共查询到20条相似文献,搜索用时 46 毫秒
1.
Lichenysins are surface-active lipopeptides with antibiotic properties produced nonribosomally by several strains of Bacillus licheniformis. Here, we report the cloning and sequencing of an entire 26.6-kb lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Three large open reading frames coding for peptide synthetases, designated licA, licB (three modules each), and licC (one module), could be detected, followed by a gene, licTE, coding for a thioesterase-like protein. The domain structure of the seven identified modules, which resembles that of the surfactin synthetases SrfA-A to -C, showed two epimerization domains attached to the third and sixth modules. The substrate specificity of the first, fifth, and seventh recombinant adenylation domains of LicA to -C (cloned and expressed in Escherichia coli) was determined to be Gln, Asp, and Ile (with minor Val and Leu substitutions), respectively. Therefore, we suppose that the identified biosynthesis operon is responsible for the production of a lichenysin variant with the primary amino acid sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile, with minor Leu and Val substitutions at the seventh position.Many strains of Bacillus are known to produce lipopeptides with remarkable surface-active properties (11). The most prominent of these powerful lipopeptides is surfactin from Bacillus subtilis (1). Surfactin is an acylated cyclic heptapeptide that reduces the surface tension of water from 72 to 27 mN m−1 even in a concentration below 0.05% and shows some antibacterial and antifungal activities (1). Some B. subtilis strains are also known to produce other, structurally related lipoheptapeptides (Table (Table1),1), like iturin (32, 34) and bacillomycin (3, 27, 30), or the lipodecapeptides fengycin (50) and plipastatin (29).
Open in a separate windowaFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of the C-terminal amino acid. bFA, β-hydroxy fatty acid. The β-hydroxy group forms an ester bond with the carboxy group of Asp5. cFA, β-amino fatty acid. The β-amino group forms a peptide bond with the carboxy group of the C-terminal amino acid. dOnly the following combinations of amino acid 1 and 5 are allowed: Gln-Asp or Glu-Asn. eWhere an alternative amino acid may be present in a structure, the alternative is also presented. In addition to B. subtilis, several strains of Bacillus licheniformis have been described as producing the lipopeptide lichenysin (14, 17, 23, 26, 51). Lichenysins can be grouped under the general sequence l-Glx–l-Leu–d-Leu–l-Val–l-Asx–d-Leu–l-Ile/Leu/Val (Table (Table1).1). The first amino acid is connected to a β-hydroxyl fatty acid, and the carboxy-terminal amino acid forms a lactone ring to the β-OH group of the lipophilic part of the molecule. In contrast to the lipopeptide surfactin, lichenysins seem to be synthesized during growth under aerobic and anaerobic conditions (16, 51). The isolation of lichenysins from cells growing on liquid mineral salt medium on glucose or sucrose basic has been studied intensively. Antimicrobial properties and the ability to reduce the surface tension of water have also been described (14, 17, 26, 51). The structural elucidation of the compounds revealed slight differences, depending on the producer strain. Various distributions of branched and linear fatty acid moieties of diverse lengths and amino acid variations in three defined positions have been identified (Table (Table11).In contrast to the well-defined methods for isolation and structural characterization of lichenysins, little is known about the biosynthetic mechanisms of lichenysin production. The structural similarity of lichenysins and surfactin suggests that the peptide moiety is produced nonribosomally by multifunctional peptide synthetases (7, 13, 25, 49, 53). Peptide synthetases from bacterial and fungal sources describe an alternative route in peptide bond formation in addition to the ubiquitous ribosomal pathway. Here, large multienzyme complexes affect the ordered recognition, activation, and linking of amino acids by utilizing the thiotemplate mechanism (19, 24, 25). According to this model, peptide synthetases activate their substrate amino acids as aminoacyl adenylates by ATP hydrolysis. These unstable intermediates are subsequently transferred to a covalently enzyme-bound 4′-phosphopantetheinyl cofactor as thioesters. The thioesterified amino acids are then integrated into the peptide product through a stepwise elongation by a series of transpeptidations directed from the amino terminals to the carboxy terminals. Peptide synthetases have not only awakened interest because of their mechanistic features; many of the nonribosomally processed peptide products also possess important biological and medical properties.In this report we describe the