首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 46 毫秒
1.
2.
3.
4.
5.
In the last two years, because of advances in protein separation and mass spectrometry, top-down mass spectrometry moved from analyzing single proteins to analyzing complex samples and identifying hundreds and even thousands of proteins. However, computational tools for database search of top-down spectra against protein databases are still in their infancy. We describe MS-Align+, a fast algorithm for top-down protein identification based on spectral alignment that enables searches for unexpected post-translational modifications. We also propose a method for evaluating statistical significance of top-down protein identifications and further benchmark various software tools on two top-down data sets from Saccharomyces cerevisiae and Salmonella typhimurium. We demonstrate that MS-Align+ significantly increases the number of identified spectra as compared with MASCOT and OMSSA on both data sets. Although MS-Align+ and ProSightPC have similar performance on the Salmonella typhimurium data set, MS-Align+ outperforms ProSightPC on the (more complex) Saccharomyces cerevisiae data set.In the past two decades, proteomics was dominated by bottom-up mass spectrometry that analyzes digested peptides rather than intact proteins. Bottom-up approaches, although powerful, do have limitations in analyzing protein species, e.g. various proteolytic forms of the same protein or various protein isoforms resulting from alternative splicing. Top-down mass spectrometry focuses on analyzing intact proteins and large peptides (110) and has advantages in localizing multiple post-translational modifications (PTMs)1 in a coordinated fashion (e.g. combinatorial PTM code) and identifying multiple protein species (e.g. proteolytically processed protein species) (11). Until recently, most top-down studies were limited to single purified proteins (1215). Top-down studies of protein mixtures were restricted by difficulties in separating and fragmenting intact proteins and a shortage of robust computational tools.In the last two years, because of advances in protein separation and top-down instrumentation, top-down mass spectrometry moved from analyzing single proteins to analyzing complex samples containing hundreds and even thousands of proteins (1621). Because algorithms for interpreting top-down spectra are still in their infancy, many recent developments include computational innovations in protein identification.Because top-down spectra are complex, the first step in top-down spectral interpretation is usually spectral deconvolution, which converts a complex top-down spectrum to a list of monoisotopic masses (a deconvolved spectrum). Every protein (possibly with modifications) can be scored against a top-down deconvoluted spectrum, resulting in a Protein-Spectrum-Match (PrSM). The top-down protein identification problem is finding a protein in a database with the highest scoring PrSM for a top-down spectrum and further output the PrSM if it is statistically significant. There are several software tools for top-down protein identification (
SoftwareIdentification of unexpected modificationsProteogenomics search against 6-frame translationSpeedEstimation of statistical significance
ProSightPC+/−a+Fast/Slowb+
PIITA+/−Fast
UStag++Fast
MS-TopDown+Slow
MS-Align+++Fast+
Open in a separate windowa ProSightPC has various search modes that contribute to bridging the gap between blind and restrictive modes of MS/MS database search. It can identify truncated proteins by using biomarker search and identify unexpected modifications by using Δm mode and setting the error tolerance of precursor mass to a large value (e.g., 1999 Da). However, it is not designed for identifying truncated proteins with unexpected PTMs which are not represented in the “shotgun annotated” database.b In its most advances mode, ProSightPC can search the annotated top-down database that contains various protein species. However, ProSightPC searches in this mode become an order of magnitude slower.We describe MS-Align+, a fast software tool for top-down protein identification. MS-Align+ shares the spectral alignment approach with MS-TopDown, but greatly improves on speed, statistical analysis (providing E-values of PrSMs), and the number of identified PrSMs (e.g. by finding spectral alignments between spectra and truncated proteins). We benchmarked various tools for top-down protein identification on two data sets from Saccharomyces cerevisiae (SC) and Salmonella typhimurium (ST). We demonstrate that MS-Align+ significantly increase the number of identified spectra as compared with MASCOT and OMSSA on both data sets. Although MS-Align+ and ProSightPC have similar performance on the ST data set, MS-Align+ outperforms ProSightPC on the more complex SC data set.  相似文献   

6.
A Systematic Proteomic Analysis of Listeria monocytogenes House-keeping Protein Secretion Systems     
Sven Halbedel  Swantje Reiss  Birgit Hahn  Dirk Albrecht  Gopala Krishna Mannala  Trinad Chakraborty  Torsten Hain  Susanne Engelmann  Antje Flieger 《Molecular & cellular proteomics : MCP》2014,13(11):3063-3081
  相似文献   

7.
Critical Factors Determining Dimerization of Human Antizyme Inhibitor     
Kuo-Liang Su  Ya-Fan Liao  Hui-Chih Hung    Guang-Yaw Liu 《The Journal of biological chemistry》2009,284(39):26768-26777
Ornithine decarboxylase (ODC) is the first enzyme involved in polyamine biosynthesis, and it catalyzes the decarboxylation of ornithine to putrescine. ODC is a dimeric enzyme, whereas antizyme inhibitor (AZI), a positive regulator of ODC that is homologous to ODC, exists predominantly as a monomer and lacks decarboxylase activity. The goal of this paper was to identify the essential amino acid residues that determine the dimerization of AZI. The nonconserved amino acid residues in the putative dimer interface of AZI (Ser-277, Ser-331, Glu-332, and Asp-389) were substituted with the corresponding residues in the putative dimer interface of ODC (Arg-277, Tyr-331, Asp-332, and Tyr-389, respectively). Analytical ultracentrifugation analysis was used to determine the size distribution of these AZI mutants. The size-distribution analysis data suggest that residue 331 may play a major role in the dimerization of AZI. Mutating Ser-331 to Tyr in AZI (AZI-S331Y) caused a shift from a monomer configuration to a dimer. Furthermore, in comparison with the single mutant AZI-S331Y, the AZI-S331Y/D389Y double mutant displayed a further reduction in the monomer-dimer Kd, suggesting that residue 389 is also crucial for AZI dimerization. Analysis of the triple mutant AZI-S331Y/D389Y/S277R showed that it formed a stable dimer (Kd value = 1.3 μm). Finally, a quadruple mutant, S331Y/D389Y/S277R/E332D, behaved as a dimer with a Kd value of ∼0.1 μm, which is very close to that of the human ODC enzyme. The quadruple mutant, although forming a dimer, could still be disrupted by antizyme (AZ), further forming a heterodimer, and it could rescue the AZ-inhibited ODC activity, suggesting that the AZ-binding ability of the AZI dimer was retained.Polyamines (putrescine, spermidine, and spermine) have been shown to have both structural and regulatory roles in protein and nucleic acid biosynthesis and function (13). Ornithine decarboxylase (ODC,3 EC 4.1.1.17) is a central regulator of cellular polyamine synthesis (reviewed in Refs. 1, 4, 5). This enzyme catalyzes the pyridoxal 5-phosphate (PLP)-dependent decarboxylation of ornithine to putrescine, and it is the first and rate-limiting enzyme in polyamine biosynthesis (2, 3, 6, 7). ODC and polyamines play important roles in a number of biological functions, including embryonic development, cell cycle, proliferation, differentiation, and apoptosis (815). They also have been associated with human diseases and a variety of cancers (1626). Because the regulation of ODC and polyamine content is critical to cell proliferation (11), as well as in the origin and progression of neoplastic diseases (23, 24), ODC has been identified as an oncogenic enzyme, and the inhibitors of ODC and the polyamine pathway are important targets for therapeutic intervention in many cancers (6, 11).ODC is ubiquitously found in organisms ranging from bacteria to humans. It contains 461 amino acid residues in each monomer and is a 106-kDa homodimer with molecular 2-fold symmetry (27, 28). Importantly, ODC activity requires the formation of a dimer (2931). X-ray structures of the ODC enzyme reveal that this dimer contains two active sites, both of which are formed at the interface between the N-terminal domain of one monomer, which provides residues involved in PLP interactions, and the C-terminal domain of the other subunit, which provides the residues that interact with substrate (27, 3241).ODC undergoes a unique ubiquitin-independent proteasomal degradation via a direct interaction with the regulatory protein antizyme (AZ). Binding of AZ promotes the dissociation of the ODC homodimers and targets ODC for degradation by the 26 S proteasome (4246). Current models of antizyme function indicate that increased polyamine levels promote the fidelity of the AZ mRNA translational frameshift, leading to increased concentrations of AZ (47). The AZ monomer selectively binds to dimeric ODC, thereby inactivating ODC by forming inactive AZ-ODC heterodimers (44, 4850). AZ acts as a regulator of polyamine metabolism that inhibits ODC activity and polyamine transport, thus restricting polyamine levels (4, 5, 51, 52). When antizymes are overexpressed, they inhibit ODC and promote ubiquitin-independent proteolytic degradation of ODC. Because elevated ODC activity is associated with most forms of human malignancies (1), it has been suggested that antizymes may function as tumor suppressors.In contrast to the extensive studies on the oncogene ODC, the endogenous antizyme inhibitor (AZI) is less well understood. AZI is homologous to the enzyme ODC. It is a 448-amino acid protein with a molecular mass of 50 kDa. However, despite the homology between these proteins, AZI does not possess any decarboxylase activity. It binds to antizyme more tightly than does ODC and releases ODC from the ODC-antizyme complex (53, 54). Both the AZI and AZ proteins display rapid ubiquitin-dependent turnover within a few minutes to 1 h in vivo (5). However, AZ binding actually stabilizes AZI by inhibiting its ubiquitination (55).AZI, which inactivates all members of the AZ family (53, 56), restores ODC activity (54), and prevents the proteolytic degradation of ODC, may play a role in tumor progression. It has been reported that down-regulation of AZI is associated with the inhibition of cell proliferation and reduced ODC activity, presumably through the modulation of AZ function (57). Moreover, overexpression of AZI has been shown to increase cell proliferation and promote cell transformation (5860). Furthermore, AZI is capable of direct interaction with cyclin D1, preventing its degradation, and this effect is at least partially independent of AZ function (60, 61). These results demonstrate a role for AZI in the positive regulation of cell proliferation and tumorigenesis.It is now known that ODC exists as a dimer and that AZI may exist as a monomer physiologically (62). Fig. 1 shows the dimeric structures of ODC (Fig. 1A) and AZI (Fig. 1B). Although structural studies indicate that both ODC and AZI crystallize as dimers, the dimeric AZI structure has fewer interactions at the dimer interface, a smaller buried surface area, and a lack of symmetry of the interactions between residues from the two monomers, suggesting that the AZI dimer may be nonphysiological (62). In this study, we identify the critical amino acid residues governing the difference in dimer formation between ODC and AZI. Our preliminary studies using analytical ultracentrifugation indicated that ODC exists as a dimer, whereas AZI exists in a concentration-dependent monomer-dimer equilibrium. Multiple sequence alignments of ODC and AZI from various species have shown that residues 277, 331, 332, and 389 are not conserved between ODC and AZI (Open in a separate windowFIGURE 1.Crystal structure and the amino acid residues at the dimer interface of human ornithine decarboxylase (hODC) and mouse antizyme inhibitor (mAZI). A, homodimeric structure of human ODC with the cofactor PLP analog, LLP (Protein Data Bank code 1D7K). B, putative dimeric structure of mouse AZI (Protein Data Bank code 3BTN). The amino acid residues in the dimer interface are shown as a ball-and-stick model. The putative AZ-binding site is colored in cyan. This figure was generated using PyMOL (DeLano Scientific LLC, San Carlos, CA).

