首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 93 毫秒
1.
2.
Lichenysins are surface-active lipopeptides with antibiotic properties produced nonribosomally by several strains of Bacillus licheniformis. Here, we report the cloning and sequencing of an entire 26.6-kb lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Three large open reading frames coding for peptide synthetases, designated licA, licB (three modules each), and licC (one module), could be detected, followed by a gene, licTE, coding for a thioesterase-like protein. The domain structure of the seven identified modules, which resembles that of the surfactin synthetases SrfA-A to -C, showed two epimerization domains attached to the third and sixth modules. The substrate specificity of the first, fifth, and seventh recombinant adenylation domains of LicA to -C (cloned and expressed in Escherichia coli) was determined to be Gln, Asp, and Ile (with minor Val and Leu substitutions), respectively. Therefore, we suppose that the identified biosynthesis operon is responsible for the production of a lichenysin variant with the primary amino acid sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile, with minor Leu and Val substitutions at the seventh position.Many strains of Bacillus are known to produce lipopeptides with remarkable surface-active properties (11). The most prominent of these powerful lipopeptides is surfactin from Bacillus subtilis (1). Surfactin is an acylated cyclic heptapeptide that reduces the surface tension of water from 72 to 27 mN m−1 even in a concentration below 0.05% and shows some antibacterial and antifungal activities (1). Some B. subtilis strains are also known to produce other, structurally related lipoheptapeptides (Table (Table1),1), like iturin (32, 34) and bacillomycin (3, 27, 30), or the lipodecapeptides fengycin (50) and plipastatin (29).

TABLE 1

Lipoheptapeptide antibiotics of Bacillus spp.
LipopeptideOrganismStructureReference
Lichenysin AB. licheniformisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asn-D-Leu-L-Ile51, 52
Lichenysin BFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu23, 26
Lichenysin CFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile17
Lichenysin DFAa-L-Gln-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-IleThis work
Surfactant 86B. licheniformisFAa-L-Glxd-L-Leu-D-Leu-L-Val-L-Asxd-D-Leu-L-Ilee14, 15
L-Val
SurfactinB. subtilisFAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu1, 7, 49
EsperinB. subtilisFAb-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leue45
L-Val 
Iturin AB. subtilisFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Ser32
Iturin CFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asne-L-Asne34
D-Ser-L-Thr 
Bacillomycin LB. subtilisFAc-L-Asp-D-Tyr-D-Asn-L-Ser-L-Gln-D-Proe-L-Thr3
D-Ser- 
Bacillomycin DFAc-L-Asp-D-Tyr-D-Asn-L-Pro-L-Glu-D-Ser-L-Thr30, 31
Bacillomycin FFAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Thr27
Open in a separate windowaFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of the C-terminal amino acid. bFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of Asp5. cFA, β-amino fatty acid. The β-amino group forms a peptide bond with the carboxy group of the C-terminal amino acid. dOnly the following combinations of amino acid 1 and 5 are allowed: Gln-Asp or Glu-Asn. eWhere an alternative amino acid may be present in a structure, the alternative is also presented. In addition to B. subtilis, several strains of Bacillus licheniformis have been described as producing the lipopeptide lichenysin (14, 17, 23, 26, 51). Lichenysins can be grouped under the general sequence l-Glx–l-Leu–d-Leu–l-Val–l-Asx–d-Leu–l-Ile/Leu/Val (Table (Table1).1). The first amino acid is connected to a β-hydroxyl fatty acid, and the carboxy-terminal amino acid forms a lactone ring to the β-OH group of the lipophilic part of the molecule. In contrast to the lipopeptide surfactin, lichenysins seem to be synthesized during growth under aerobic and anaerobic conditions (16, 51). The isolation of lichenysins from cells growing on liquid mineral salt medium on glucose or sucrose basic has been studied intensively. Antimicrobial properties and the ability to reduce the surface tension of water have also been described (14, 17, 26, 51). The structural elucidation of the compounds revealed slight differences, depending on the producer strain. Various distributions of branched and linear fatty acid moieties of diverse lengths and amino acid variations in three defined positions have been identified (Table (Table11).In contrast to the well-defined methods for isolation and structural characterization of lichenysins, little is known about the biosynthetic mechanisms of lichenysin production. The structural similarity of lichenysins and surfactin suggests that the peptide moiety is produced nonribosomally by multifunctional peptide synthetases (7, 13, 25, 49, 53). Peptide synthetases from bacterial and fungal sources describe an alternative route in peptide bond formation in addition to the ubiquitous ribosomal pathway. Here, large multienzyme complexes affect the ordered recognition, activation, and linking of amino acids by utilizing the thiotemplate mechanism (19, 24, 25). According to this model, peptide synthetases activate their substrate amino acids as aminoacyl adenylates by ATP hydrolysis. These unstable intermediates are subsequently transferred to a covalently enzyme-bound 4′-phosphopantetheinyl cofactor as thioesters. The thioesterified amino acids are then integrated into the peptide product through a stepwise elongation by a series of transpeptidations directed from the amino terminals to the carboxy terminals. Peptide synthetases have not only awakened interest because of their mechanistic features; many of the nonribosomally processed peptide products also possess important biological and medical properties.In this report we describe the identification and characterization of a putative lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Cloning and sequencing of the entire lic operon (26.6 kb) revealed three genes, licA, licB, and licC, with structural patterns common to peptide synthetases and a gene designated licTE, which codes for a putative thioesterase. The modular organization of the sequenced genes resembles the requirements for the biosynthesis of the heptapeptide lichenysin. Based on the arrangement of the seven identified modules and the tested substrate specificities, we propose that the identified genes are involved in the nonribosomal synthesis of the portion of the lichenysin peptide with the primary sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile (with minor Val and Leu substitutions).  相似文献   