identification and characterization of a putative lichenysin biosynthesis operon from B. licheniformis ATCC 10716. Cloning and sequencing of the entire lic operon (26.6 kb) revealed three genes, licA, licB, and licC, with structural patterns common to peptide synthetases and a gene designated licTE, which codes for a putative thioesterase. The modular organization of the sequenced genes resembles the requirements for the biosynthesis of the heptapeptide lichenysin. Based on the arrangement of the seven identified modules and the tested substrate specificities, we propose that the identified genes are involved in the nonribosomal synthesis of the portion of the lichenysin peptide with the primary sequence l-Gln–l-Leu–d-Leu–l-Val–l-Asp–d-Leu–l-Ile (with minor Val and Leu substitutions). 相似文献
TABLE 1
Lipoheptapeptide antibiotics of Bacillus spp.Lipopeptide | Organism | Structure | Reference |
---|---|---|---|
Lichenysin A | B. licheniformis | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asn-D-Leu-L-Ile | 51, 52 |
Lichenysin B | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu | 23, 26 | |
Lichenysin C | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile | 17 | |
Lichenysin D | FAa-L-Gln-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Ile | This work | |
Surfactant 86 | B. licheniformis | FAa-L-Glxd-L-Leu-D-Leu-L-Val-L-Asxd-D-Leu-L-Ilee | 14, 15 |
L-Val | |||
Surfactin | B. subtilis | FAa-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu | 1, 7, 49 |
Esperin | B. subtilis | FAb-L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leue | 45 |
L-Val | |||
Iturin A | B. subtilis | FAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Ser | 32 |
Iturin C | FAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asne-L-Asne | 34 | |
D-Ser-L-Thr | |||
Bacillomycin L | B. subtilis | FAc-L-Asp-D-Tyr-D-Asn-L-Ser-L-Gln-D-Proe-L-Thr | 3 |
D-Ser- | |||
Bacillomycin D | FAc-L-Asp-D-Tyr-D-Asn-L-Pro-L-Glu-D-Ser-L-Thr | 30, 31 | |
Bacillomycin F | FAc-L-Asn-D-Tyr-D-Asn-L-Gln-L-Pro-D-Asn-L-Thr | 27 |
2.
3.
4.
Mervyn L. de Souza Jennifer Seffernick Betsy Martinez Michael J. Sadowsky Lawrence P. Wackett 《Journal of bacteriology》1998,180(7):1951-1954
Pseudomonas strain ADP metabolizes the herbicide atrazine via three enzymatic steps, encoded by the genes atzABC, to yield cyanuric acid, a nitrogen source for many bacteria. Here, we show that five geographically distinct atrazine-degrading bacteria contain genes homologous to atzA, -B, and -C. The sequence identities of the atz genes from different atrazine-degrading bacteria were greater than 99% in all pairwise comparisons. This differs from bacterial genes involved in the catabolism of other chlorinated compounds, for which the average sequence identity in pairwise comparisons of the known members of a class ranged from 25 to 56%. Our results indicate that globally distributed atrazine-catabolic genes are highly conserved in diverse genera of bacteria.Atrazine [2-chloro-4-(ethylamino)-6-(isopropylamino)- 1,3,5-triazine] is a herbicide used for controlling broad-leaf and grassy weeds and is relatively persistent in soils (51). Atrazine and other s-triazine compounds have been detected in ground and surface waters at levels exceeding the Environmental Protection Agency’s maximum contaminant level of 3 ppb (30).Microbial populations exposed to synthetic chlorinated compounds, such as atrazine, often respond by producing enzymes that degrade these molecules. Most of our current understanding of the genes and enzymes involved in atrazine degradation derives from studies using Pseudomonas strain ADP, in which the first three enzymatic steps in atrazine degradation have been defined (6, 14, 15, 48). The genes atz A, -B, and -C, which encode these enzymes, have been cloned and sequenced. Atrazine chlorohydrolase (AtzA), hydroxyatrazine ethylaminohydrolase (AtzB), and N-isopropylammelide isopropylaminohydrolase (AtzC) sequentially convert atrazine to cyanuric acid (6, 14, 15, 48) (Fig. (Fig.1).1). Cyanuric acid and related compounds are catabolized by many soil bacteria (10, 11, 17, 24, 26, 61), and by Pseudomonas sp. ADP, to carbon dioxide and ammonia (35). This provides the evolutionary pressure for the atzA, -B, and -C genes to permit bacterial growth on the more than one billion pounds of atrazine that have been applied to soils globally (20). Here we used a knowledge of the atzA, -B, and -C gene sequences to investigate the presence of homologous genes in other atrazine-degrading bacteria. In this study, we report that five atrazine-degrading microorganisms, which were recently isolated from geographically separated sites exposed to atrazine, contained nearly identical atzA, -B, and -C genes. Open in a separate windowFIG. 1Pathway for atrazine catabolism to cyanuric acid in Pseudomonas sp. strain ADP.