TABLE 1

Amino acid residues at the dimer interface of human ODC and AZI
Human ODCResidueHuman AZI
Nonconserved
    Arg277Ser
    Tyr331Ser
    Asp332Glu
    Tyr389Asp

Conserved
    Asp134Asp
    Lys169Lys
    Lys294Lys
    Tyr323Tyr
    Asp364Asp
    Gly387Gly
    Phe397Phe
Open in a separate window  相似文献   

8.
Glycopeptide-preferring Polypeptide GalNAc Transferase 10 (ppGalNAc T10), Involved in Mucin-type O-Glycosylation, Has a Unique GalNAc-O-Ser/Thr-binding Site in Its Catalytic Domain Not Found in ppGalNAc T1 or T2     
Cynthia L. Perrine  Anjali Ganguli  Peng Wu  Carolyn R. Bertozzi  Timothy A. Fritz  Jayalakshmi Raman  Lawrence A. Tabak    Thomas A. Gerken 《The Journal of biological chemistry》2009,284(30):20387-20397
Mucin-type O-gly co sy la tion is initiated by a large family of UDP-GalNAc:polypeptide α-N-acetylgalactosaminyltransferases (ppGalNAc Ts) that transfer GalNAc from UDP-GalNAc to the Ser and Thr residues of polypeptide acceptors. Some members of the family prefer previously gly co sylated peptides (ppGalNAc T7 and T10), whereas others are inhibited by neighboring gly co sy la tion (ppGalNAc T1 and T2). Characterizing their peptide and glycopeptide substrate specificity is critical for understanding the biological role and significance of each isoform. Utilizing a series of random peptide and glycopeptide substrates, we have obtained the peptide and glycopeptide specificities of ppGalNAc T10 for comparison with ppGalNAc T1 and T2. For the glycopeptide substrates, ppGalNAc T10 exhibited a single large preference for Ser/Thr-O-GalNAc at the +1 (C-terminal) position relative to the Ser or Thr acceptor site. ppGalNAc T1 and T2 revealed no significant enhancements suggesting Ser/Thr-O-GalNAc was inhibitory at most positions for these isoforms. Against random peptide substrates, ppGalNAc T10 revealed no significant hydrophobic or hydrophilic residue enhancements, in contrast to what has been reported previously for ppGalNAc T1 and T2. Our results reveal that these transferases have unique peptide and glycopeptide preferences demonstrating their substrate diversity and their likely roles ranging from initiating transferases to filling-in transferases.Mucin-type O-glycosylation is a common post-translational modification of secreted and membrane-associated proteins. O-Glycan biosynthesis is initiated by the transfer of GalNAc from UDP-GalNAc to the hydroxyl groups of serine or threonine residues in a polypeptide, catalyzed by a family of polypeptide N-α-acetylgalactosaminyltransferases (ppGalNAc Ts).5 To date, 16 mammalian members have been reported in the literature (116) with a total of at least 20 members currently present in the human genome data base. Multiple members of the ppGalNAc T family have also been identified in Drosophila (9, 10, 14), Caenorhabditis elegans (3, 8), and single and multicellular organisms (1720). Several members show close sequence orthologues across species suggesting that the ppGalNAc Ts are responsible for biologically significant functions that have been conserved during evolution. For example, in Drosophila four isoforms have close sequence orthologues to the mammalian transferases. Of the two that have been recently compared, nearly identical peptide substrate specificities have been observed between the fly and mammals, suggesting common but presently unknown functions preserved across these diverse species (21).Recently, several ppGalNAc T isoforms have been shown to be important for normal development or cellular processes. For example, inactive mutations in the fly PGANT35A (the T11 orthologue in mammals) are lethal because of the disruption of the tracheal tube structures (9, 10, 22), whereas mutations in PGANT3 alter epithelial cell adhesion in the Drosophila wing blade resulting in wing blistering (23). In humans, mutations in ppGalNAc T3 are associated with familial tumoral calcinosis, the result of the abnormal processing and secretion of the phosphaturic factor FGF23 (24, 25). Human ppGalNAc T14 has been suggested to modulate apoptotic signaling in tumor cells by its glycosylation of the proapoptotic receptors DLR4 and DLR5 (26), and very recently the specific O-glycosylation of the TGFB-II receptor (ActR-II) by the GalNTL1 has been shown to modulate its signaling in development (16).Historically, the major targets of the ppGalNAc Ts have been thought to be heavily O-glycosylated mucin domains of membrane and secreted glycoproteins. Such domains typically contain 15–30% Ser or Thr, which are highly (>50%) substituted by GalNAc. One question in the field is as follows. How is this high degree of peptide core glycosylation achieved and is it related to the large number of ppGalNAc isoforms, some of which may even have specific mucin domain preferences? Interestingly, some members of the ppGalNAc T family are known to prefer substrates that have been previously modified with O-linked GalNAc on nearby Ser/Thr residues, hence having so-called glycopeptide or filling-in activities, i.e. ppGalNAc T7 and T10 (8, 2729). Others simply possess altered preferences against glycopeptide substrates, i.e. ppGalNAc T2 and T4 (3033), or may be inhibited by neighboring glycosylation, i.e. ppGalNAc T1 and T2 (29, 34, 35). These latter transferases have been called early or initiating transferases, preferring nonglycosylated over-glycosylated substrates. Presently, little is known about which factors dictate the different peptide/glycopeptide specificities among the ppGalNAc Ts.The ppGalNAc Ts consist of an N-terminal catalytic domain tethered by a short linker to a C-terminal ricin-like lectin domain containing three recognizable carbohydrate-binding sites (36). Because ppGalNAc T7 and T10 prefer to transfer GalNAc to glycopeptide acceptors, it has been widely assumed that their C-terminal lectin domains would play significant roles in this activity, as has been demonstrated for other family members (27, 28, 32). Recently, Kubota et al. (37) solved the crystal structure of ppGalNAc T10 in complex with Ser-GalNAc specifically bound to its lectin domain. In this work (37), the authors further demonstrated that a T10 lectin domain mutant indeed had altered specificity against GalNAc-containing glycopeptide substrates when the acceptor Ser/Thr site was distal from the pre-existing glycopeptide GalNAc site. However, it was also observed that the lectin mutant still possessed relatively unaltered glycopeptide activity when the acceptor Ser/Thr site was directly N-terminal of a pre-existing glycopeptide GalNAc site. Kubota et al. (37) therefore concluded that for ppGalNAc T10, both its lectin and indeed its catalytic domain must contain distinct peptide GalNAc recognition sites. In support of this, Raman et al. (33) have shown that the complete removal of the ppGalNAc T10 lectin domain only slightly alters its specificity against distal glycopeptide substrates while showing no difference in its ability to glycosylate residues directly N-terminal of an existing site of glycosylation. Thus, it seems that the catalytic domain of ppGalNAc T10 may have specific requirements for a peptide O-linked GalNAc in at least the +1 position (toward the C terminus) of residues being glycosylated. As no systematic determination of the glycopeptide binding properties of the ppGalNAc Ts catalytic domain has been performed, it is unknown whether additional GalNAc peptide-binding sites exist in T10 or, for that matter, any of the other ppGalNAc Ts.We have recently reported the use of oriented random peptide substrates, GAGA(X)nT(X)nAGAGK (where X indicates randomized amino acid positions and n = 3 and 5) for determining the peptide substrate specificities of mammalian ppGalNAc T1, T2, and their fly orthologues (21, 38). In the present work, we extend this approach to the determination of the catalytic domain glycopeptide (Ser/Thr-O-GalNAc) substrate preferences for ppGalNAc T1, T2, and T10 employing two n = 4 oriented random glycopeptide libraries (21). Interestingly, ppGalNAc T10 displays few significant enhancements and specifically lacks the Pro residue enhancements observed for ppGalNAc T1 and T2. These findings further demonstrate the vast substrate diversity of the catalytic domains of the ppGalNAc T family of transferases.