3.
Peptidoglycan from Deinococcus radiodurans was analyzed by high-performance liquid chromatography and mass spectrometry. The monomeric subunit was: N-acetylglucosamine–N-acetylmuramic acid–l-Ala–d-Glu-(γ)–l-Orn-[(δ)Gly-Gly]–d-Ala–d-Ala. Cross-linkage was mediated by (Gly)2 bridges, and glycan strands were terminated in (1→6)anhydro-muramic acid residues. Structural relations with the phylogenetically close Thermus thermophilus are discussed.The gram-positive bacterium Deinococcus radiodurans is remarkable because of its extreme resistance to ionizing radiation (14). Phylogenetically the closest relatives of Deinococcus are the extreme thermophiles of the genus Thermus (4, 11). In 16S rRNA phylogenetic trees, the genera Thermus and Deinococcus group together as one of the older branches in bacterial evolution (11). Both microorganisms have complex cell envelopes with outer membranes, S-layers, and ornithine-Gly-containing mureins (7, 12, 19, 20, 22, 23). However, Deinococcus and Thermus differ in their response to the Gram reaction, having positive and negative reactions, respectively (4, 14). The murein structure for Thermus thermophilus HB8 has been recently elucidated (19). Here we report the murein structure of Deinococcus radiodurans with similar detail.D. radiodurans Sark (23) was used in the present study. Cultures were grown in Luria-Bertani medium (13) at 30°C with aeration. Murein was purified and subjected to amino acid and high-performance liquid chromatography (HPLC) analyses as previously described (6, 9, 10, 19). For further analysis muropeptides were purified, lyophilized, and desalted as reported elsewhere (6, 19). Purified muropeptides were subjected to plasma desorption linear time-of-flight mass spectrometry (PDMS) as described previously (1, 5, 16, 19). Positive and negative ion mass spectra were obtained on a short linear 252californium time-of-flight instrument (BioIon AB, Uppsala, Sweden). The acceleration voltage was between 17 and 19 kV, and spectra were accumulated for 1 to 10 million fission events. Calibration of the mass spectra was done in the positive ion mode with H+ and Na+ ions and in the negative ion mode with H and CN ions. Calculated m/z values are based on average masses.Amino acid analysis of muramidase (Cellosyl; Hoechst, Frankfurt am Main, Germany)-digested sacculi (50 μg) revealed Glu, Orn, Ala, and Gly as the only amino acids in the muramidase-solubilized material. Less than 3% of the total Orn remained in the muramidase-insoluble fraction, indicating an essentially complete solubilization of murein.Muramidase-digested murein samples (200 μg) were analyzed by HPLC as described in reference 19. The muropeptide pattern (Fig. (Fig.1)1) was relatively simple, with five dominating components (DR5 and DR10 to DR13 [Fig. 1]). The muropeptides resolved by HPLC were collected, desalted, and subjected to PDMS. The results are presented in Table Table11 compared with the m/z values calculated for best-matching muropeptides made up of N-acetylglucosamine (GlucNAc), N-acetylmuramic acid (MurNAc), and the amino acids detected in the murein. The more likely structures are shown in Fig. Fig.1.1. According to the m/z values, muropeptides DR1 to DR7 and DR9 were monomers; DR8, DR10, and DR11 were dimers; and DR12 and DR13 were trimers. The best-fitting structures for DR3 to DR8, DR11, and DR13 coincided with muropeptides previously characterized in T. thermophilus HB8 (19) and had identical retention times in comparative HPLC runs. The minor muropeptide DR7 (Fig. (Fig.1)1) was the only one detected with a d-Ala–d-Ala dipeptide and most likely represents the basic monomeric subunit. The composition of the major cross-linked species DR11 and DR13 confirmed that cross-linking is mediated by (Gly)2 bridges, as proposed previously (20). Open in a separate windowFIG. 1HPLC muropeptide elution patterns of murein purified from D. radiodurans. Muramidase-digested murein samples were subjected to HPLC analysis, and the A204 of the eluate was recorded. The most likely structures for each muroeptide as deduced by PDMS are shown. The position of residues in brackets is the most likely one as deduced from the structures of other muropeptides but could not be formally demonstrated. R = GlucNac–MurNac–l-Ala–d-Glu-(γ)→.

TABLE 1

Calculated and measured m/z values for the molecular ions of the major muropeptides from D. radiodurans
MuropeptideaIonm/z
ΔmbError (%)cMuropeptide composition
Muropeptide abundance (mol%)
CalculatedMeasuredNAGdNAMeGluOrnAlaGly
DR1[M+H]+699.69700.10.410.0611101012.0
DR2[M+H]+927.94928.30.360.041111125.7
DR3[M+Na]+1,006.971,007.50.530.051111133.0
DR4[M+Na]+963.95964.60.650.071111212.5
DR5[M+H]+999.02999.80.780.0811112227.7
[M−H]997.00997.30.300.03
DR6[M+Na]+1,078.51,078.80.750.071111232.4
DR7[M+H]+1,070.091,071.00.900.081111322.2
DR8[M+Na]+1,520.531,521.61.080.071122442.2
DR9[M+Na]+701.64702.10.460.0311f10105.0
DR10[M+H]+1,907.941,907.80.140.0122223410.1
[M−H]1,905.921,906.60.680.04
DR11[M+H]+1,979.011,979.10.090.0122224419.1
[M−H]1,977.001,977.30.300.02
DR12[M+H]+2,887.932,886.5−1.43−0.053333564.4
[M−H]2,885.912,885.8−0.11−0.01
DR13[M+H]+2,959.002,957.8−1.20−0.043333663.6
[M−H]2,956.992,955.9−1.09−0.04
Open in a separate windowaDR5 and DR10 to DR13 were analyzed in both the positive and negative ion modes. Muropeptides DR1 to DR4 and DR6 to DR9 were analyzed in the positive mode only due to the small amounts of sample available. bMass difference between measured and calculated quasimolecular ion values. c[(Measured mass−calculated mass)/calculated mass] × 100. dN-Acetylglucosamine. eN-Acetylmuramitol. f(1→6)Anhydro-N-acetylmuramic acid. Structural assignments of muropeptides DR1, DR2, DR8 to DR10, and DR12 deserve special comments. The low m/z value measured for DR1 (700.1) fitted very well with the value calculated for GlucNAc–MurNAc–l-Ala–d-Glu (699.69). Even smaller was the mass deduced for DR9 from the m/z value of the molecular ion of the sodium adduct (702.1) (Fig. (Fig.2).2). The mass difference between DR1 and DR9 (19.9 mass units) was very close indeed to the calculated difference between N-acetylmuramitol and the (1→6)anhydro form of MurNAc (20.04 mass units). Therefore, DR9 was identified as GlucNAc–(1→6)anhydro-MurNAc–l-Ala–d-Glu (Fig. (Fig.1).1). Muropeptides with (1→6)anhydro muramic acid have been identified in mureins from diverse origins (10, 15, 17, 19), indicating that it might be a common feature among peptidoglycan-containing microorganisms. Open in a separate windowFIG. 2Positive-ion linear PDMS of muropeptide DR9. Muropeptide DR9 was purified, desalted by HPLC, and subjected to PDMS to determine the molecular mass. The masses for the dominant molecular ions are indicated.The measured m/z value for the [M+Na]+ ion of DR8 was 1,521.6, very close to the mass calculated for a cross-linked dimer without one disaccharide moiety (1,520.53) (Fig. (Fig.1;1; Table Table1).1). Such muropeptides, also identified in T. thermophilus HB8 and other bacteria (18, 19), are most likely generated by the enzymatic clevage of MurNAc–l-Ala amide bonds in murein by an N-acetylmuramyl–l-alanine amidase (21). In particular, DR8 could derive from DR11. The difference between measured m/z values for DR8 and DR11 was 478.7, which fits with the mass contribution of a disaccharide moiety (480.5) within the mass accuracy of the instrument.The m/z values for muropeptides DR2, DR10, and DR12 supported the argument for structures in which the two d-Ala residues from the d-Ala–d-Ala C-terminal dipeptide were lost, leaving Orn as the C-terminal amino acid.The position of one Gly residue in muropeptides DR2, DR8, and DR10 to DR13 could not be formally demonstrated. One of the Gly residues could be at either the N- or the C-terminal positions. However, the N-terminal position seems more likely. The structure of the basic muropeptide (DR7), with a (Gly)2 acylating the δ-NH2 group of Orn, suggests that major muropeptides should present a (Gly)2 dipeptide. The scarcity of DR3 and DR6, which unambiguously have Gly as the C-terminal amino acid (Fig. (Fig.1),1), supports our assumption.Molar proportions for each muropeptide were calculated as proposed by Glauner et al. (10) and are shown in Table Table1.1. For calculations the structures of DR10 to DR13 were assumed to be those shown in Fig. Fig.1.1. The degree of cross-linkage calculated was 47.2%. Trimeric muropeptides were rather abundant (8 mol%) and made a substantial contribution to total cross-linkage. However, higher-order oligomers were not detected, in contrast with other gram-positive bacteria, such as Staphylococcus aureus, which is rich in such oligomers (8). The proportion of muropeptides with (1→6)anhydro-muramic acid (5 mol%) corresponded to a mean glycan strand length of 20 disaccharide units, which is in the range of values published for other bacteria (10, 17).The results of our study indicate that mureins from D. radiodurans and T. thermophilus HB8 (19) are certainly related in their basic structures but have distinct muropeptide compositions. In accordance with the phylogenetic proximity of Thermus and Deinococcus (11), both mureins are built up from the same basic monomeric subunit (DR7 in Fig. Fig.1),1), are cross-linked by (Gly)2 bridges, and have (1→6)anhydro-muramic acid at the termini of glycan strands. Most interestingly, Deinococcus and Thermus are the only microorganisms identified at present with the murein chemotype A3β as defined by Schleifer and Kandler (20). Nevertheless, the differences in muropeptide composition were substantial. Murein from D. radiodurans was poor in d-Ala–d-Ala- and d-Ala–Gly-terminated muropeptides (2.2 and 2.4 mol%, respectively) but abundant in Orn-terminated muropeptides (23.8 mol%) and in muropeptides with a peptide chain reduced to the dipeptide l-Ala–d-Glu (18 mol%). In contrast, neither Orn- nor Glu-terminated muropeptides have been detected in T. thermophilus HB8 murein, which is highly enriched in muropeptides with d-Ala–d-Ala and d-Ala–Gly (19). Furthermore, no traces of phenyl acetate-containing muropeptides, a landmark for T. thermophilus HB8 murein (19), were found in D. radiodurans. Cross-linkage was definitely higher in D. radiodurans than in T. thermophilus HB8 (47.4 and 27%, respectively), largely due to the higher proportion of trimers in the former.The similarity in murein basic structure suggests that the difference between D. radiodurans and T. thermophilus HB8 with respect to the Gram reaction may simply be a consequence of the difference in the thickness of cell walls (2, 3, 23). Interestingly, D. radiodurans murein turned out to be relatively simple for a gram-positive organism, possibly reflecting the primitive nature of this genus as deduced from phylogenetic trees (11). Our results illustrate the phylogenetic proximity between Deinococcus and Thermus at the cell wall level but also point out the structural divergences originated by the evolutionary history of each genus.  相似文献   

