology》1998,64(9):3275-3281
Four class IIa bacteriocins (pediocin PA-1, enterocin A, sakacin P, and curvacin A) were purified to homogeneity and tested for activity toward a variety of indicator strains. Pediocin PA-1 and enterocin A inhibited more strains and had generally lower MICs than sakacin P and curvacin A. The antagonistic activity of pediocin-PA1 and enterocin A was much more sensitive to reduction of disulfide bonds than the antagonistic activity of sakacin P and curvacin A, suggesting that an extra disulfide bond that is present in the former two may contribute to their high levels of activity. The food pathogen Listeria monocytogenes was among the most sensitive indicator strains for all four bacteriocins. Enterocin A was most effective in inhibiting Listeria, having MICs in the range of 0.1 to 1 ng/ml. Sakacin P had the interesting property of being very active toward Listeria but not having concomitant high levels of activity toward lactic acid bacteria. Strains producing class IIa bacteriocins displayed various degrees of resistance toward noncognate class IIa bacteriocins; for the sakacin P producer, it was shown that this resistance is correlated with the expression of immunity genes. It is hypothesized that variation in the presence and/or expression of such immunity genes accounts in part for the remarkably large variation in bacteriocin sensitivity displayed by lactic acid bacteria.Many lactic acid bacteria (LAB), including members of the genera Lactococcus, Lactobacillus, Carnobacterium, Enterococcus, and Pediococcus, are known to secrete small, ribosomally synthesized antimicrobial peptides called bacteriocins (26, 29, 34). Some of these peptides undergo posttranslational modifications (class I bacteriocins), whereas others are not modified (class II bacteriocins) (29, 34). Class II bacteriocins contain between 30 and 60 residues and are usually positively charged at a neutral pH. Studies of a large number of class II bacteriocins have led to subgrouping of these compounds (29, 34). One of the subgroups, class IIa, contains bacteriocins that are characterized by the presence of YGNG and CXXXXCXV sequence motifs in their N-terminal halves as well as by their strong inhibitory effect on Listeria (e.g., 3, 4, 22, 23, 27, 28, 31, 38, 45) (Fig. (Fig.1).1). Because of their effectiveness against the food pathogen Listeria, class IIa bacteriocins have potential as antimicrobial agents in food and feed. Open in a separate windowFIG. 1Sequence alignment of class IIa bacteriocins. Residue numbering is according to the sequence of pediocin PA-1. Cysteine residues are printed in boldface; the two known class IIa bacteriocins with four cysteine residues are in the upper group. No attempt was made to optimize the alignment in the C-terminal halves of the peptides. Piscicolin 126 is identical to piscicocin V1a (4). Carnobacteriocin BM1 most probably is identical to piscicocin V1b (4). Sakacin P most probably is identical to bavaricin A (30). Curvacin A is identical to sakacin A (2). The consensus sequence includes residues conserved in at least 8 of the 12 sequences shown; 100% conserved residues are underlined.Class IIa bacteriocins act by permeabilizing the membrane of their target cells (1, 5, 6, 9, 10, 26, 28). The most recent studies on the mode of action of these bacteriocins indicate that antimicrobial activity does not require a specific receptor and is enhanced by (but not fully dependent on) a membrane potential (9, 28). Little is known about bacteriocin structure, and unravelling the relationships between structure and function is one of the great challenges in current bacteriocin research. A logical starting point for structure-function studies is a thorough study of the differences in activity and target cell specificity between naturally occurring homologous bacteriocins. A few such studies have been described, but these suffer from either a very limited number of tested indicator strains or the use of culture supernatants instead of purified bacteriocins (3, 4, 17, 45). The use of purified bacteriocins for comparative analyses is absolutely essential, since it is becoming increasingly evident that bacteriocin producers produce more than one bacteriocin (4, 8, 38, 48; this study).In the present study, the activities of four pure class IIa bacteriocins (pediocin PA-1, enterocin A, curvacin A, and sakacin P) (Fig. (Fig.1)1) were tested against a large number of LAB as well as several strains of the food pathogen Listeria monocytogenes. The bacteriocins were purified from their respective producer strains by use of an optimized purification protocol yielding highly pure samples. The contribution of disulfide formation was assessed and found to be important for activity. The effects of the purified bacteriocins on (noncognate) class IIa bacteriocin-producing strains are described, and the implications of our findings for immunity and resistance are discussed. 相似文献
20.
Hajime Shibuya Hiroaki Nagasaki Satoshi Kaneko Shigeki Yoshida Gwi Gun Park Isao Kusakabe Hideyuki Kobayashi 《Applied and environmental microbiology》1998,64(11):4489-4494
The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides.α-Galactosidase (αGal) (EC 3.2.1.22) is of particular interest in view of its biotechnological applications. αGal from coffee beans demonstrates a relatively broad substrate specificity, cleaving a variety of terminal α-galactosyl residues, including blood group B antigens on the erythrocyte surface. Treatment of type B erythrocytes with coffee bean αGal results in specific removal of the terminal α-galactosyl residues, thus generating serological type O erythrocytes (8). Cyamopsis tetragonoloba (guar) αGal effectively liberates the α-galactosyl residue of galactomannan. Removal of a quantitative proportion of galactose moieties from guar gum by αGal improves the gelling properties of the polysaccharide and makes them comparable to those of locust bean gum (18). In the sugar beet industry, αGal has been used to increase the sucrose yield by eliminating raffinose, which prevents normal crystallization of beet sugar (28). Raffinose and stachyose in beans are known to cause flatulence. αGal has the potential to alleviate these symptoms, for instance, in the treatment of soybean milk (16).αGals are also known to occur widely in microorganisms, plants, and animals, and some of them have been purified and characterized (5). Dey et al. showed that αGals are classified into two groups based on their substrate specificity. One group is specific for low-Mr α-galactosides such as pNPGal (p-nitrophenyl-α-d-galactopyranoside), melibiose, and the raffinose family of oligosaccharides. The other group of αGals acts on galactomannans and also hydrolyzes low-Mr substrates to various extents (6).We have studied the substrate specificity of αGals by using galactomanno-oligosaccharides such as Gal3Man3 (63-mono-α-d-galactopyranosyl-β-1,4-mannotriose) and Gal3Man4 (63-mono-α-d-galactopyranosyl-β-1,4-mannotetraose). The structures of these galactomanno-oligosaccharides are shown in Fig. Fig.1.1. Mortierella vinacea αGal I (11) and yeast αGals (29) are specific for the Gal3Man3 having an α-galactosyl residue (designated the terminal α-galactosyl residue) attached to the O-6 position of the nonreducing end mannose of β-1,4-mannotriose. On the other hand, Aspergillus niger 5-16 αGal (12) and Penicillium purpurogenum αGal (25) show a preference for the Gal3Man4 having an α-galactosyl residue (designated the stubbed α-galactosyl residue) attached to the O-6 position of the third mannose from the reducing end of β-1,4-mannotetraose. The M. vinacea αGal II (26) acts on both substrates to almost equal extents. The difference in specificity may be ascribed to the tertiary structures of these enzymes. Open in a separate windowFIG. 1Structures of galactomanno-oligosaccharides.Genes encoding αGals have been cloned from various sources, including humans (3), plants (20, 32), yeasts (27), filamentous fungi (4, 17, 24, 26), and bacteria (1, 2, 15). αGals from eukaryotes show a considerable degree of similarity and are grouped into family 27 (10).Here we describe the cloning of P. purpurogenum αGal cDNA, its expression in Saccharomyces cerevisiae, and the purification and characterization of the recombinant enzyme. 相似文献