TABLE 1

ppGalNAc transferase random substrates utilized in this workPVI, PVII, GP-I, and GP-II random (glyco)peptide substrates.
PeptideSequenceNo. of unique sequences
GAGAXXXXXTXXXXXAGAGK
P-VIX = G, A, P, V, L, Y, E, Q, R, H10 × 109
P-VIIX = G, A, P, I, M, F, D, N, R, K10 × 109

GAGAXXXXTXXXXAGAG
GP-IX = G, A, P, V, I, F, Y, E, D, N, R, K, H, and Ser-O-α-GalNAc1.47 × 109

GAGAXXXX(Thr-O-α-GalNAc)XXXXAGAG
GP-IIX = G, A, P, V, I, F, Y, E, D, N, R, K, H, S1.47 × 109
Open in a separate window  相似文献   

9.
Mode of Action of cGMP-dependent Protein Kinase-specific Inhibitors Probed by Photoaffinity Cross-linking Mass Spectrometry     
Martijn W. H. Pinkse  Dirk T. S. Rijkers  Wolfgang R. Dostmann    Albert J. R. Heck 《The Journal of biological chemistry》2009,284(24):16354-16368
The inhibitor peptide DT-2 (YGRKKRRQRRRPPLRKKKKKH) is the most potent and selective inhibitor of the cGMP-dependent protein kinase (PKG) known today. DT-2 is a construct of a PKG tight binding sequence (W45, LRKKKKKH, KI = 0.8 μm) and a membrane translocating sequence (DT-6, YGRKKRRQRRRPP, KI = 1.1 μm), that combined strongly inhibits PKG catalyzed phosphorylation (KI = 12.5 nm) with ∼1000-fold selectivity toward PKG over protein kinase A, the closest relative of PKG. However, the molecular mechanism behind this inhibition is not entirely understood. Using a combination of photoaffinity labeling, stable isotope labeling, and mass spectrometry, we have located the binding sites of PKG-specific substrate and inhibitor peptides. Covalent linkage of a PKG-specific substrate analogue was localized in the catalytic core on residues 356–372, also known as the glycine-rich loop, essential for ATP binding. By analogy, the individual inhibitor peptides W45 and DT-6 were also found to cross-link near the glycine-rich loop, suggesting these are both substrate competitive inhibitors. A bifunctional photoreactive analogue of DT-2 was found to generate dimers of PKG. This cross-linking induced covalent PKG dimerization was not observed for an N-terminal deletion mutant of PKG, which lacks the dimerization domain. In addition, non-covalent mass spectrometry was used to determine binding stoichiometry and binding order of the inhibitor peptides. Dimeric PKG binds two W45 and DT-6 peptides, whereas only one DT-2 molecule was observed to bind to the dimeric PKG. Taken together, these findings imply that (i) the two individual components making up DT-2 are both targeted against the substrate-binding site and (ii) binding of a single DT-2 molecule inactivates both PKG monomers simultaneously, which is an indication that (iii) in cGMP-activated PKG the catalytic centers of both subunits may be in each other''s proximity.Among the superfamily of protein kinases the two cyclic nucleotide-regulated protein kinases, cAMP-dependent protein kinase and cGMP-dependent protein kinase, form a closely related subfamily of serine/threonine protein kinases (14). Both proteins share several structural elements, such as the N-terminal dimerization domain, an autoinhibition site, two in-tandem cyclic nucleotide-binding sites, and a highly conserved catalytic core (Fig. 1, A and B). Despite these similarities, these two enzymes display differences, which account for their unique properties. Whereas PKA2 is nearly ubiquitous, PKG is primarily found in the lung, cerebellum, and smooth muscles (5, 6). From a structural point of view these cyclic nucleotide-dependent protein kinases differ as well. The holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. The catalytic subunits are non-covalently attached to the regulatory subunit dimer. Upon interaction with cAMP, the catalytic subunits dissociate from the holoenzyme and are free to catalyze heterophosphorylation (Fig. 1C). The mammalian type I PKGs are homodimeric cytosolic proteins containing two identical polypeptides of ∼76 kDa. Alternative mRNA splicing produces type Iα and type Iβ PKG, which are identical proteins apart from their first ∼100 N-terminal residues (7). Each PKG subunit is composed of a regulatory and a catalytic domain on a single polypeptide chain. Consequently, when cGMP activates PKG, the catalytic and regulatory components remain physically attached (Fig. 1D). Within the catalytic domain PKA and PKG share a strong primary sequence homology (8). Not surprisingly, these enzymes also exhibit overlapping substrate specificities, a feature that often interferes with efforts to elucidate their distinct biological pathways. Peptide substrates with a primary amino acid sequence motif RRX(S/T)X are in general recognized by both PKA and PKG (9). Besides this strong overlapping substrate specificity, several studies report on subtle differences in determinants that discriminate for PKA and PKG substrate specificity (1016). To specifically discriminate between PKG and PKA activity in biological assays a highly specific PKG peptide inhibitor was developed (17). This peptide, YGRKKRRQRRRPPLRKKKKKH (DT-2), is the most potent and selective PKG inhibitor known today. Recently, the validity of DT-2 as a superior inhibitor of PKG in terms of potency, selectivity, and membrane permeability has been demonstrated (1824). The inhibitor is a construct of a substrate competitive sequence, LRKKKKKH (W45), derived from a library screen that selected for tight PKG binding sequences, with a significant specificity toward PKG over PKA, and a membrane translocating signal peptide, YGRKKRRQRRRPP (DT-6). DT-2 strongly inhibits PKG-catalyzed phosphorylation (Ki = 12.5 nm), however, the molecular nature of DT-2 inhibition is not entirely understood (25). Because high resolution structural data are not available for PKG, one of our goals is to elucidate binding sites for PKG-specific substrates and inhibitors in more detail using a combination of mass spectrometric techniques and photoaffinity labeling. To further delineate the nature of inhibition we have developed photoaffinity analogues of DT-2 and related inhibitory peptides, as well as a high affinity peptide substrate. The method of photoaffinity labeling enables the direct probing of target proteins through a covalent bond, which is photochemically introduced between a ligand and its specific receptor (26). In combination with modern mass spectrometric techniques this is a powerful approach for the characterization of peptide-protein interactions (27). Substrate and inhibitor peptides containing photoactivatable analogues of phenylalanine, 4-benzoyl-l-phenylalanine (Phe(Bz)) or 4′-(3-(trifluoromethyl)-3H-diazirin-3-yl)-l-phenylalanine (Phe(Tmd)) were synthesized and used to locate their substrate/inhibitor-binding sites on PKG. These measurements indicate that the substrate peptide resides near the glycine-rich loop within the catalytic domain and that the inhibitor peptides are directed similarly toward this substrate-binding site, thereby acting as competitive inhibitors. In addition, nanoflow electrospray ionization time of flight mass spectrometry (ESI-TOF-MS) was performed to study the interaction between DT-2 and PKG in more detail. ESI-MS has proven to be a useful tool to analyze the non-covalent interaction of proteins with ligands, oligonucleotides, peptides, or other proteins (2831). Using this technique, important information on conformational changes (3235), measurement of relative dissociation constants (36, 37), and sequential binding order and cooperativity (38, 39) can be obtained. ESI-MS confirms that PKG is primarily a homodimer and is able to bind four cGMP molecules. Binding of DT-2 was strongly enhanced in the presence of cGMP. Surprising is the observation that only one DT-2 molecule binds to dimeric PKG. The information derived from these measurements allows for molecular modeling and structural refinements of the next generation of PKG-selective inhibitors.Open in a separate windowFIGURE 1.Linear arrangement of the functional domains of the regulatory and catalytic subunit of PKA (A) and PKG (B) type I and schematic representation of the current working models of the activation process of PKA (C) and PKG (D) type 1. Binding of cAMP to the PKA induces a conformational change that results in the dissociation of the catalytic subunits. Binding of cGMP to PKG also induces a conformational change, which exposes the catalytic domains, but both catalytic domains remain near each other via the N-terminal dimerization domain. (Images adapted from Scholten et al. (4).)