4.
5.
Forty-five different point mutations in POLG, the gene encoding the catalytic subunit of the human mitochondrial DNA polymerase (pol γ), cause the early onset mitochondrial DNA depletion disorder, Alpers syndrome. Sequence analysis of the C-terminal polymerase region of pol γ revealed a cluster of four Alpers mutations at highly conserved residues in the thumb subdomain (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) and two Alpers mutations at less conserved positions in the adjacent palm subdomain (Q879H, c.2637g→t and T885S, c.2653a→t). Biochemical characterization of purified, recombinant forms of pol γ revealed that Alpers mutations in the thumb subdomain reduced polymerase activity more than 99% relative to the wild-type enzyme, whereas the palm subdomain mutations retained 50–70% wild-type polymerase activity. All six mutant enzymes retained physical and functional interaction with the pol γ accessory subunit (p55), and none of the six mutants exhibited defects in misinsertion fidelity in vitro. However, differential DNA binding by these mutants suggests a possible orientation of the DNA with respect to the polymerase during catalysis. To our knowledge this study represents the first structure-function analysis of the thumb subdomain in pol γ and examines the consequences of mitochondrial disease mutations in this region.As the only DNA polymerase found in animal cell mitochondria, DNA polymerase γ (pol γ)3 bears sole responsibility for DNA synthesis in all replication and repair transactions involving mitochondrial DNA (1, 2). Mammalian cell pol γ is a heterotrimeric complex composed of one catalytic subunit of 140 kDa (p140) and two 55-kDa accessory subunits (p55) that form a dimer (3). The catalytic subunit contains an N-terminal exonuclease domain connected by a linker region to a C-terminal polymerase domain. Whereas the exonuclease domain contains essential motifs I, II, and III for its activity, the polymerase domain comprising the thumb, palm, and finger subdomains contains motifs A, B, and C that are crucial for polymerase activity. The catalytic subunit is a family A DNA polymerase that includes bacterial pol I and T7 DNA polymerase and possesses DNA polymerase, 3′ → 5′ exonuclease, and 5′-deoxyribose phosphate lyase activities (for review, see Refs. 1 and 2). The 55-kDa accessory subunit (p55) confers processive DNA synthesis and tight binding of the pol γ complex to DNA (4, 5).Depletion of mtDNA as well as the accumulation of deletions and point mutations in mtDNA have been observed in several mitochondrial disorders (for review, see Ref. 6). mtDNA depletion syndromes are caused by defects in nuclear genes responsible for replication and maintenance of the mitochondrial genome (7). Mutation of POLG, the gene encoding the catalytic subunit of pol γ, is frequently involved in disorders linked to mutagenesis of mtDNA (8, 9). Presently, more than 150 point mutations in POLG are linked with a wide variety of mitochondrial diseases, including the autosomal dominant (ad) and recessive forms of progressive external ophthalmoplegia (PEO), Alpers syndrome, parkinsonism, ataxia-neuropathy syndromes, and male infertility (tools.niehs.nih.gov/polg) (9).Alpers syndrome, a hepatocerebral mtDNA depletion disorder, and myocerebrohepatopathy are rare heritable autosomal recessive diseases primarily affecting young children (1012). These diseases generally manifest during the first few weeks to years of life, and symptoms gradually develop in a stepwise manner eventually leading to death. Alpers syndrome is characterized by refractory seizures, psychomotor regression, and hepatic failure (11, 12). Mutation of POLG was first linked to Alpers syndrome in 2004 (13), and to date 45 different point mutations in POLG (18 localized to the polymerase domain) are associated with Alpers syndrome (9, 14, 15). However, only two Alpers mutations (A467T and W748S, both in the linker region) have been biochemically characterized (16, 17).During the initial cloning and sequencing of the human, Drosophila, and chicken pol γ genes, we noted a highly conserved region N-terminal to motif A in the polymerase domain that was specific to pol γ (18). This region corresponds to part of the thumb subdomain that tracks DNA into the active site of both Escherichia coli pol I and T7 DNA polymerase (1921). A high concentration of disease mutations, many associated with Alpers syndrome, is found in the thumb subdomain.Here we investigated six mitochondrial disease mutations clustered in the N-terminal portion of the polymerase domain of the enzyme (Fig. 1A). Four mutations (G848S, c.2542g→a; T851A, c.2551a→g; R852C, c.2554c→t; R853Q, c.2558g→a) reside in the thumb subdomain and two (Q879H, c.2637g→t and T885S, c.2653a→t) are located in the palm subdomain. These mutations are associated with Alpers, PEO, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), ataxia-neuropathy syndrome, Leigh syndrome, and myocerebrohepatopathy (
POLG mutationDiseaseGeneticsReference
G848SAlpers syndromeIn trans with A467T, Q497H, T251I-P587L, or W748S-E1143G in Alpers syndrome15, 35, 4350
Leigh syndromeIn trans with R232H in Leigh syndrome49
MELASIn trans with R627Q in MELAS38
PEO with ataxia-neuropathyIn trans with G746S and E1143G in PEO with ataxia50
PEOIn trans with T251I and P587L in PEO51, 52
T851AAlpers syndromeIn trans with R1047W48, 53
In trans with H277C
R852CAlpers syndromeIn trans with A467T14, 48, 50
In cis with G11D and in trans with W748S-E1143G or A467T
Ataxia-neuropathyIn trans with G11D-R627Q15
R853QMyocerebrohepatopathyIn trans with T251I-P587L15
Q879HAlpers syndrome with valproate-induced hepatic failureIn cis with E1143G and in trans with A467T-T885S35, 54
T885SAlpers syndrome with valproate-induced hepatic failureIn cis with A467T and in trans with Q879H-E1143G35, 54
Open in a separate windowOpen in a separate windowFIGURE 1.POLG mutations characterized in this study. A, the location of the six mutations characterized is shown in red in the primary sequence of pol γ. Four mutations, the G848S, T851A, R852C, and R853Q, are located in the thumb domain, whereas two mutations, the Q879H and T885S, are in the palm domain of the polymerase region. B, sequence alignment of pol γ from yeast to humans. The amino acids characterized in this study are shown in red. Yellow-highlighted amino acids are highly conserved, and blue-highlighted amino acids are moderately conserved.  相似文献   