Open in a separate windowaIsolate identity based on 16S rRNA sequence analysis. bND, not determined.
Open in a separate windowaDNA sequences obtained from each strain by using the ataA, -B, and -C primers were compared with the atzABC gene sequences from Pseudomonas strain ADP. A review of the literature on other bacterial catabolic pathways indicated a much greater degree of divergence when genes encoding enzymes for the catabolism of other commercially relevant chlorinated compounds were compared (Table (Table3).3). As with atrazine, multiple bacterial strains that catabolize 1,2-dichloroethane, chloroacetic acid, 2,4-dichlorophenoxyacetate, dichloromethane, and 4-chlorobenzoate have been isolated. A comparison of the gene sequences encoding the initiating reactions in the catabolism of each of those compounds revealed that sequence divergence was comparatively high. In pairwise comparisons within each gene class, the average sequence identities ranged from 25 to 56% (divergence was 46 to 75%). With the atzABC genes, by contrast, there is at most a 1% sequence difference within the sequenced gene region (Table (Table2).2). Moreover, the atzB sequences were completely identical, and the atzC genes diverged by only 1 bp in one of the five strains tested. This suggests that the atz genes recently arose from a single origin and have become distributed globally. Similarly, identical parathion hydrolase genes were isolated from two bacteria representing different genera and global locations (40, 52, 53).
Open in a separate windowaAll possible pairwise alignments of translated gene sequences were made. The average percent identity is the mean of the percent identity values for all pairwise alignments ± standard error of the mean. bIncludes full protein sequences as well as partial protein sequences of ≥100 amino acids. cSequence identity within a 0.5-kb PCR product for atzA and -B and within a 0.6-kb PCR product for atzC. Six sequences were analyzed for atzA, and five were analyzed for atzB and -C. The data presented here provide further support for previous studies suggesting that hydroxyatrazine in the environment derives from biological processes (36), and not solely from abiotic reactions (2, 9). The present data, and a recent report by Bouquard et al. (8), indicate that the gene encoding atrazine chlorohydrolase is widespread in the United States and Europe.Our observations argue for a single, recent evolutionary origin of the atz genes and their subsequent global distribution. We have recently localized the atzA, -B, and -C genes to a large, self-transmissible plasmid in Pseudomonas strain ADP (12), and possible mechanisms of transfer of the atzABC genes are currently under investigation. 相似文献
Atrazine-catabolizing bacteria used in this study.
Until recently, attempts at isolating bacteria (18) or fungi (27) that completely degrade atrazine to carbon dioxide, ammonia, and chloride were unsuccessful. While several microorganisms were shown to dealkylate atrazine, they were unable to displace the chlorine atom (41, 54). Since 1994, several research groups have independently isolated atrazine-degrading bacteria that displaced the chlorine atom and mineralized atrazine (3, 7, 13, 35, 39, 46). Six of these bacterial cultures, listed in Table Table1,1, were studied here, and the Clavibacter strain had been investigated previously (13).TABLE 1
Recently isolated atrazine-catabolizing bacteriaGenus | Strain | Location where isolated | Yr reported (reference) |
---|---|---|---|
Pseudomonasa | ADP | Agricultural-chemical dealership site, Little Falls, Minn. | 1995 (35) |
Ralstoniaa | M91-3 | Agricultural soil, Ohio | 1995 (46, 55) |
Mixed culture | Basel, Switzerland | 1995 (57) | |
Clavibacter | Agricultural soil, Riverside, Calif. | 1996 (13) | |
Agrobacterium | J14a | Agricultural soil, Nebraska | 1996 (39) |
NDb | 38/38 | Atrazine-contaminated soil, Indiana | 1996 (3) |
Alcaligenesa | SG1 | Industrial settling pond, San Gabriel, La. | 1997 (7) |
Detection of atzA, -B, and -C homologs in atrazine-degrading microorganisms by PCR analysis.