TABLE 1

Inhibition contants (KI) of PKA- or PKG-specific peptide inhibitors and the PKA/PKG specificity index
PeptideSequencePKGKiPKAKiSpecificity index (PKA/PKG)Ref.
μmμm
PKI(5–24)TTYDFIASGRTGRRNAIHD-NH21500.0030.0002(11)
WW21TQAKRKKALAMA-NH27.5750100(11)
W45LRKKKKKH0.82 ± 0.33559680(17)
DT-6YGRGGRRQRRRPP1.1 ± 0.2226 ± 423.6(17)
DT-2YGRKKRRQRRRPPLRKKKKKH0.0125 ± 0.00316.5 ± 3.81320(17)
Open in a separate window  相似文献   

10.
Molecular and Biochemical Characterization of the Protein Template Controlling Biosynthesis of the Lipopeptide Lichenysin     
Dirk Konz  Sascha Doekel  Mohamed A. Marahiel 《Journal of bacteriology》1999,181(1):133-140
Lichenysins are surface-active lipopeptides with antibiotic properties produced nonribosomally by several strains of Bacillus licheniformis. Here, we report the cloning and sequencing of an entire 26.6-kb lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Three large open reading frames coding for peptide synthetases, designated licA, licB (three modules each), and licC (one module), could be detected, followed by a gene, licTE, coding for a thioesterase-like protein. The domain structure of the seven identified modules, which resembles that of the surfactin synthetases SrfA-A to -C, showed two epimerization domains attached to the third and sixth modules. The substrate specificity of the first, fifth, and seventh recombinant adenylation domains of LicA to -C (cloned and expressed in Escherichia coli) was determined to be Gln, Asp, and Ile (with minor Val and Leu substitutions), respectively. Therefore, we suppose that the identified biosynthesis operon is responsible for the production of a lichenysin variant with the primary amino acid sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile, with minor Leu and Val substitutions at the seventh position.Many strains of Bacillus are known to produce lipopeptides with remarkable surface-active properties (11). The most prominent of these powerful lipopeptides is surfactin from Bacillus subtilis (1). Surfactin is an acylated cyclic heptapeptide that reduces the surface tension of water from 72 to 27 mN m−1 even in a concentration below 0.05% and shows some antibacterial and antifungal activities (1). Some B. subtilis strains are also known to produce other, structurally related lipoheptapeptides (Table (Table1),1), like iturin (32, 34) and bacillomycin (3, 27, 30), or the lipodecapeptides fengycin (50) and plipastatin (29).

TABLE 1

Lipoheptapeptide antibiotics of Bacillus spp.
LipopeptideOrganismStructureReference
Lichenysin AB. licheniformisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asn-D-Leu-L-Ile51, 52
Lichenysin BFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu23, 26
Lichenysin CFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile17
Lichenysin DFAa-L-Gln-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-IleThis work
Surfactant 86B. licheniformisFAa-L-Glxd-L-Leu-D-Leu-L-Val-L-Asxd-D-Leu-L-Ilee14, 15
L-Val
SurfactinB. subtilisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu1, 7, 49
EsperinB. subtilisFAb-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leue45
L-Val 
Iturin AB. subtilisFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Ser32
Iturin CFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asne-L-Asne34
D-Ser-L-Thr 
Bacillomycin LB. subtilisFAc-L-Asp-D-Tyr-D-Asn-L-Ser-L-Gln-D-Proe-L-Thr3
D-Ser- 
Bacillomycin DFAc-L-Asp-D-Tyr-D-Asn-L-Pro-L-Glu-D-Ser-L-Thr30, 31
Bacillomycin FFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Thr27
Open in a separate windowaFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of the C-terminal amino acid. bFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of Asp5. cFA, β-amino fatty acid. The β-amino group forms a peptide bond with the carboxy group of the C-terminal amino acid. dOnly the following combinations of amino acid 1 and 5 are allowed: Gln-Asp or Glu-Asn. eWhere an alternative amino acid may be present in a structure, the alternative is also presented. In addition to B. subtilis, several strains of Bacillus licheniformis have been described as producing the lipopeptide lichenysin (14, 17, 23, 26, 51). Lichenysins can be grouped under the general sequence l-Glx–l-Leu–d-Leu–l-Val–l-Asx–d-Leu–l-Ile/Leu/Val (Table (Table1).1). The first amino acid is connected to a β-hydroxyl fatty acid, and the carboxy-terminal amino acid forms a lactone ring to the β-OH group of the lipophilic part of the molecule. In contrast to the lipopeptide surfactin, lichenysins seem to be synthesized during growth under aerobic and anaerobic conditions (16, 51). The isolation of lichenysins from cells growing on liquid mineral salt medium on glucose or sucrose basic has been studied intensively. Antimicrobial properties and the ability to reduce the surface tension of water have also been described (14, 17, 26, 51). The structural elucidation of the compounds revealed slight differences, depending on the producer strain. Various distributions of branched and linear fatty acid moieties of diverse lengths and amino acid variations in three defined positions have been identified (Table (Table11).In contrast to the well-defined methods for isolation and structural characterization of lichenysins, little is known about the biosynthetic mechanisms of lichenysin production. The structural similarity of lichenysins and surfactin suggests that the peptide moiety is produced nonribosomally by multifunctional peptide synthetases (7, 13, 25, 49, 53). Peptide synthetases from bacterial and fungal sources describe an alternative route in peptide bond formation in addition to the ubiquitous ribosomal pathway. Here, large multienzyme complexes affect the ordered recognition, activation, and linking of amino acids by utilizing the thiotemplate mechanism (19, 24, 25). According to this model, peptide synthetases activate their substrate amino acids as aminoacyl adenylates by ATP hydrolysis. These unstable intermediates are subsequently transferred to a covalently enzyme-bound 4′-phosphopantetheinyl cofactor as thioesters. The thioesterified amino acids are then integrated into the peptide product through a stepwise elongation by a series of transpeptidations directed from the amino terminals to the carboxy terminals. Peptide synthetases have not only awakened interest because of their mechanistic features; many of the nonribosomally processed peptide products also possess important biological and medical properties.In this report we describe the identification and characterization of a putative lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Cloning and sequencing of the entire lic operon (26.6 kb) revealed three genes, licA, licB, and licC, with structural patterns common to peptide synthetases and a gene designated licTE, which codes for a putative thioesterase. The modular organization of the sequenced genes resembles the requirements for the biosynthesis of the heptapeptide lichenysin. Based on the arrangement of the seven identified modules and the tested substrate specificities, we propose that the identified genes are involved in the nonribosomal synthesis of the portion of the lichenysin peptide with the primary sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile (with minor Val and Leu substitutions).  相似文献   