6.
The Pre-mRNA Splicing Machinery of Trypanosomes: Complex or Simplified?     
Arthur Günzl 《Eukaryotic cell》2010,9(8):1159-1170
  相似文献   

7.
Current Status of Hemostatic Agents and Sealants in Urologic Surgical Practice     
Sashi S Kommu  Robert McArthur  Amr M Emara  Utsav D Reddy  Christopher J Anderson  Neil J Barber  Raj A Persad  Christopher G Eden 《Reviews in urology》2015,17(3):150-159
  相似文献   

8.
Protein Identification Using Top-Down Spectra     
Xiaowen Liu  Yakov Sirotkin  Yufeng Shen  Gordon Anderson  Yihsuan S. Tsai  Ying S. Ting  David R. Goodlett  Richard D. Smith  Vineet Bafna  Pavel A. Pevzner 《Molecular & cellular proteomics : MCP》2012,11(6)
In the last two years, because of advances in protein separation and mass spectrometry, top-down mass spectrometry moved from analyzing single proteins to analyzing complex samples and identifying hundreds and even thousands of proteins. However, computational tools for database search of top-down spectra against protein databases are still in their infancy. We describe MS-Align+, a fast algorithm for top-down protein identification based on spectral alignment that enables searches for unexpected post-translational modifications. We also propose a method for evaluating statistical significance of top-down protein identifications and further benchmark various software tools on two top-down data sets from Saccharomyces cerevisiae and Salmonella typhimurium. We demonstrate that MS-Align+ significantly increases the number of identified spectra as compared with MASCOT and OMSSA on both data sets. Although MS-Align+ and ProSightPC have similar performance on the Salmonella typhimurium data set, MS-Align+ outperforms ProSightPC on the (more complex) Saccharomyces cerevisiae data set.In the past two decades, proteomics was dominated by bottom-up mass spectrometry that analyzes digested peptides rather than intact proteins. Bottom-up approaches, although powerful, do have limitations in analyzing protein species, e.g. various proteolytic forms of the same protein or various protein isoforms resulting from alternative splicing. Top-down mass spectrometry focuses on analyzing intact proteins and large peptides (110) and has advantages in localizing multiple post-translational modifications (PTMs)1 in a coordinated fashion (e.g. combinatorial PTM code) and identifying multiple protein species (e.g. proteolytically processed protein species) (11). Until recently, most top-down studies were limited to single purified proteins (1215). Top-down studies of protein mixtures were restricted by difficulties in separating and fragmenting intact proteins and a shortage of robust computational tools.In the last two years, because of advances in protein separation and top-down instrumentation, top-down mass spectrometry moved from analyzing single proteins to analyzing complex samples containing hundreds and even thousands of proteins (1621). Because algorithms for interpreting top-down spectra are still in their infancy, many recent developments include computational innovations in protein identification.Because top-down spectra are complex, the first step in top-down spectral interpretation is usually spectral deconvolution, which converts a complex top-down spectrum to a list of monoisotopic masses (a deconvolved spectrum). Every protein (possibly with modifications) can be scored against a top-down deconvoluted spectrum, resulting in a Protein-Spectrum-Match (PrSM). The top-down protein identification problem is finding a protein in a database with the highest scoring PrSM for a top-down spectrum and further output the PrSM if it is statistically significant. There are several software tools for top-down protein identification (SoftwareIdentification of unexpected modificationsProteogenomics search against 6-frame translationSpeedEstimation of statistical significanceProSightPC+/−a+Fast/Slowb+PIITA+/−−Fast−UStag++Fast−MS-TopDown+−Slow−MS-Align+++Fast+Open in a separate windowa ProSightPC has various search modes that contribute to bridging the gap between blind and restrictive modes of MS/MS database search. It can identify truncated proteins by using biomarker search and identify unexpected modifications by using Δm mode and setting the error tolerance of precursor mass to a large value (e.g., 1999 Da). However, it is not designed for identifying truncated proteins with unexpected PTMs which are not represented in the “shotgun annotated” database.b In its most advances mode, ProSightPC can search the annotated top-down database that contains various protein species. However, ProSightPC searches in this mode become an order of magnitude slower.
  • ProSightPC—ProSightPC is the most commonly used tool for top-down protein identification (22, 23). ProSightPC searches spectra against a “shotgun annotated” protein database, which is generated by considering all expected PTMs. The “shotgun annotated” protein database is much larger than the original protein database. ProSightPC can identify some (but not all) proteins with unexpected PTMs using advanced search options, such as biomarker search and Δm mode, but it is not designed for identifying truncated proteins with unexpected PTMs that are not represented in the “shotgun annotated” database. ProSightPC is a fast tool that reports the statistical significance of PrSMs.
  • PIITA—Unlike ProSightPC, PIITA (19) is a precursor independent method that uses only fragment ions for protein identification. It is capable of identifying protein species with unexpected PTMs on N- or C-termini, but it cannot directly identify protein species with PTMs on both N- and C-termini. PIITA is a fast tool that provides FIT scores and Δ scores rather than statistical significance estimates.
  • USTag—Unique Sequence Tag (USTag) (17) generates long (6 amino acids or longer) peptide sequence tags to identify PrSMs. This approach, although fast, relies on long peptide sequence tags that may be difficult to obtain for some spectra. It also does not provide an estimate of the statistical significance of PrSMs.
  • MS-TopDown—MS-TopDown (24) is based on spectral alignment (25). MS-TopDown allows one to match top-down spectra to proteins with unexpected PTMs, i.e. without knowing which PTMs are present in the sample. However, MS-TopDown is rather slow when searching against large proteomes and does not provide the statistical significance of PrSMs, making it difficult to select good PrSMs.
  • In addition, MASCOT, SEQUEST, and OMSSA (16, 26, 27) have been used for top-down protein identification.
We describe MS-Align+, a fast software tool for top-down protein identification. MS-Align+ shares the spectral alignment approach with MS-TopDown, but greatly improves on speed, statistical analysis (providing E-values of PrSMs), and the number of identified PrSMs (e.g. by finding spectral alignments between spectra and truncated proteins). We benchmarked various tools for top-down protein identification on two data sets from Saccharomyces cerevisiae (SC) and Salmonella typhimurium (ST). We demonstrate that MS-Align+ significantly increase the number of identified spectra as compared with MASCOT and OMSSA on both data sets. Although MS-Align+ and ProSightPC have similar performance on the ST data set, MS-Align+ outperforms ProSightPC on the more complex SC data set.  相似文献   

9.
The Chlamydomonas reinhardtii ODA3 Gene Encodes a Protein of the Outer Dynein Arm Docking Complex     
Anthony Koutoulis  Gregory J. Pazour  Curtis G. Wilkerson  Kazuo Inaba  Hong Sheng  Saeko Takada  George B. Witman 《The Journal of cell biology》1997,137(5):1069-1080
  相似文献   