Recently isolated atrazine-degrading bacteria were screened for the presence of DNA homologous to the Pseudomonas strain ADP atzABC genes, which encode enzymes transforming atrazine to cyanuric acid (Fig. (Fig.1).1). Total genomic DNA was isolated from each of these bacteria as described elsewhere (49), and the PCR technique was used to amplify sequences internal to the atzA, -B, and -C genes as described elsewhere (13). Custom primers were designed specifically for atzA (5′CCATGTGAACCAGATCCT3′ and 5′TGAAGCGTCCACATTACC3′), atzB (5′TCACCGGGGATGTCGCGGGC3′ and 5′CTCTCCCGCATGGCATCGGG3′), and atzC (5′GCTCACATGCAGGTACTCCA3′ and 5′GTACCATATCACCGTTTGCCA3′) by using the Primer Designer package, version 2.01 (Scientific and Educational Software, State Line, Pa.), and were synthesized by Gibco BRL (Gaithersburg, Md.). PCR fragments were amplified by using Taq DNA polymerase (Gibco BRL) (22) and were separated from primers on a 1.0% agarose gel. The results of these studies (Fig. (Fig.2)2) indicated that PCR amplification consistently produced DNA fragments of 0.5 kb for all organisms when the atzA or -B primers were used and fragments of 0.6 kb when the atzC primers were used. Open in a separate windowFIG. 2PCR analysis with primers designed to amplify internal regions of atzA (lanes 1 to 5), atzB (lanes 6 to 10), and atzC (lanes 11 to 15). The atrazine-degrading bacteria analyzed were Pseudomonas strain ADP (35) (lanes 1, 6, and 11), Alcaligenes strain SGI (7) (lanes 2, 7, and 12), Ralstonia strain M91-3 (46) (lanes 3, 8, and 13), Agrobacterium strain J14a (39) (lanes 4, 9, and 14), and isolate 38/38 (3) (lanes 5, 10, and 15). Values to the right of the gel are sizes (in kilobase pairs).Southern hybridization analyses were performed on the PCR-amplified DNA as described elsewhere (49) to confirm the presence of homologous DNA. We used a 0.6-kb ApaI/PstI fragment from pMD4 (15), a 1.5-kb BglII fragment from pATZB-2 (6), and a 2.0-kb EcoRI/AvaI fragment from pTD2.5 (48) as probes for atzA, -B, and -C genes, respectively. DNA probes were labeled with [α-32P]dCTP by using the Rediprime Random Primer Labeling Kit (Amersham Life Science, Arlington Heights, Ill.) according to the manufacturer’s instructions. Southern hybridization analyses, performed under stringent conditions, confirmed that each strain contained DNA homologous to atzA, -B, and -C (data not shown). With strain M91-3 and isolate 38/38, however, in addition to the expected 0.5-kb atzB PCR product (Fig. (Fig.2,2, lanes 8 and 10), a 1.2-kb fragment was also obtained. However, no hybridization to this fragment was seen with the atzB probe. Similar investigations showed that a mixed culture obtained from Switzerland (Table (Table1),1), capable of degrading atrazine, also contained DNA homologous to all three atz genes (12).As a negative control, bacteria known not to degrade atrazine were analyzed. PCR analyses were carried out with genomic DNA from the following randomly chosen laboratory strains: Rhodococcus chlorophenolicus (1), Flavobacterium sp. (47), Streptomyces coelicolor M145 (21), Amycolatopsis mediterranei (19), Agrobacterium strain A136 and strain A348 (A136/pTiA6NC) (60), Arthrobacter globiformis MN1 (45), Bradyrhizobium japonicum (33), Rhizobium sp. strain NGR 234 (44), Pseudomonas NRRLB12228, and Klebsiella pneumoniae 99 (16). None of these strains contained DNA that was amplified by PCR using the primers designed to identify the atzA, -B, or -C gene (data not shown).DNA sequences of atzA, -B, and -C homologs in atrazine-degrading microorganisms.