11.
Disease Mutations in the Human Mitochondrial DNA Polymerase Thumb Subdomain Impart Severe Defects in Mitochondrial DNA Replication     
Rajesh Kasiviswanathan  Matthew J. Longley  Sherine S. L. Chan    William C. Copeland 《The Journal of biological chemistry》2009,284(29):19501-19510
Forty-five different point mutations in POLG, the gene encoding the catalytic subunit of the human mitochondrial DNA polymerase (pol γ), cause the early onset mitochondrial DNA depletion disorder, Alpers syndrome. Sequence analysis of the C-terminal polymerase region of pol γ revealed a cluster of four Alpers mutations at highly conserved residues in the thumb subdomain (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) and two Alpers mutations at less conserved positions in the adjacent palm subdomain (Q879H, c.2637g→t and T885S, c.2653a→t). Biochemical characterization of purified, recombinant forms of pol γ revealed that Alpers mutations in the thumb subdomain reduced polymerase activity more than 99% relative to the wild-type enzyme, whereas the palm subdomain mutations retained 50–70% wild-type polymerase activity. All six mutant enzymes retained physical and functional interaction with the pol γ accessory subunit (p55), and none of the six mutants exhibited defects in misinsertion fidelity in vitro. However, differential DNA binding by these mutants suggests a possible orientation of the DNA with respect to the polymerase during catalysis. To our knowledge this study represents the first structure-function analysis of the thumb subdomain in pol γ and examines the consequences of mitochondrial disease mutations in this region.As the only DNA polymerase found in animal cell mitochondria, DNA polymerase γ (pol γ)3 bears sole responsibility for DNA synthesis in all replication and repair transactions involving mitochondrial DNA (1, 2). Mammalian cell pol γ is a heterotrimeric complex composed of one catalytic subunit of 140 kDa (p140) and two 55-kDa accessory subunits (p55) that form a dimer (3). The catalytic subunit contains an N-terminal exonuclease domain connected by a linker region to a C-terminal polymerase domain. Whereas the exonuclease domain contains essential motifs I, II, and III for its activity, the polymerase domain comprising the thumb, palm, and finger subdomains contains motifs A, B, and C that are crucial for polymerase activity. The catalytic subunit is a family A DNA polymerase that includes bacterial pol I and T7 DNA polymerase and possesses DNA polymerase, 3′ → 5′ exonuclease, and 5′-deoxyribose phosphate lyase activities (for review, see Refs. 1 and 2). The 55-kDa accessory subunit (p55) confers processive DNA synthesis and tight binding of the pol γ complex to DNA (4, 5).Depletion of mtDNA as well as the accumulation of deletions and point mutations in mtDNA have been observed in several mitochondrial disorders (for review, see Ref. 6). mtDNA depletion syndromes are caused by defects in nuclear genes responsible for replication and maintenance of the mitochondrial genome (7). Mutation of POLG, the gene encoding the catalytic subunit of pol γ, is frequently involved in disorders linked to mutagenesis of mtDNA (8, 9). Presently, more than 150 point mutations in POLG are linked with a wide variety of mitochondrial diseases, including the autosomal dominant (ad) and recessive forms of progressive external ophthalmoplegia (PEO), Alpers syndrome, parkinsonism, ataxia-neuropathy syndromes, and male infertility (tools.niehs.nih.gov/polg) (9).Alpers syndrome, a hepatocerebral mtDNA depletion disorder, and myocerebrohepatopathy are rare heritable autosomal recessive diseases primarily affecting young children (1012). These diseases generally manifest during the first few weeks to years of life, and symptoms gradually develop in a stepwise manner eventually leading to death. Alpers syndrome is characterized by refractory seizures, psychomotor regression, and hepatic failure (11, 12). Mutation of POLG was first linked to Alpers syndrome in 2004 (13), and to date 45 different point mutations in POLG (18 localized to the polymerase domain) are associated with Alpers syndrome (9, 14, 15). However, only two Alpers mutations (A467T and W748S, both in the linker region) have been biochemically characterized (16, 17).During the initial cloning and sequencing of the human, Drosophila, and chicken pol γ genes, we noted a highly conserved region N-terminal to motif A in the polymerase domain that was specific to pol γ (18). This region corresponds to part of the thumb subdomain that tracks DNA into the active site of both Escherichia coli pol I and T7 DNA polymerase (1921). A high concentration of disease mutations, many associated with Alpers syndrome, is found in the thumb subdomain.Here we investigated six mitochondrial disease mutations clustered in the N-terminal portion of the polymerase domain of the enzyme (Fig. 1A). Four mutations (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) reside in the thumb subdomain and two (Q879H, c.2637g→t and T885S, c.2653a→t) are located in the palm subdomain. These mutations are associated with Alpers, PEO, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), ataxia-neuropathy syndrome, Leigh syndrome, and myocerebrohepatopathy (POLG mutationDiseaseGeneticsReferenceG848SAlpers syndromeIn trans with A467T, Q497H, T251I-P587L, or W748S-E1143G in Alpers syndrome15, 35, 4350Leigh syndromeIn trans with R232H in Leigh syndrome49MELASIn trans with R627Q in MELAS38PEO with ataxia-neuropathyIn trans with G746S and E1143G in PEO with ataxia50PEOIn trans with T251I and P587L in PEO51, 52T851AAlpers syndromeIn trans with R1047W48, 53In trans with H277CR852CAlpers syndromeIn trans with A467T14, 48, 50In cis with G11D and in trans with W748S-E1143G or A467TAtaxia-neuropathyIn trans with G11D-R627Q15R853QMyocerebrohepatopathyIn trans with T251I-P587L15Q879HAlpers syndrome with valproate-induced hepatic failureIn cis with E1143G and in trans with A467T-T885S35, 54T885SAlpers syndrome with valproate-induced hepatic failureIn cis with A467T and in trans with Q879H-E1143G35, 54Open in a separate windowOpen in a separate windowFIGURE 1.POLG mutations characterized in this study. A, the location of the six mutations characterized is shown in red in the primary sequence of pol γ. Four mutations, the G848S, T851A, R852C, and R853Q, are located in the thumb domain, whereas two mutations, the Q879H and T885S, are in the palm domain of the polymerase region. B, sequence alignment of pol γ from yeast to humans. The amino acids characterized in this study are shown in red. Yellow-highlighted amino acids are highly conserved, and blue-highlighted amino acids are moderately conserved.  相似文献   

12.
Neurodegeneration and Alzheimer's disease (AD). What Can Proteomics Tell Us About the Alzheimer's Brain?     
Guillermo Moya-Alvarado  Noga Gershoni-Emek  Eran Perlson  Francisca C. Bronfman 《Molecular & cellular proteomics : MCP》2016,15(2):409-425
  相似文献   

13.
Evidence for a New Avian Paramyxovirus Serotype 10 Detected in Rockhopper Penguins from the Falkland Islands     
Patti J. Miller  Claudio L. Afonso  Erica Spackman  Melissa A. Scott  Janice C. Pedersen  Dennis A. Senne  Justin D. Brown  Chad M. Fuller  Marcela M. Uhart  William B. Karesh  Ian H. Brown  Dennis J. Alexander  David E. Swayne 《Journal of virology》2010,84(21):11496-11504
The biological, serological, and genomic characterization of a paramyxovirus recently isolated from rockhopper penguins (Eudyptes chrysocome) suggested that this virus represented a new avian paramyxovirus (APMV) group, APMV10. This penguin virus resembled other APMVs by electron microscopy; however, its viral hemagglutination (HA) activity was not inhibited by antisera against any of the nine defined APMV serotypes. In addition, antiserum generated against this penguin virus did not inhibit the HA of representative viruses of the other APMV serotypes. Sequence data produced using random priming methods revealed a genomic structure typical of APMV. Phylogenetic evaluation of coding regions revealed that amino acid sequences of all six proteins were most closely related to APMV2 and APMV8. The calculation of evolutionary distances among proteins and distances at the nucleotide level confirmed that APMV2, APMV8, and the penguin virus all were sufficiently divergent from each other to be considered different serotypes. We propose that this isolate, named APMV10/penguin/Falkland Islands/324/2007, be the prototype virus for APMV10. Because of the known problems associated with serology, such as antiserum cross-reactivity and one-way immunogenicity, in addition to the reliance on the immune response to a single protein, the hemagglutinin-neuraminidase, as the sole base for viral classification, we suggest the need for new classification guidelines that incorporate genome sequence comparisons.Viruses from the Paramyxoviridae family have caused disease in humans and animals for centuries. Over the last 40 years, many paramyxoviruses isolated from animals and people have been newly described (16, 17, 22, 29, 31, 32, 36, 42, 44, 46, 49, 58, 59, 62-64). Viruses from this family are pleomorphic, enveloped, single-stranded, nonsegmented, negative-sense RNA viruses that demonstrate serological cross-reactivity with other paramyxoviruses related to them (30, 46). The subfamily Paramyxovirinae is divided into five genera: Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, and Avulavirus (30). The Avulavirus genus contains nine distinct avian paramyxovirus (APMV) serotypes (Table (Table1),1), and information on the discovery of each has been reported elsewhere (4, 6, 7, 9, 12, 34, 41, 50, 51, 60, 68).