10.
RNA Polymerase I Transcription Silences Noncoding RNAs at the Ribosomal DNA Locus in Saccharomyces cerevisiae     
Elisa Cesarini  Francesca Romana Mariotti  Francesco Cioci  Giorgio Camilloni 《Eukaryotic cell》2010,9(2):325-335
  相似文献   

11.
Mode of Action of cGMP-dependent Protein Kinase-specific Inhibitors Probed by Photoaffinity Cross-linking Mass Spectrometry     
Martijn W. H. Pinkse  Dirk T. S. Rijkers  Wolfgang R. Dostmann    Albert J. R. Heck 《The Journal of biological chemistry》2009,284(24):16354-16368
The inhibitor peptide DT-2 (YGRKKRRQRRRPPLRKKKKKH) is the most potent and selective inhibitor of the cGMP-dependent protein kinase (PKG) known today. DT-2 is a construct of a PKG tight binding sequence (W45, LRKKKKKH, KI = 0.8 μm) and a membrane translocating sequence (DT-6, YGRKKRRQRRRPP, KI = 1.1 μm), that combined strongly inhibits PKG catalyzed phosphorylation (KI = 12.5 nm) with ∼1000-fold selectivity toward PKG over protein kinase A, the closest relative of PKG. However, the molecular mechanism behind this inhibition is not entirely understood. Using a combination of photoaffinity labeling, stable isotope labeling, and mass spectrometry, we have located the binding sites of PKG-specific substrate and inhibitor peptides. Covalent linkage of a PKG-specific substrate analogue was localized in the catalytic core on residues 356–372, also known as the glycine-rich loop, essential for ATP binding. By analogy, the individual inhibitor peptides W45 and DT-6 were also found to cross-link near the glycine-rich loop, suggesting these are both substrate competitive inhibitors. A bifunctional photoreactive analogue of DT-2 was found to generate dimers of PKG. This cross-linking induced covalent PKG dimerization was not observed for an N-terminal deletion mutant of PKG, which lacks the dimerization domain. In addition, non-covalent mass spectrometry was used to determine binding stoichiometry and binding order of the inhibitor peptides. Dimeric PKG binds two W45 and DT-6 peptides, whereas only one DT-2 molecule was observed to bind to the dimeric PKG. Taken together, these findings imply that (i) the two individual components making up DT-2 are both targeted against the substrate-binding site and (ii) binding of a single DT-2 molecule inactivates both PKG monomers simultaneously, which is an indication that (iii) in cGMP-activated PKG the catalytic centers of both subunits may be in each other''s proximity.Among the superfamily of protein kinases the two cyclic nucleotide-regulated protein kinases, cAMP-dependent protein kinase and cGMP-dependent protein kinase, form a closely related subfamily of serine/threonine protein kinases (14). Both proteins share several structural elements, such as the N-terminal dimerization domain, an autoinhibition site, two in-tandem cyclic nucleotide-binding sites, and a highly conserved catalytic core (Fig. 1, A and B). Despite these similarities, these two enzymes display differences, which account for their unique properties. Whereas PKA2 is nearly ubiquitous, PKG is primarily found in the lung, cerebellum, and smooth muscles (5, 6). From a structural point of view these cyclic nucleotide-dependent protein kinases differ as well. The holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. The catalytic subunits are non-covalently attached to the regulatory subunit dimer. Upon interaction with cAMP, the catalytic subunits dissociate from the holoenzyme and are free to catalyze heterophosphorylation (Fig. 1C). The mammalian type I PKGs are homodimeric cytosolic proteins containing two identical polypeptides of ∼76 kDa. Alternative mRNA splicing produces type Iα and type Iβ PKG, which are identical proteins apart from their first ∼100 N-terminal residues (7). Each PKG subunit is composed of a regulatory and a catalytic domain on a single polypeptide chain. Consequently, when cGMP activates PKG, the catalytic and regulatory components remain physically attached (Fig. 1D). Within the catalytic domain PKA and PKG share a strong primary sequence homology (8). Not surprisingly, these enzymes also exhibit overlapping substrate specificities, a feature that often interferes with efforts to elucidate their distinct biological pathways. Peptide substrates with a primary amino acid sequence motif RRX(S/T)X are in general recognized by both PKA and PKG (9). Besides this strong overlapping substrate specificity, several studies report on subtle differences in determinants that discriminate for PKA and PKG substrate specificity (1016). To specifically discriminate between PKG and PKA activity in biological assays a highly specific PKG peptide inhibitor was developed (17). This peptide, YGRKKRRQRRRPPLRKKKKKH (DT-2), is the most potent and selective PKG inhibitor known today. Recently, the validity of DT-2 as a superior inhibitor of PKG in terms of potency, selectivity, and membrane permeability has been demonstrated (1824). The inhibitor is a construct of a substrate competitive sequence, LRKKKKKH (W45), derived from a library screen that selected for tight PKG binding sequences, with a significant specificity toward PKG over PKA, and a membrane translocating signal peptide, YGRKKRRQRRRPP (DT-6). DT-2 strongly inhibits PKG-catalyzed phosphorylation (Ki = 12.5 nm), however, the molecular nature of DT-2 inhibition is not entirely understood (25). Because high resolution structural data are not available for PKG, one of our goals is to elucidate binding sites for PKG-specific substrates and inhibitors in more detail using a combination of mass spectrometric techniques and photoaffinity labeling. To further delineate the nature of inhibition we have developed photoaffinity analogues of DT-2 and related inhibitory peptides, as well as a high affinity peptide substrate. The method of photoaffinity labeling enables the direct probing of target proteins through a covalent bond, which is photochemically introduced between a ligand and its specific receptor (26). In combination with modern mass spectrometric techniques this is a powerful approach for the characterization of peptide-protein interactions (27). Substrate and inhibitor peptides containing photoactivatable analogues of phenylalanine, 4-benzoyl-l-phenylalanine (Phe(Bz)) or 4′-(3-(trifluoromethyl)-3H-diazirin-3-yl)-l-phenylalanine (Phe(Tmd)) were synthesized and used to locate their substrate/inhibitor-binding sites on PKG. These measurements indicate that the substrate peptide resides near the glycine-rich loop within the catalytic domain and that the inhibitor peptides are directed similarly toward this substrate-binding site, thereby acting as competitive inhibitors. In addition, nanoflow electrospray ionization time of flight mass spectrometry (ESI-TOF-MS) was performed to study the interaction between DT-2 and PKG in more detail. ESI-MS has proven to be a useful tool to analyze the non-covalent interaction of proteins with ligands, oligonucleotides, peptides, or other proteins (2831). Using this technique, important information on conformational changes (3235), measurement of relative dissociation constants (36, 37), and sequential binding order and cooperativity (38, 39) can be obtained. ESI-MS confirms that PKG is primarily a homodimer and is able to bind four cGMP molecules. Binding of DT-2 was strongly enhanced in the presence of cGMP. Surprising is the observation that only one DT-2 molecule binds to dimeric PKG. The information derived from these measurements allows for molecular modeling and structural refinements of the next generation of PKG-selective inhibitors.Open in a separate windowFIGURE 1.Linear arrangement of the functional domains of the regulatory and catalytic subunit of PKA (A) and PKG (B) type I and schematic representation of the current working models of the activation process of PKA (C) and PKG (D) type 1. Binding of cAMP to the PKA induces a conformational change that results in the dissociation of the catalytic subunits. Binding of cGMP to PKG also induces a conformational change, which exposes the catalytic domains, but both catalytic domains remain near each other via the N-terminal dimerization domain. (Images adapted from Scholten et al. (4).)