DNAs amplified from the five strains in Table Table11 with the atzA, -B, and -C primers were purified from gel slices by using the GeneClean II System (Bio 101, Inc., Vista, Calif.) and sequenced with a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corp., Norwalk, Conn.) and an ABI model 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). The GCG sequence analysis software package (Genetics Computer Group, Inc., Madison, Wis.) was used for all DNA and protein sequence comparisons and alignments. Table Table22 summarizes these data. The PCR-amplified genes were ≥99% identical to the Pseudomonas strain ADP atzA, -B, and -C genes in all pairwise comparisons of DNA sequences. This remarkable sequence identity suggested that each atz gene in the different genera was derived from a common ancestor and that they have diverged evolutionarily only to a limited extent.TABLE 2
Sequence identities of atzABC homologs from different atrazine-degrading bacteriaStrain | % DNA sequence identitya
| ||
---|---|---|---|
atzA | atzB | atzC | |
Pseudomonas ADP | 100 | 100 | 100 |
Alcaligenes SG1 | 99.2 | 100 | 100 |
Ralstonia M91-3 | 99.0 | 100 | 100 |
Agrobacterium J14a | 99.1 | 100 | 100 |
Isolate 38/38 | 99.3 | 100 | 99.8 |
TABLE 3
Sequence comparisons of isofunctional bacterial enzymes that catabolize chlorinated compoundsGene | Enzyme | Average % protein sequence identitya (no. of pairwise comparisons) | References |
---|---|---|---|
dhlA, dhaA | Haloalkane dehalogenase | 25.0 (1) | 23, 31 |
dehC, hadL, dehH, dehH1, dehH2, dhlB, dehCI, dehCII | 2-Haloacid dehalogenase | 36.6 ± 3.9 (36) | 5, 25, 28, 29, 42, 43, 50, 59 |
tfdA | 2,4-Dichlorophenoxyacetate monooxygenase | 43.2 ± 4.6 (21)b | 34, 37, 38, 56, 58 |
dcmA | Dichloromethane dehalogenase | 56.0 (1) | 4, 32 |
atzA | Atrazine chlorohydrolase | 98.6 ± 0.12 (15)c | This study |
atzB | Hydroxyatrazine ethylaminohydrolase | 100 (10)c | This study |
atzC | N-Isopropylammelide isopropylaminohydrolase | 99.0 ± 0.43 (10)c | This study |
5.
6.
7.
8.
Xiaowen Liu Yakov Sirotkin Yufeng Shen Gordon Anderson Yihsuan S. Tsai Ying S. Ting David R. Goodlett Richard D. Smith Vineet Bafna Pavel A. Pevzner 《Molecular & cellular proteomics : MCP》2012,11(6)
In the last two years, because of advances in protein separation and mass spectrometry, top-down mass spectrometry moved from analyzing single proteins to analyzing complex samples and identifying hundreds and even thousands of proteins. However, computational tools for database search of top-down spectra against protein databases are still in their infancy. We describe MS-Align+, a fast algorithm for top-down protein identification based on spectral alignment that enables searches for unexpected post-translational modifications. We also propose a method for evaluating statistical significance of top-down protein identifications and further benchmark various software tools on two top-down data sets from Saccharomyces cerevisiae and Salmonella typhimurium. We demonstrate that MS-Align+ significantly increases the number of identified spectra as compared with MASCOT and OMSSA on both data sets. Although MS-Align+ and ProSightPC have similar performance on the Salmonella typhimurium data set, MS-Align+ outperforms ProSightPC on the (more complex) Saccharomyces cerevisiae data set.In the past two decades, proteomics was dominated by bottom-up mass spectrometry that analyzes digested peptides rather than intact proteins. Bottom-up approaches, although powerful, do have limitations in analyzing protein species, e.g. various proteolytic forms of the same protein or various protein isoforms resulting from alternative splicing. Top-down mass spectrometry focuses on analyzing intact proteins and large peptides (1–10) and has advantages in localizing multiple post-translational modifications (PTMs)1 in a coordinated fashion (e.g. combinatorial PTM code) and identifying multiple protein species (e.g. proteolytically processed protein species) (11). Until recently, most top-down studies were limited to single purified proteins (12–15). Top-down studies of protein mixtures were restricted by difficulties in separating and fragmenting intact proteins and a shortage of robust computational tools.In the last two years, because of advances in protein separation and top-down instrumentation, top-down mass spectrometry moved from analyzing single proteins to analyzing complex samples containing hundreds and even thousands of proteins (16–21). Because algorithms for interpreting top-down spectra are still in their infancy, many recent developments include computational innovations in protein identification.Because top-down spectra are complex, the first step in top-down spectral interpretation is usually spectral deconvolution, which converts a complex top-down spectrum to a list of monoisotopic masses (a deconvolved spectrum). Every protein (possibly with modifications) can be scored against a top-down deconvoluted spectrum, resulting in a Protein-Spectrum-Match (PrSM). The top-down protein identification problem is finding a protein in a database with the highest scoring PrSM for a top-down spectrum and further output the PrSM if it is statistically significant. There are several software tools for top-down protein identification (Software Identification of unexpected modifications Proteogenomics search against 6-frame translation Speed Estimation of statistical significance ProSightPC +/−a + Fast/Slowb + PIITA +/− − Fast − UStag + + Fast − MS-TopDown + − Slow − MS-Align+ + + Fast +