TABLE 1.

Characteristics of prototype viruses APMV1 to APMV9 and the penguin virus
StrainHostDiseaseDistributionFusion cleavagecGI accession no.
APMV1/Newcastle disease virus>250 speciesHigh mortalityWorldwideGRRQKRF45511218
InapparentWorldwideGGRQGRLa11545722
APMV2/Chicken/CA/Yucaipa/1956Turkey, chickens, psittacines, rails, passerinesDecrease in egg production and respiratory diseaseWorldwideDKPASRF169144527
APMV3/Turkey/WI/1968TurkeyMild respiratory disease and moderate egg decreaseWorldwidePRPSGRLa209484147
APMV3/Parakeet/Netherlands/449/1975Psittacines, passerines, flamingosNeurological, enteric, and respiratory diseaseWorldwideARPRGRLa171472314
APMV4/Duck/Hong Kong/D3/1975Duck, geese, chickensNone knownWorldwideVDIQPRF210076708
APMV5/Budgerigar/Japan/Kunitachi/1974Budgerigars, lorikeetsHigh mortality, enteric diseaseJapan, United Kingdom, AustraliaGKRKKRFa290563909
APMV6/Duck/Hong Kong/199/1977Ducks, geese, turkeysMild respiratory disease and increased mortality in turkeysWorldwidePAPEPRLb15081567
APMV7/Dove/TN/4/1975Pigeons, doves, turkeysMild respiratory disease in turkeysUnited States, England, JapanTLPSSRF224979458
APMV8/Goose/DE/1053/1976Ducks, geeseNone knownUnited States, JapanTYPQTRLa226343050
APMV9/Duck/NY/22/1978DucksNone knownWorldwideRIREGRIa217068693
APMV10/Penguin/Falkland Islands/324/2007Rockhopper penguinsNone KnownFalkland IslandsDKPSQRIa300432141
Open in a separate windowaRequires the addition of an exogenous protease.bProtease requirement depends on the isolate examined.cPutative.Six of these serotypes were classified in the latter half of the 1970s, when the most reliable assay available to classify paramyxoviruses was the hemagglutination inhibition (HI) assay (61). However, there are multiple problems associated with the use of serology, including the inability to classify some APMVs by comparing them to the sera of the nine defined APMVs alone (2, 8). In addition, one-way antigenicity and cross-reactivity between different serotypes have been documented for many years (4, 5, 14, 25, 29, 33, 34, 41, 51, 52, 60). The ability of APMVs, like other viruses, to show antigenic drift as it evolves over time (37, 43, 54) and the wide use and availability of precise molecular methods, such as PCR and genome sequencing, demonstrate the need for a more practical classification system.The genetic diversity of APMVs is still largely unexplored, as hundreds of avian species have never been surveyed for the presence of viruses that do not cause significant signs of disease or are not economically important. The emergence of H5N1 highly pathogenic avian influenza (HPAI) virus as the cause of the largest outbreak of a virulent virus in poultry in the past 100 years has spurred the development of surveillance programs to better understand the ecology of avian influenza (AI) viruses in aquatic birds around the globe, and in some instances it has provided opportunities for observing other viruses in wild bird populations (15, 53). In 2007, as part of a seabird health surveillance program in the Falkland Islands (Islas Malvinas), oral and cloacal swabs and serum were collected from rockhopper penguins (Eudyptes chrysocome) and environmental/fecal swab pools were collected from other seabirds.While AI virus has not yet been isolated from penguins in the sub-Antarctic and Antarctic areas, there have been two reports of serum antibodies positive to H7 and H10 from the Adélie species (11, 40). Rare isolations of APMV1, both virulent (45) and of low virulence (8), have been reported from Antarctic penguins. Sera positive for APMV1 and AMPV2 have also been reported (21, 24, 38, 40, 53). Since 1981, paramyxoviruses have been isolated from king penguins (Aptenodytes patagonicus), royal penguins (Eudyptes schlegeli), and Adélie penguins (Pygoscelis adeliae) from Antarctica and little blue penguins (Eudyptula minor) from Australia that cannot be identified as belonging to APMV1 to -9 and have not yet been classified (8, 11, 38-40). The morphology, biological and genomic characteristics, and antigenic relatedness of an APMV recently isolated from multiple penguin colonies on the Falkland Islands are reported here. Evidence that the virus belongs to a new serotype (APMV10) and a demonstration of the advantages of a whole genome system of analysis based on random sequencing followed by comparison of genetic distances are presented. Only after all APMVs are reported and classified will epidemiological information be known as to how the viruses are moving and spreading as the birds travel and interact with other avian species.  相似文献   

14.
The Atrazine Catabolism Genes atzABC Are Widespread and Highly Conserved     
Mervyn L. de Souza  Jennifer Seffernick  Betsy Martinez  Michael J. Sadowsky  Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.

Atrazine-catabolizing bacteria used in this study.

Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).

TABLE 1

Recently isolated atrazine-catabolizing bacteria
GenusStrainLocation where isolatedYr reported (reference)
PseudomonasaADPAgricultural-chemical dealership site, Little Falls, Minn.1995 (35)
RalstoniaaM91-3Agricultural soil, Ohio1995 (46, 55)
Mixed cultureBasel, Switzerland1995 (57)
ClavibacterAgricultural soil, Riverside, Calif.1996 (13)
AgrobacteriumJ14aAgricultural soil, Nebraska1996 (39)
NDb38/38Atrazine-contaminated soil, Indiana1996 (3)
AlcaligenesaSG1Industrial settling pond, San Gabriel, La.1997 (7)
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined. 

Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.

Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).

DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.

DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.

TABLE 2

Sequence identities of atzABC homologs from different atrazine-degrading bacteria
Strain% DNA sequence identitya
atzAatzBatzC
Pseudomonas ADP100100100
Alcaligenes SG199.2100100
Ralstonia M91-399.0100100
Agrobacterium J14a99.1100100
Isolate 38/3899.310099.8
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).

TABLE 3

Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compounds
GeneEnzymeAverage % protein sequence identitya (no. of pairwise comparisons)References
dhlA, dhaAHaloalkane dehalogenase25.0 (1)23, 31
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII2-Haloacid dehalogenase36.6 ± 3.9 (36)5, 25, 28, 29, 42, 43, 50, 59
tfdA2,4-Dichlorophenoxyacetate monooxygenase43.2 ± 4.6 (21)b34, 37, 38, 56, 58
dcmADichloromethane dehalogenase56.0 (1)4, 32
atzAAtrazine chlorohydrolase98.6 ± 0.12 (15)cThis study
atzBHydroxyatrazine ethylaminohydrolase100 (10)cThis study
atzCN-Isopropylammelide isopropylaminohydrolase99.0 ± 0.43 (10)cThis study
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation.  相似文献   

15.
Pharmacovirological Impact of an Integrase Inhibitor on Human Immunodeficiency Virus Type 1 cDNA Species In Vivo     
Christine Goffinet  Ina Allespach  Lena Oberbremer  Pamela L. Golden  Scott A. Foster  Brian A. Johns  Jason G. Weatherhead  Steven J. Novick  Karen E. Chiswell  Edward P. Garvey  Oliver T. Keppler 《Journal of virology》2009,83(15):7706-7717
  相似文献   