TABLE 1

Inhibition contants (KI) of PKA- or PKG-specific peptide inhibitors and the PKA/PKG specificity index
PeptideSequencePKGKiPKAKiSpecificity index (PKA/PKG)Ref.
μmμm
PKI(5–24)TTYDFIASGRTGRRNAIHD-NH21500.0030.0002(11)
WW21TQAKRKKALAMA-NH27.5750100(11)
W45LRKKKKKH0.82 ± 0.33559680(17)
DT-6YGRGGRRQRRRPP1.1 ± 0.2226 ± 423.6(17)
DT-2YGRKKRRQRRRPPLRKKKKKH0.0125 ± 0.00316.5 ± 3.81320(17)
Open in a separate window  相似文献   

12.
Old knowledge and new technologies allow rapid development of model organisms     
Charles E. Cook  Janet Chenevert  Tomas A. Larsson  Detlev Arendt  Evelyn Houliston  Péter Lénárt 《Molecular biology of the cell》2016,27(6):882-887
  相似文献   

13.
Neurodegeneration and Alzheimer's disease (AD). What Can Proteomics Tell Us About the Alzheimer's Brain?     
Guillermo Moya-Alvarado  Noga Gershoni-Emek  Eran Perlson  Francisca C. Bronfman 《Molecular & cellular proteomics : MCP》2016,15(2):409-425
  相似文献   

14.
Basal levels of inorganic elements,genetic damages,and hematological values in captive Falco peregrinus     
Julian Stocker  Ana Paula Morel  Micaele Wolfarth  Johnny Ferraz Dias  Liana Appel Boufleur Niekraszewicz  Cristina V. Cademartori  Fernanda R. da Silva 《Genetics and molecular biology》2022,45(2)
It is essential to determine the basal pattern of different biomarkers for future evaluation of animal health and biomonitoring studies. Due to their great displacement capacity and to being at the top of their food chains, birds of prey are suitable for monitoring purposes. Furthermore, some birds of prey are adapted to using resources in urban places, providing information about this environment. Thus, this study determined the basal frequency of micronuclei and other nuclear alterations in peripheral blood erythrocytes of Falco peregrinus. Hematological and inorganic elements analysis were also performed. For this purpose, 13 individuals (7 females and 6 males) were sampled in private breeding grounds. Micronucleus, nuclear buds, nucleoplasmic bridges, notched nuclei, binucleated cells and nuclear tails were quantified. Inorganic elements detected included the macro-elements Ca, P, Mg, Na, Cl, S and K as well as the micro-elements Fe, Al and Zn. Our study found similar values compared to previous studies determining the reference ranges of hematologic parameters in falcons. The only different value was observed in the relative number of monocytes. Thus, this study is the first approach to obtaining reference values of cytogenetic damage in this species and could be useful for future comparisons in biomonitoring studies. Keywords: Biological monitoring, basal DNA damage, falcon, reference value, hematology