16.
Human Parainfluenza Virus Type 2 V Protein Inhibits Genome Replication by Binding to the L Protein: Possible Role in Promoting Viral Fitness          下载免费PDF全文
Machiko Nishio  Junpei Ohtsuka  Masato Tsurudome  Tetsuya Nosaka  Daniel Kolakofsky 《Journal of virology》2008,82(13):6130-6138
  相似文献   

17.
The Wall Teichoic Acid Polymerase TagF Is Non-processive in Vitro and Amenable to Study Using Steady State Kinetic Analysis     
Edward W. C. Sewell  Mark P. Pereira    Eric D. Brown 《The Journal of biological chemistry》2009,284(32):21132-21138
Wall teichoic acids are a chemically diverse group of anionic polymers that constitute up to 50% of the Gram-positive cell wall. These polymers play a pivotal role in virulence and have been implicated in a diverse range of physiological functions. The TagF-like family of enzymes has been shown to be responsible for wall teichoic acid priming and polymerization events. Although many such enzymes are well validated therapeutic targets, a mechanistic understanding of this enzyme family has remained elusive. TagF is the prototypical teichoic acid polymerase and uses CDP-glycerol to catalyze synthesis of the linear (1,3)-linked poly(glycerol phosphate) teichoic acid in Bacillus subtilis 168. Here we used a synthetic soluble analog of the natural substrate of the enzyme, Lipid ϕ, to conduct the first detailed mechanistic investigation of teichoic acid polymerization. Through the use of a new high pressure liquid chromatography-based assay to monitor single glycerol phosphate incorporations into the Lipid ϕ analog, we conducted a detailed analysis of reaction product formation patterns and unequivocally showed TagF to be non-processive in vitro. Furthermore by monitoring the kinetics of polymerization, we showed that Lipid ϕ analog species varying in size have the same Km value of 2.6 μm and validated use of Bi Bi velocity expressions to model the TagF enzyme system. Initial rate analysis showed that TagF catalyzes a sequential Bi Bi mechanism where both substrates are added to the enzyme prior to product release consistent with a single displacement chemical mechanism.Wall teichoic acids are a group of phosphate-containing anionic carbohydrate polymers that constitute up to 50% of the dry weight of the Gram-positive cell wall (1). Teichoic acids play a pivotal role in virulence and have been implicated in a diverse range of physiological functions including cation homeostasis, nutrient trafficking, binding of envelope proteins, and regulation of autolysins (24). Our knowledge of wall teichoic acid synthesis largely stems from studies conducted in the model bacterium Bacillus subtilis 168, which expresses a linear (1,3)-linked poly(glycerol phosphate) teichoic acid (57). Through these studies, our group and others have identified the genetic requirements for poly(glycerol phosphate) synthesis; however, until recently, a biochemical understanding of priming and polymerization events have been confounded by the interfacial localization of these enzymatic steps (8, 9). Indeed interfacial localization has hindered the understanding of the synthesis of many other important cell wall components such as O-antigen, polysialic acid, lipoarabinomannan, oligomers for N-linked glycosylation, and others (1013). A breakthrough in our ability to study the enzymes involved in the lipid-linked steps of wall teichoic acid synthesis was made by Ginsberg et al. (14) with the development of synthetic substrate analogs of lipid-linked wall teichoic acid intermediates. These substrate analogs have since facilitated the detailed mechanistic study of uncharacterized teichoic acid enzymes and were used to reconstitute all intracellular steps in Staphylococcus aureus wall teichoic acid synthesis in vitro (15, 16).Genetic and biochemical studies have given rise to a model for the synthesis of poly(glycerol phosphate) wall teichoic acid in B. subtilis 168 in which polymer synthesis is carried out on the intracellular surface of the cytoplasmic membrane by stepwise additions of sugars to an undecaprenol phosphate lipid carrier via the tag (teichoic acid glycerol) gene products (7, 17). Polymer synthesis is initiated by TagO, which catalyzes the transfer of N-acetylglucosamine-1-phosphate from UDP-GlcNAc to undecaprenol phosphate to create Lipid α (18) (the new nomenclature for lipid-linked teichoic acid intermediates proposed by Pereira and Brown (17) is summarized in 2 is transferred to Lipid α from UDP-ManNAc by TagA, producing Lipid β that is “primed” with sn-glycerol-3-phosphate by TagB to create the polymerization substrate Lipid ϕ.1 (9, 14, 16). Some 30–50 glycerol phosphate residues are subsequently added to Lipid ϕ.1 by TagF, and the intracellular steps of teichoic acid synthesis are completed via polymer glucosylation by TagE (6, 8). Intracellular teichoic acid is then exported to the outer leaflet of the cytoplasmic membrane by the TagG/H ATP-binding cassette transport system and transferred to peptidoglycan by a currently unknown enzyme (19).

TABLE 1

Recently proposed nomenclature for wall teichoic acid intermediatesShown is the nomenclature proposed for wall teichoic acid biosynthetic intermediates (17). Intermediates were named according to the enzyme utilizing the molecule as a substrate. Lipid α is the substrate for TagA, Lipid β is the substrate for TagB. Lipid ϕ.n species are substrates for TagF where n indicates the number of glycerol phosphate residues in the molecule. For example, Lipid ϕ.1 is the product of the TagB-catalyzed priming reaction where a single glycerol phosphate residue is added. und, undecaprenol; P, phosphate; GroP, sn-glycerol-3-phosphate.
EnzymeSubstrateChemical composition
TagALipid αGlcNAc-1-P-P-und
TagBLipid βManNAc-β(1–4)-GlcNAc-1-P-P-und
TagFLipid ϕ.n(GroP)n-ManNAc-β(1–4)-GlcNAc-1-P-P-und
TagFLipid ϕ.n analog(GroP)n-ManNAc-β(1–4)-GlcNAc-1-P-P-tridecane
Open in a separate windowBased on sequence identity and crude mechanistic studies of B. subtilis 168 TagB and TagF enzymes, teichoic acid primases, oligomerases, and polymerases have been grouped into the TagF-like enzyme family that share a conserved ≈300-residue C-terminal catalytic domain and a basic N-terminal domain of variable size (9, 20). In efforts to expand our mechanistic understanding of this unique enzyme family, soluble substrate analogs have been used to study wall teichoic acid priming and polymerization events in B. subtilis 168 and S. aureus (14, 15, 21). Through these studies, the Lipid ϕ analog has been validated as a suitable substrate for kinetic investigation of B. subtilis 168 TagF (21). To firmly establish the processivity of the prototypical TagF enzyme, herein we developed a robust HPLC-based assay that allowed us to monitor single glycerol phosphate incorporations into a radiolabeled Lipid ϕ analog. We analyzed patterns of product accumulation to determine enzyme processivity and showed unequivocally that soluble TagF utilizes a non-processive polymerization mechanism. Further we took advantage of this finding to validate application of Bi Bi initial rate expressions to the TagF system. We conducted the first detailed steady state kinetic mechanistic study of wall teichoic acid polymerization and showed that poly(glycerol phosphate) synthesis is mediated via a sequential Bi Bi mechanism. We posit a single displacement active site mechanism where Lipid ϕ directly attacks the pyrophosphate linkage of CDP-glycerol.  相似文献   