In recent years, different organisms have provided information about environmental quality (Parmar et al., 2016). Birds of prey due to their great displacement capacity and to being at the top of the food chains are suited for monitoring purposes (Lodenius and Solonen, 2013). Top bird predators have been evaluated regarding exposure to pesticide, metal and other chemical substances (Lodenius and Solonen, 2013; de Wit et al., 2019; Aver et al., 2020; Frixione and Rodríguez-Estrella, 2020). In biomonitoring studies, it is possible to evaluate biomarkers at the molecular, cellular, morphological and physiological levels in different species. Among the available bioassays, there are several that are more invasive or less invasive to animals (Valdes, 2010). A technique that estimates the exposure level in DNA without having to sacrifice the organism exposed is the Erythrocyte Nuclear Abnormalities (ENA) assay. The ENA assay is considered a proper tool for detecting the DNA damage because its analysis includes micronuclei and the other nuclear alterations analyses (Gomes et al., 2015). Most studies about genotoxicity in birds include only micronuclei in analysis, excluding the other nuclear variations, which may be more frequent than micronuclei. Nuclei with smaller or larger evaginations, nuclei with vacuoles and nuclei with a deep slit are alterations that can also be observed (Carrasco et al., 1990; Quero et al., 2016; de Souza et al., 2017; de Faria et al., 2018; Silveira et al., 2022).Some birds of prey, such as Falco peregrinus, have adapted to using resources in urban areas. According to Pollack et al. (2017) these species provide information, especially about the widespread consequences of urbanization, giving an insight into its influence on animal behavior and physiology, as well as guiding investigations in humans. The aim of this study was to determine the frequency of micronuclei and other nuclear alterations in peripheral blood erythrocytes of Falco peregrinus, as a first approach to obtain reference values of cytogenetic damage in this species. Furthermore, knowledge was obtained regarding other physiological parameters, such as hematological analysis and the quantification of inorganic elements.All birds used in this study belong to Criatório Hayabusa - Consultoria Ambiental Ltda., a wildlife center and commercial breeder located in São Francisco de Paula (Rio Grande do Sul, Brazil). The area has approximately 48 ha and is considered to be in an excellent state of conservation, distant from urban areas and areas where crops are cultivated. The individuals are housed in outdoor aviary cages (4 m (width) x 4 m (height) x 4 m (length)) containing a couple of birds each. The birds had been captive for at least four years and were fed daily with Coturnix coturnix and water ad libitum. The sex of the birds was determined through external sexual size dimorphism, wherein the male can carry up to 50% less loads than the female (Mills et al., 2019). In addition, the bird’s age (juvenile/adult) was defined according to information on a metal ring.The procedures involving animals were conducted in compliance with the guidelines approved by the Committee on Ethics in the Use of Animals of the Universidade La Salle (CEUA-UNILASALLE, number 003/2017), and authorized by the Ministry of the Environment (MMA) through the Sistema de Autorização e Informação da Biodiversidade (SISBIO) for scientific activities (number 59921-1).Blood samples of 13 individuals, collected by the center’s veterinarian, were drawn from the ulnar vein of the wing using heparinised syringes. The samples were immediately smeared onto clean glass slides, where two slides were prepared per individual. The slides were sent to the laboratory. Remaining blood samples were also transported to the laboratories at below 8 ºC for the analysis of hematological and inorganic elements. The animals were identified as to sex and age (juvenile/adult). All the birds sampled were apparently healthy, without any signs of illness.In the laboratory, the slides were prepared according to Grisolia and Cordeiro (2000). At least 2,000 erythrocytes for each animal were scored using bright-field optical microscopy at a magnification of ×200-1000. Coded slides were blind-scored by a single observer. The presence of ENA was evaluated according to procedures by Carrasco et al. (1990) and Quero et al. (2016), using mature erythrocytes to estimate the frequency of the following nuclear lesions: (i) micronuclei (MN); (ii) nuclear buds (NBud); (iii) binucleated cell (BN); (iv) nuclear tails (NT); (v) nucleoplasmic (NB); and (vi) Notched (NO).The content of inorganic elements in the blood samples was analyzed by particle-induced X-ray emission (PIXE) (Johansson et al., 1995). As the PIXE system requires the use of solid samples, the blood samples were dried at 60 °C. Once dried, the samples were homogenized and pressed into 2 mm thick pellets before being placed in the target holder inside the reaction chamber (pressure about 10-5 mbar). A 3 MV Tandetron accelerator provided a 2.0 MeV proton beam with an average current of 3 nA at the target. The X-rays produced in the samples were detected by a Si(Li) detector with an energy resolution of ca. 150 eV at 5.9 keV. The spectra were analyzed with the GUPIX software package and the results were expressed in mg/g (Campbell et al., 2000). The same sample was evaluated in three independent analyses in order to obtain mean and standard deviation.The hematological evaluation was carried out in a commercial laboratory (BLUT’S Centro de Diagnóstico, Produtos e Serviços Veterinários, Porto Alegre-RS, Brazil) according to standard methods. Together with the results of the present study, information about other studies were taken as reference to interpret hematologic parameters.The normality of the variables was evaluated using the Kolmogorov-Smirnov test. To compare the parameters of the study population, Studentt-, and Mann-Whitney U non-parametric tests were used. The critical level for rejection of the null hypothesis was considered to be P < 0.05.The interspecific variations in the spontaneous frequencies of nuclear alterations are probably related to the intrinsic individual factors associated with ingestion, accumulation, metabolism and excretion of the xenobiotics to which the organism is exposed daily. Furthermore, the correct functioning of the DNA repair also could be involved in this interspecific response to DNA damage (Jha, 2004). Information on 13 animals sampled is presented in Female (n=7)Male (n=6)Total (n=13)Micronucleus1.29 ± 1.502.00 ± 1.261.62 ± 1.39Nuclear buds3.14 ± 2.341.5 ± 1.522.38 ± 2.10Nucleoplasmic bridges0.43 ± 0.5300.23 ± 0.44Nuclear tails1.14 ± 1.070.5 ± 0.550.85 ± 0.90Notched nuclei0.14 ± 0.380.33 ± 0.820.23 ± 0.60Binucleated cells1.29 ± 1.381.17 ± 1.941.23 ± 1.59Open in a separate windowMann-Whitney test to compare female and male. Data expressed in mean ± standard deviation. According to Zúñiga-González et al. (2001), species with the highest values of MNs basal frequency potentially could be useful for biomonitoring the possible effect of environmental mutagens. Birds of prey are sensitive indicators of environmental quality because they are particularly prone to bioaccumulate organic contaminants (Carneiro et al., 2016), including genotoxins. However, there is scarce information concerning spontaneous MN frequency in birds, mainly in birds of prey. In our study, the mean MN frequency was 0.8 per 1,000 erythrocytes analysed, values ​​higher than determined for Buteo albicaudatus and Polyborus plancus, that are other species of birds of prey of the Falconidae family. No micronucleus was found in Polyborus plancus while the rate for Buteo albicaudatus was 0.05 micronuclei (Zúñiga-González et al., 2001). In another study, Zúñiga-González et al. (2000) evaluated spontaneous micronuclei in birds of prey and did not observe MN in Accipiter cooperi, Polyborus plancus, Aquila chrysaetos, and Parabuteo unicinctus. For Falco sp. and Buteo sp. the MN frequencies were 0.14 and 0.02 respectively. Regarding other abnormalities evaluated by ENA assay, a rate of 1.19 NBud per 1,000 erythrocytes was counted. NBud reflects chromosomal instability and it is related to DNA amplification, DNA repair complexes and excess chromosomes due to aneuploid events (Fenech et al., 2011). There is no information concerning ENA frequencies in birds of prey. In birds, Quero et al. (2016), evaluating 17 different species of wild birds, observed that 80.9 % of the individuals presented at least one NBud with a rate of 0.10 to 0.95 ± 0.14/1000 erythrocytes. A high frequency of NBud (1.28/1000 cells) was observed in individuals of Aratinga canicularis exposed to water (negative control) (Gomez-Meda et al., 2006). This study evaluated the MN and NBud frequencies in birds exposed to mitomycin-C, suggesting that budding may reflect a wider spectrum of DNA damage than the MN formation. Thus, the authors proposed that estimating the NBud rate in routine hematological analysis could serve to establish basal values for the species and to evaluate environmental genotoxicity exposure.In our study, the individuals also presented NB and NT in their erythrocytes. Molecularly, these nuclear alterations could be formed by the same pathway (Anbumani and Mohankumar, 2015). When there is dicentric chromosome formation due to misrepair of DNA breaks, telomere end fusions or incorrect sister chromatid separation, this chromosome can be pulled to opposite poles of the cell during mitosis, producing the nucleoplasmic bridges (Fenech et al., 2011). It is also possible that a cytoplasmic constriction of the NB could result in a nuclear tail (Anbumani and Mohankumar, 2015). Falco peregrinus showed a rate of 0.12 nucleoplasmic bridge and 0.43 nuclear tails for 1000 erythrocytes. There are no previous studies including frequencies of these nuclear alterations in birds of prey. However, Quero et al. (2016) in different orders found a mean range between 0.01 and 0.20 for NB as well as 0.05 and 0.22 for NT in peripheral blood erythrocytes.In addition, the evaluation of NO cells in this work showed a mean frequency of 0.12/1000 erythrocytes. The mechanisms responsible for NO cell formation must be better understood, although de Faria et al. (2018) comment on nuclei with asymmetric constriction such as notched type that can be associated with damage in structures/proteins that leads to the cleavage of different nuclear and cytoskeleton proteins and to tubulin polymerization failure, for example. Quero et al. (2016) found mean nuclear alterations between 0.1 and 2.5 in birds analyzed, with results similar to those reported here.Erythrocytes with two nuclei present cytokinesis failure. BN cell formation is related to erroneous mitosis, where karyokinesis is not synchronized with cytokinesis (Coonen et al., 2004). In F. peregrinus the BN cell rate was 0.62/1000 cells. Regarding BN cells in birds, reported mean frequencies were between 0.05 and 0.40 for bird species (Quero et al., 2016).As to age and sex influence on spontaneous nuclear alterations, Shepherd and Somers (2012) have shown that these are important factors affecting background MN frequency. In their study, male birds had a 1.4- to 2.2-fold higher frequency of MN than females. In our research, all birds tested were adults and with regard to sex, NB cells were observed only in female individuals. Other authors showed that the sex of the birds did not affect nuclear alteration in the control group (de Souza et al., 2017).Inorganic elements detected in the blood of birds of prey included the macro-elements Ca, P, Mg, Na, Cl, S and K as well as the micro-elements Fe, Al and Zn (Figure 1). In Figure 1A it appeared that Na (4.25 mg/g) was the highest concentration, while Zn (0.018 mg/g) was the lowest element (Figure 1B). No difference was observed between male and female (P>0.05). Open in a separate windowFigure 1 -A and B) Levels of inorganic elements in blood samples of Falco peregrinus. Data expressed in mg/g, mean ± standard deviation.The analysis of elements, mainly metals in birds, has been an important tool to assess environmental pollution because human activities have increased the natural environment concentrations (Carneiro et al., 2016). In our study, the basal quantity of some macro and micronutrients was detected in the blood of captive birds of prey not exposed to contaminants. Carneiro et al. (2016), in a review about biomonitoring of metals and metalloids using raptors in Portugal and Spain, point out that the blood and liver samples were very frequently used the studies. Metals, such as Fe and Zn, were detected in bird blood in our study. Fe is needed in the hemoglobin production for the blood to carry oxygen. However, as the Fe homeostasis must be maintained, little iron in the diet can cause anemia in birds and too much can lead to iron storage disease (Cork, 2000). Zn is also an important micronutrient with physiologic benefits, including bone formation, immune function and normal functioning of the central nervous system. In birds, overexposure to zinc can result in anemia (Puschner and Poppenga, 2009). In our study, the findings indicate the presence of Al in the blood of birds of prey. The origin of Al found in the birds is as yet unknown due to an increase in the redistribution of this element in the environment as a result of human activities. This element is abundant in the Earth’s crust and is moved by natural and/or human activity. Atmospheric precipitation may be acidic, enhancing the Al leaching. However, levels of A1 below 0.1% generally do not have an adverse effect on the overall health of the animal, but higher levels may cause decreased growth rates and muscle weakness (Scheuhammer, 1987).Results of hematological values are summarized in Wernery et al. (2004) (n = 267), Muller et al. (2005) (n = 320) and Padrtova and Lloyd (2009) (n = 96). A different value was observed in the relative number of monocytes, where in the cited studies they range from 1.8 to 4.4, while in our study it was 10.75±4.81. In birds, monocyte cells can be confused with lymphocytes during cell count, and variations the results may reflect this difficulty (Ivins et al., 1986).Table 2 - Hematological values for Falco peregrinus and reference ranges of falcons from the literature.
Present studyReference 1Reference 2Reference 3
Red blood cells (x106/uL)2.88 ± 0.362.68 ± 0.233.35 ± 0.122.39 ± 0.26
Hemoglobin (g/dL)15.75 ± 1.4817.9 ± 1.115.3 ± 0.617.9 ± 1.6
Hematocrit (%)49.00 ± 5.29N.D.46 ± 2N.D.
MCV (fL)172.99 ± 28.52176.5 ± 10.3137.3 ± 4.2219.7 ± 25.4
MCHC (%)32.18 ± 28.5238.1 ± 2.0N.D.34.4 ± 1.5
Leukocytes (x103/uL)5.44 ± 1.215.63 ± 1.639.31 ± 3.247.55 ± 2.27
Platelets21.17 ± 6.96N.D.N.D.N.D.
PP (g/L)44.5 ± 6.22N.D.N.D.N.D.
Heterophils (%)66.75 ± 11.1769.9 ± 10.060.0 ± 10.049.9 ± 3.5
Lymphocytes (%)20.75 ± 7.9225.3 ± 9.237.4 ± 11.244.2 ± 3.4
Monocytes (%)10.75 ± 4.811.8 ± 1.62.6 ± 1.24.4 ± 1.6
Eosinophils (%)1.25 ± 1.711.9 ± 1.901.4 ± 1.1
Basophils (%)0.5 ± 0.711.1 ± 1.200.1 ± 0
Open in a separate windowMCV = Mean Corpuscular Volume; MCHC = Mean Corpuscular Hemoglobin Concentration; PP = Plasm Protein; Reference 1: Padrtova and Lloyd, 2009; Reference 2: Wernery et al 2004; Reference 3: Muller et al, 2005. N.D: Not determined. In addition, changes were observed in hematological parameters between birds of prey of different sex, where the relative numbers of basophils were higher in males. Oliveira et al. (2014), comparing males and females of Harpia harpyja, found some variation in the values of relative number of basophils, with values increased in females. According to Campbell (1994) the function of basophils in poultry is not fully elucidated.In order to evaluate environmental pollution using biomonitoring, it is essential to know the physiological parameters of the species studied, such as basal DNA damage, inorganic elements, and hematological values. In the present study, data on baseline MN and ENA frequencies for Falco peregrinus were first reported on captive species. Micronucleus, nuclear buds, nucleoplasmic bridges, notched nuclei, binucleated cells and nuclear tails were observed. Inorganic elements were also detected in the blood of bird of prey including macro and micro-elements as well, as hematological values. Thus, the data published in this study could be useful for future comparisons in biomonitoring studies and it can help the veterinarian in laboratory and clinical assessments of falcons kept in captivity in conservation programs.  相似文献   

15.
Inhibition of Lysine Acetyltransferase KAT3B/p300 Activity by a Naturally Occurring Hydroxynaphthoquinone, Plumbagin     
Kodihalli C. Ravindra  B. Ruthrotha Selvi  Mohammed Arif  B. A. Ashok Reddy  Gali R. Thanuja  Shipra Agrawal  Suman Kalyan Pradhan  Natesh Nagashayana  Dipak Dasgupta    Tapas K. Kundu 《The Journal of biological chemistry》2009,284(36):24453-24464
  相似文献   

16.
Ca2+/Calmodulin-dependent Protein Kinase IV Links Group I Metabotropic Glutamate Receptors to Fragile X Mental Retardation Protein in Cingulate Cortex     
Hansen Wang  Hotaka Fukushima  Satoshi Kida    Min Zhuo 《The Journal of biological chemistry》2009,284(28):18953-18962
  相似文献   

17.
The untapped cell biology of neglected tropical diseases     
William Sullivan 《Molecular biology of the cell》2016,27(5):739-743
  相似文献   

18.
A Systematic Proteomic Analysis of Listeria monocytogenes House-keeping Protein Secretion Systems     
Sven Halbedel  Swantje Reiss  Birgit Hahn  Dirk Albrecht  Gopala Krishna Mannala  Trinad Chakraborty  Torsten Hain  Susanne Engelmann  Antje Flieger 《Molecular & cellular proteomics : MCP》2014,13(11):3063-3081
  相似文献   

19.
In Vitro and In Vivo Oncogenic Potential of Bovine Leukemia Virus G4 Protein     
Pierre Kerkhofs  Hubertine Heremans  Arsène Burny  Richard Kettmann  Luc Willems 《Journal of virology》1998,72(3):2554-2559
  相似文献   

20.
The Atrazine Catabolism Genes atzABC Are Widespread and Highly Conserved     
Mervyn L. de Souza  Jennifer Seffernick  Betsy Martinez  Michael J. Sadowsky  Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.

Atrazine-catabolizing bacteria used in this study.

Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).

TABLE 1

Recently isolated atrazine-catabolizing bacteria
GenusStrainLocation where isolatedYr reported (reference)
PseudomonasaADPAgricultural-chemical dealership site, Little Falls, Minn.1995 (35)
RalstoniaaM91-3Agricultural soil, Ohio1995 (46, 55)
Mixed cultureBasel, Switzerland1995 (57)
ClavibacterAgricultural soil, Riverside, Calif.1996 (13)
AgrobacteriumJ14aAgricultural soil, Nebraska1996 (39)
NDb38/38Atrazine-contaminated soil, Indiana1996 (3)
AlcaligenesaSG1Industrial settling pond, San Gabriel, La.1997 (7)
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined. 

Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.

Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).

DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.

DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.

TABLE 2

Sequence identities of atzABC homologs from different atrazine-degrading bacteria
Strain% DNA sequence identitya
atzAatzBatzC
Pseudomonas ADP100100100
Alcaligenes SG199.2100100
Ralstonia M91-399.0100100
Agrobacterium J14a99.1100100
Isolate 38/3899.310099.8
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).

TABLE 3

Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compounds
GeneEnzymeAverage % protein sequence identitya (no. of pairwise comparisons)References
dhlA, dhaAHaloalkane dehalogenase25.0 (1)23, 31
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII2-Haloacid dehalogenase36.6 ± 3.9 (36)5, 25, 28, 29, 42, 43, 50, 59
tfdA2,4-Dichlorophenoxyacetate monooxygenase43.2 ± 4.6 (21)b34, 37, 38, 56, 58
dcmADichloromethane dehalogenase56.0 (1)4, 32
atzAAtrazine chlorohydrolase98.6 ± 0.12 (15)cThis study
atzBHydroxyatrazine ethylaminohydrolase100 (10)cThis study
atzCN-Isopropylammelide isopropylaminohydrolase99.0 ± 0.43 (10)cThis study
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation.  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号