18.
Environmental Occurrence of the Whipple’s Disease Bacterium (Tropheryma whippelii)     
Matthias Maiwald  Frank Schuhmacher  Hans-Jürgen Ditton  Axel von Herbay 《Applied and environmental microbiology》1998,64(2):760-762
Whipple’s disease is a systemic disorder in which a gram-positive rod-shaped bacterium is constantly present in infected tissues. After numerous unsuccessful attempts to culture this bacterium, it was eventually characterized by 16S rRNA gene analysis to be a member of the actinomycetes. The name Tropheryma whippelii was proposed. Until now, the bacterium has only been found in infected human tissues, but there is no evidence for human-to-human transmission. Here we report the detection of DNA specific for the Whipple’s disease bacterium in 25 of 38 wastewater samples from five different sewage treatment plants in the area of Heidelberg, Germany. These findings provide the first evidence that T. whippelii occurs in the environment, within a polymicrobial community. This is in accordance with the phylogenetic relationship of this bacterium as well as with known epidemiological aspects of Whipple’s disease. Our data argue for an environmental source for infection with the Whipple’s disease bacterium.Whipple’s disease, which was first described in 1907 as intestinal lipodystrophy (18), is a multisystem disorder characterized by the presence of gram-positive, rod-shaped bacteria in infected human tissues (2). Numerous attempts to culture the bacterium associated with Whipple’s disease have failed (2), and eventually its phylogenetic position within the actinomycetes was established by 16S rRNA gene analysis (11, 19). The name Tropheryma whippelii was proposed (11).The clinical presentation of Whipple’s disease is heterogeneous. Frequently, patients suffer for years from arthralgias, chronic diarrhea, and weight loss, and less often from dementia or cardiac insufficiency. If untreated, the disease is usually fatal, but with appropriate antibiotic therapy the prognosis is favorable (2). However, the pathogenesis of Whipple’s disease appears to involve more than just an infection with T. whippelii. Immunological abnormalities are presumed to play a necessary role as predisposing factors (2, 7, 8), a view which is strengthened by the detection of T. whippelii in association with AIDS (5).Two outstanding questions in the epidemiology of Whipple’s disease are the bacterium’s natural habitat and the route of infection. Until now, T. whippelii has never been found outside of infected human hosts, and although an oral route of infection has often been suspected (10), it has not been proven. There is no evidence for human-to-human transmission.A reassessment of its phylogeny revealed a close relationship of the Whipple’s disease bacterium to typical environmental bacteria, such as the cellulomonads and the rare group B peptidoglycan organisms (6). This would support the hypothesis that T. whippelii may be a soil or water inhabitant. This may also explain the difficulties involved with its culture, as an estimated 80 to 99% of bacteria occurring in such natural environments are not culturable on artificial media (14, 17) and uncultured members of the actinomycete line of descent have been found in different environments and geographical locations (12). Soil and water bacteria tend to concentrate in sewage to form communities in which a large variety of different species are found. Therefore, the search for the Whipple’s disease bacterium was concentrated at sewage treatment plants.From September 1995 to July 1996, a total of 38 effluent samples from the sedimentation ponds of five different sewage treatment plants were examined by PCR for the presence of the Whipple’s disease bacterium. The sewage treatment plants are located within a distance of 5 to 25 km from Heidelberg, Germany (Fig. (Fig.1).1). Effluent was sampled in 1,000-ml single-use plastic flasks and filtered as described previously (4) in portions of 25 ml through cellulose acetate prefilters (25-mm diameter, 5-μm pore size; Sartorius, Göttingen, Germany). It was then passed through polyvinylidene fluoride filters (25-mm diameter, 0.45-μm pore size; Millipore, Bedford, Mass.). The DNA from the 0.45-μm-pore-size filters was extracted with the EnviroAmp Legionella sample preparation kit (Perkin-Elmer, Norwalk, Conn.), with the addition of 0.2% bovine serum albumin to the water in the final extraction step. Distilled water for negative controls was sampled in the same flasks and treated in the same way as the sewage. Open in a separate windowFIG. 1Map of the area around Heidelberg, Germany, displaying the rivers Rhine (Rhein) and Neckar, the relevant townships (shaded areas with names in capital letters), and the five sewage treatment plants (dots) from which samples were taken. The inset in the figure shows the localization of the area within Germany.PCR amplification and detection were performed as described in detail elsewhere (15). Primers whip1 (5′-AGAGATACGCCCCCCGCAA) and whip2 (5′-ATTCGCTCCACCTTGCGA), which amplify a fragment of 267 bp from the 16S rRNA gene of the bacterium, were used. In addition to hybridization with oligonucleotide whip3 (5′-TGGTACAGAGGGTTGCAATA), a second hybridization in a separate reaction was performed with oligonucleotide whip4 (5′-GTAATGGCGGGGACTCACAG). The specificities of primers whip1 and whip2 and of probe whip3 have been tested previously (15), and testing of probe whip4 with the same set of 37 control bacteria gave the same results as those reported for whip3 (15).Of the 38 sewage samples tested, 25 were found to be positive by PCR and hybridization with both oligonucleotides (Table (Table1).1). Positive samples were found at each of the five sewage treatment plants. Most of the positive PCR products displayed relatively weak bands at the expected size of 267 bp. They also contained some extraneous bands, which were not of the expected size, probably due to the large amount of DNA from other organisms present in sewage. On hybridization, however, the PCR products displayed distinct bands, which were consistent between the two oligonucleotides (Fig. (Fig.2).2).

TABLE 1

Results of PCR for the Whipple’s disease bacterium from sewage samples
Sewage treatment plantNo. of samples:
TestedPositive
Heidelberg149
Untere Hardt77
Mannheim137
Kohlhof21
Grenzhof21
 Total3825
Open in a separate windowOpen in a separate windowFIG. 2Detection of DNA from the Whipple’s disease bacterium in sewage samples. Shown are the results of analyses of PCR products by polyacrylamide gel electrophoresis (A) and Southern blot hybridization with oligonucleotide whip4 (B). Lanes: 1 and 10, 100-bp DNA marker; 2, positive control consisting of a tissue digest (diluted 10−4) from the intestinal biopsy of a patient with Whipple’s disease (9); 3, negative control consisting of 10 μl of distilled water in the PCR mixture; 4 and 5, sewage samples from Heidelberg; 6 and 9, negative controls consisting of distilled water which was filtered and treated in the same way as the sewage; 7 and 8, sewage samples from Untere Hardt.To further compare the sequences of the PCR products with the known sequence of the Whipple’s disease bacterium, nine PCR products selected from all five sewage treatment plants were cloned and sequenced. The PCR products were reamplified over 5 cycles by using specific primers with BamHI and EcoRI restriction endonuclease recognition sites (11), ligated into vector pDS1-NOC (3) and transformed by electroporation into Escherichia coli JM101. To screen for positive clones, a series of PCRs (primer whip2 and vector-specific primer 5′-TTGCTTTGTGAGCGGATAACAATTAT) in which pools of 10 E. coli colonies were amplified in each of the reactions was performed. The PCR products were tested by gel electrophoresis, Southern blotting, and hybridization with oligonucleotide whip4. Pools which produced hybridizing bands of the appropriate size were retested to find individual colonies. Plasmids from positive clones were extracted according to standard methods (13), and both strands of the inserts were sequenced manually with the AmpliCycle sequencing kit (Perkin-Elmer), with incorporation of [α-33P]dATP. For each of the nine sewage samples, the sequence of the PCR product was identical to the known sequence determined previously for the Whipple’s disease bacterium (5, 9).This is the first documented encounter with the Whipple’s disease bacterium outside of the human body. The specific sequence was found in all of the sewage treatment plants from which samples were taken, indicating that the bacterium is a regular member of, and most likely is able to multiply in, such polymicrobial communities. This finding is in agreement with one previous report which found sequences highly similar to, but not identical with, those of the Whipple’s disease bacterium in the eutrophic water of a Mediterranean coastal lagoon (1).The environmental occurrence of the Whipple’s disease bacterium at the sewage treatment plants is in agreement with the evolutionary relationships of the bacterium (6, 11). It is also consistent with the lack of geographical preference of reported cases of Whipple’s disease in Germany and with the relatively constant incidence of new cases per year (16). In addition, it is consistent with a predominance of outdoor professions among patients with the disease (2). These features and the absence of the Whipple’s disease bacterium in normal human tissues (11, 15) make it highly unlikely that this bacterium is a common commensal which is transferred between warm-blooded hosts in the same way as a variety of other pathogens. However, the complete range of occurrences in the environment and the exact localization of the habitats of the Whipple’s disease bacterium still remain to be determined.

Nucleotide sequence accession numbers.

The GenBank/EMBL accession numbers of the published 16S rRNA gene sequences of the Whipple’s disease bacterium are M77832 (19), M87484 (11), and X99636 (6).  相似文献   

19.
Ca2+/Calmodulin-dependent Protein Kinase IV Links Group I Metabotropic Glutamate Receptors to Fragile X Mental Retardation Protein in Cingulate Cortex     
Hansen Wang  Hotaka Fukushima  Satoshi Kida    Min Zhuo 《The Journal of biological chemistry》2009,284(28):18953-18962
  相似文献   

20.
Phanerochaete chrysosporium Cellobiohydrolase and Cellobiose Dehydrogenase Transcripts in Wood     
Marcelo A. Vallim  Bernard J. H. Janse  Jill Gaskell  Aline A. Pizzirani-Kleiner  Daniel Cullen 《Applied and environmental microbiology》1998,64(5):1924
  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号